|
Plant Physiol, September 2001, Vol. 127, pp. 173-183
Maize Genes Encoding the Small Subunit of ADP- Glucose
Pyrophosphorylase1
L. Curtis
Hannah,*
Janine R.
Shaw,
Michael J.
Giroux,2
Agnes
Reyss,
Jean-Louis
Prioul,
Jung-Myung
Bae,3 and
Jung-Youn
Lee4
Program in Plant Molecular and Cellular Biology, Horticultural
Sciences, University of Florida, P.O. Box 110690, 2211 Fifield Hall,
Gainesville, Florida, 32611 (L.C.H., J.R.S., M.J.G., J.-M.B., J.-Y.L.);
and Institut de Biotechnologie des Plantes, UMR8618,
Associé au Centre National de la Recherche Scientifique,
Structure et Métabolisme des Plantes, Bât. 630, Université de Paris-Sud, 91405 Orsay cedex, France (A.R.,
J.-L.P.)
 |
ABSTRACT |
Plant ADP-glucose pyrophosphorylase (AGP) is a heterotetrameric
enzyme composed of two large and two small subunits. Here, we report
the structures of the maize (Zea mays) genes encoding AGP small subunits of leaf and endosperm. Excluding exon 1, protein-encoding sequences of the two genes are nearly identical. Exon
1 coding sequences, however, possess no similarity. Introns are placed in identical positions and exhibit obvious sequence similarity. Size
differences are primarily due to insertions and duplications, hallmarks
of transposable element visitation. Comparison of the maize genes with
other plant AGP small subunit genes leads to a number of noteworthy
inferences concerning the evolution of these genes. The small subunit
gene can be divided into two modules. One module, encompassing all
coding information except that derived from exon 1, displays striking
similarity among all genes. It is surprising that members from eudicots
form one group, whereas those from cereals form a second group. This
implies that the duplications giving rise to family members occurred at
least twice and after the separation of eudicots and monocot cereals.
One intron within this module may have had a transposon origin. A different evolutionary history is suggested for exon 1. These sequences
define three distinct groups, two of which come from cereal seeds. This
distinction likely has functional significance because cereal endosperm
AGPs are cytosolic, whereas all other forms appear to be plastid
localized. Finally, whereas barley (Hordeum vulgare)
reportedly employs only one gene to encode the small subunit of the
seed and leaf, maize utilizes the two genes described here.
 |
INTRODUCTION |
The formation of ADP-Glc from
Glc-1-phosphate and ATP with the release of pyrophosphate is considered
the first committed step in the starch biosynthetic pathway. This key,
rate-limiting reaction is catalyzed by the enzyme ADP-Glc
pyrophosphorylase (AGP; EC 2.7.7.27). AGP isoforms occur in organisms
and tissues ranging from Escherichia coli to the potato
(Solanum tuberosum) tuber and the maize (Zea
mays) endosperm (for review, see Preiss and Romeo, 1994 ; Preiss
and Sivak, 1996 ; Hannah, 1997 ). Conventional mutant analysis and
antisense studies have highlighted the important role AGP plays in
starch synthesis both in photosynthetic and non-photosynthetic plant
tissues (Tsai and Nelson, 1966 ; Hannah and Nelson, 1976 ; Lin et al.,
1988a , 1988b ; Smith et al., 1989 ; Hylton and Smith, 1992 ; Muller-Rober
et al., 1992 ; Singletary et al., 1997 ).
Cloning and sequencing of Sh2 and Bt2 and
analysis of informative mutants (Bae et al., 1990 , Bhave et al., 1990 )
of maize endosperm transcripts and genes showed that both loci encode
subunits of AGP. Bt2 encodes the small subunit, whereas the
large subunit is derived from Sh2. The two proteins are
similar to each other and also to the subunit of the homotetrameric
E. coli AGP. This suggests that the two complementary plant
genes arose from an early gene duplication event (Bhave et al., 1990 ).
Although similar in sequence, the subunits are not interchangeable.
Active maize endosperm AGP formation requires both subunits (for
review, see Hannah 1997 ).
Sequence analysis of AGP structural genes from other plants confirmed
the universal nature of heterotetrameric plant AGPs. Plant AGPs are
composed of subunits of dissimilar size and genetic origin (for review,
see Smith-White and Preiss, 1992 ), whereas a somewhat active enzyme
containing only the small subunit can be formed when the small subunit
gene of the potato tuber or barley (Hordeum vulgare)
endosperm is expressed in E. coli or in insect cells
(Ballicora et al., 1995 ; Doan et al., 1999 ) or following mutagenesis of
the potato small subunit (Greene et al., 1998 ). Conditions required for
homotetrameric activity, however, are likely non-physiological.
Following the duplication forming what are now complementary AGP
structural genes, other duplications likely occurred giving rise to the
genes expressed in the various plant tissues. For example, early
enzymological and genetic studies pointed to expression of different
batteries of AGP structural genes in the maize endosperm, embryo, and
leaf (Preiss et al., 1971 ; Hannah and Nelson, 1976 ; Fuchs, 1977 ; Bryce
and Nelson, 1979 ). The tissue-specific nature of AGP expression was
confirmed by subsequent molecular investigations (Giroux and Hannah,
1994 ; Prioul et al., 1994 ; Giroux et al., 1995 ). These latter studies
also detected a second set of AGP structural genes expressed in the
endosperm. This second endosperm AGP is expressed at low levels and
definitive proof for its presence came only through analysis of null
sh2 and bt2 mutants (Giroux and Hannah, 1994 ). As
in the case of maize, multiple forms of AGP have been found in many if
not all plants examined in sufficient detail; for example, wheat
(Triticum aestivum) (Olive et al., 1989 ), potato (Okita et
al., 1990 ; La Cognata et al., 1995 ), tomato (Lycopersicon
esculentum; Chen and Janes, 1997 ), barley (Villand et al.,
1992 ), rice (Oryza sativa; Nakamura and Kawaguchi, 1992 ), Arabidopsis (Villand et al., 1993 ), Vicia faba (Weber et
al., 1995 ), pea (Pisum sativum; Burgess et al., 1997 ), and
sweet potato (Ipomoea batatas; Bae and Liu, 1997 ).
Although a multitude of genes encode the small subunit and the large
subunit of AGP, early sequence data (compiled by Smith-White and
Preiss, 1992 ) clearly showed less sequence heterogeneity within members
of the small subunit gene family compared with those of the large
subunit class. Interpretation of this result is not obvious because
mutation in either subunit can affect both the kinetic and the
allosteric properties of AGP (for review, see Hannah, 1997 ). Hence, the
genes encoding both subunits should be under the same evolutionary constraints.
One explanation for the lack of sequence heterogeneity within at least
two members of the small subunit family was recently suggested by
Thorbjornsen et al. (1996a) . They reported that a single barley gene
encodes both the endosperm and leaf AGP small subunit. Two different
sequences serve as the first exon of the respective genes and the use
of two promoters or alternative splicing then provides the two
different mature transcripts.
Another observation resulting from the barley sequence analysis was the
absence of signal peptide. This observation raises the issue of enzyme
localization (Thorbjornsen et al., 1996b ). As reviewed below, genetic,
biochemical, molecular, and localization studies point to
extraplastidal location in maize and barley kernels.
Here, we initially asked whether maize employed one gene to encode both
the leaf and endosperm AGP small subunit. In contrast to the single
gene reported in barley, we detected two separate genes in maize for
the leaf and endosperm AGP small subunits. Except for exon 1, the maize
genes exhibit obvious sequence similarity in exons and introns.
Sequence similarity in introns may point to a fairly recent duplication
giving rise to these two genes. Much of the sequence divergence within
introns likely was caused by transposable element visitation. In
contrast to the rest of the gene, exon 1 sequences are more divergent
and appear to have a different origin compared to the rest of the gene.
Within cereal endosperms, the first exon likely has had two independent
origins. Finally, from comparison of sequenced plant genes, the
duplications giving rise to the rest of the gene likely did not occur
until after the evolutionary separation of monocots from eudicots.
 |
RESULTS |
Gene Nomenclature
The brittle-2 (Bt2) gene of maize was named
for the phenotype resulting from loss of its activity. Subsequent work
showed that it encoded the smaller subunit of the major,
endosperm-specific AGP. Because the gene encoding the smaller subunit
of the leaf AGP is not associated with a mutant phenotype, we term this
gene Agpslzm (AGP, small, leaf, Zea mays). This
abbreviation replaces L2 we used previously (Prioul et al., 1994 ),
encapsulates nomenclature of AGP, and renders the necessary plant and
tissue specificity. Likewise, we replace AGP2, the term we (Giroux and
Hannah, 1994 ) used previously for the cloned embryo small subunit, with
Agpsemzm.
Determination of Bt2 and Agpslzm
Structures
Fragments from partial cDNA clones of Bt2 and
Agpslzm reported previously (Bae et al., 1990 ; Prioul et
al., 1994 ) were used in primer extension experiments with endosperm or
leaf RNA to ascertain 5' sequences of corresponding transcripts.
Corresponding genomic clones isolated by conventional hybridization,
harbor sequences matching those of the mature transcripts. Two
Agpslzm genomic clones from separate maize lines were
sequenced. Resulting sequences were identical in a 5,026-bp overlap
that encompasses all exons and introns.
Introns of Bt2 and Agpslzm
Both Bt2 and Agpslzm consist of nine introns
and 10 exons (Table I). Introns occur in
identical positions in both genes. Moreover, corresponding introns of
approximately the same size exhibit much sequence similarity (Table
I).
Those introns differing in size exhibit alterations that are hallmarks
of transposable elements. Straightforward examples of this are shown in
Figure 1. Introns 5 are 85% identical
and, with one exception, differ only by single base substitutions
principally in the central portion of the intron. The extra bases in
intron 5 of Agpslzm likely were derived by an internal
duplication involving an inversion. Introns 6 (83% identical) and 7 (82% identical) of Bt2 and Agpslzm differ in
size by incorporation of relatively short internal repeats. More
complex footprints occur as well (Fig.
2). The second introns of Bt2
and Agpslzm are nearly identical except for the central
portion. Bt2 contains a duplicated, partially overlapping
28-bp sequence. A repeating AG motif of 180 bp follows the duplication.
Finally, four relatively short direct repeats terminate the sequence
unique to Bt2.

View larger version (40K):
[in this window]
[in a new window]
|
Figure 1.
Agpslzm (abbreviated here and below as
Asl to conserve space) and Bt2 introns though consistent in
placement vary in length. Comparison of the three most conserved
introns indicates the size differences are due to insertions of
duplicated sequence, a hallmark of transposable element visitation. The
duplicated sequences are in bold and orientation is shown by
arrows.
|
|

View larger version (49K):
[in this window]
[in a new window]
|
Figure 2.
Intron 2 of Agpslzm and Bt2
has the greatest variation in size with Bt2 913 bp larger
than Agpslzm. Duplicated sequences are denoted by arrows and
bold type. The long overlapping duplication (long arrows) in
Bt2 bears some similarity to a sequence present in both
genes (indicated by bold type with no arrow). Bt2 also
contains a long AG repeat, underlined.
|
|
A more complicated series of rearrangements is found in intron 3 (Fig.
3.) A fragment of 274 bp, unique to
Bt2, contains a series of direct and inverted duplications.
In one case, labeled duplication 6, each duplicate is actually composed
of two tandem inverted repeats. Searches of GenBank (October
2000) with the sequence delimited by and including the left
member of duplication 1 and the right member of duplication 9 showed
that sequences of greatest similarity were located on several rice
chromosomes. Arabidopsis sequences were not detected. This suggests
that this sequence represents a repetitive element possibly unique to
monocots or cereals.

View larger version (44K):
[in this window]
[in a new window]
|
Figure 3.
Though Agpslzm and Bt2
introns vary in length, the shorter intron sequence can be found in the
terminal portions of the longer intron. The internal sequence of the
longer intron contains duplications such as the complex sequence shown
here in intron 3. These duplications may be due to successive
insertions and excisions of transposable elements. Arrows with
identical numbers indicate duplicated sequences. Duplicated sequences
are in bold.
|
|
Splicing of Bt2 and Agpslzm Introns Uses
Consensus Splice Sites
All introns begin and end with the consensus dinucleotide pairs,
GT and AG. This is relevant because Anderson et al. (1991) reported
that intron 2 of a rice AGP small subunit gene began with CA and ended
with CC. Intron 2 and adjoining exon sequences of the rice gene,
Bt2, Agpslzm, the potato small subunit gene, and the
Arabidopsis gene for the small subunit are shown in Figure 4. Aside from a T missing in the rice
gene, the three cereal genes are virtually identical. We also note that
the sequence TCAGG is duplicated at the termini of the cereal introns.
This duplication precludes definitive identification of the exact
splice sites, but we note that an intron beginning with GT and ending
with AG can be identified in the Bt2 and Agpslzm
genomic sequences as well as in the potato sequence. The duplication,
however, does allow for a number of non-consensus termini in the rice
intron. At present, it is unknown whether splicing of this rice intron follows nonconventional patterns of splicing and, if so, which sequences actually terminate the intron or whether the sequence reported is in error. It is interesting that one member of this gene
family, from Arabidopsis, lacks this intron as well as one member of
the duplication.

View larger version (11K):
[in this window]
[in a new window]
|
Figure 4.
Intron 2 splice junctions and flanking exon
sequences from rice, Bt2, Agpslzm, potato, and
Arabidopsis. Spaces have been placed between codon triplets in the
exons. Bolded letters indicate the duplicated sequence.
|
|
Coding Regions of Bt2 and Agpslzm
Exons 2 through 9 of brittle-2 and Agpslzm
are of the same size and are identical at 96% of the corresponding bp.
Exons 10, which lack protein coding information, exhibit approximately
79% similarity. Both genes initiate translation in exon 1 and
termination is near the 3' terminus of exon 9. As discussed below, the
high GC content of Agpslzm exon 1 prevented unequivocal
determination of the start of transcription and translation. Hence, the
provisional start of translation is inferred from comparison with the
translation start site of the barley leaf small subunit gene. We do not
know the full extent of Agpslzm exon 1; however, the
location of the presumed ATG is 255 bp 5' of the 3' terminus of exon 1 and the closest possible TATA sequence is 283 bp upstream from the ATG. Bt2 exon 1 is 153 bp in length with a TATA box 34 bp
upstream of the start of transcription.
Exons 1 of AGP Small Subunit Genes Exhibit Striking Sequence
Dissimilarity
Exons 1 of Bt2 and Agpslzm show little to no
similarity at either the DNA or amino acid level whereas they differ at
only 14 of the 434 amino acids encoded by exons 2 to 9 (97% identity). This pattern of sequence similarity is consistent across all AGP small
subunits in GenBank as well as the maize embryo form, now termed
Agpsemzm (accession no. AY032604). The peptides encoded by
the first exons are highly variable, whereas the rest of the proteins
are virtually identical. Amino acids encoded by exon 1 and the 5'
portion of exon 2 of a number of AGP small subunit genes are shown in
Figure 5.

View larger version (75K):
[in this window]
[in a new window]
|
Figure 5.
AGP small subunit sequences aligned relative
to BT2 demonstrate the vast dissimilarity in variation of sequences
encoded by exon 1 and exon 2. Sequences from GenBank are identified by
plant name and accession no. indicates the placement of intron 1. Hyphens indicate gaps in the sequence. Dots identify amino acids
identical to those of BT2. All of exon 1-encoded sequences and one-half
of exon 2 are shown. The remainder of the proteins exhibits the degree
of similarity found in exon 2. Sequences were aligned using the program
for multiple sequence alignment at
http://www.toulouse.inra.fr/multalin.html.
|
|
Some similarities can be found in exon 1. Agpslzm, Agpsemzm,
and the other monocot leaf and eudicot genes display discernible conserved motifs. These sequences likely reflect coding information for
transit peptides. In contrast, Bt2 and the seed sequences from the other cereals have few similarities and, in all likelihood, lack transit peptides (see below). Finally, we note that barley, wheat,
and rice seed small subunits share similarities not found in
Bt2.
Exons 1 Define a Phylogenetic Tree Different from the Rest of the
Gene
Because of the demarcation in similarity exhibited by the
two portions of the small subunit genes, phylogenetic relationships of
each section were determined separately. A phylogenetic tree resulting
from the comparison of exon 1-encoded peptides consists of three main
branches (Fig. 6). The Bt2
peptide is the only representative of one of these branches. The
other monocot seed/endosperm sequences lie on the second branch,
whereas all other sequences cluster at the end of the third branch. The
percent accepted mutation distance analysis found no similarity between
Bt2 and any of the other exon 1 encoded peptides. There was
also no detectable similarity between the monocot seed small subunit
and the other sequences.

View larger version (13K):
[in this window]
[in a new window]
|
Figure 6.
Unrooted phylogenetic trees of comparison of
peptides encoded by the first exons only (A) and the remainder of the
genes (B). Trees were prepared using all against all comparisons of the
following proteins: maize Bt2 (endosperm), maize
Agpslzm (leaf), maize Agpsemzm (embryo), barley
Z48563 (endosperm), barley Z48562 (leaf), potato X61186 (tuber),
Arabidopsis U70616, beet (Beta vulgaris) X78899 (tap
root), citrus (Citrus unshiu) AF184597, melon (Cucumis
melo) AF030382 (mature fruit), pea X96764 (cotyledon), pea X96765
(cotyledon), potato L36648 (leaf), rice J04960 (seed), rice P15280
(endosperm specific), sweet potato Z79635 (tuberous root and leaf),
sweet potato Z79636 (tuberous root and leaf), tomato L41126 (fruit),
V. faba P52416 (cotyledon), V. faba
P524167 (cotyledon), watermelon (Citrullus lanatus) AF032471
(fruit), and wheat X66080 (developing grain). The Internet site for the
all against all related peptide sequence comparison was from the
Computational Biochemistry Research Group Server of ETHZ at
http://cbrg.inf.ethz.ch/subsection311.html. Resulting PostScript files
were visualized using Aladdin Ghostscript 5.50 found at
http://www.cs.wisc.edu/~ghost/aladdin/get550.html. Scales of A and B
differ.
|
|
In contrast, the tree generated using the remaining coding sequences
(exons 2-9) contains only two main branches. Overall, the percent
accepted mutation distances in these comparisons are much smaller than
those in the monocot leaf, Agpsemzm, eudicot cluster in the
exon 1 tree. An interesting feature of this tree is the separation of
monocots and eudicots. This tree is nearly identical to one resulting
from the whole protein (data not shown) as well as trees developed via
Phylip programs.
 |
DISCUSSION |
We initially asked whether the closely related plants, maize and
barley, exhibit the same form of genetic control of the leaf and
endosperm small subunit AGPs. Whereas one gene in barley has been shown
to encode subunits expressed in both the leaf and seed, we report here
that two different genes are employed in maize. Whether the barley gene
is also contained within the maize genome cannot be ascertained at this
time; however, screening of approximately 560,000 expressed sequence
tags in the Pioneer/DuPont database (T. Helentjaris and C. Zinselmeier,
personal communication) failed to detect any similarity to the first
exons of the barley gene. Based on extant data, it appears that maize
and barley exhibit a fundamental difference in their genetic control of
two of the AGP small subunits.
A number of interesting inferences can be gleaned about the possible
evolution of the AGP small subunit genes from perusal of the genes
encoding this protein.
First, sequence variation within the genes is not randomly distributed.
The vast majority of sequence diversity lies in the 5' portion of the
genes. For example, exon 1 and intron 1 of Agpslzm bear no
similarity to their counterparts in Bt2, but beginning in
exon 2, 97% of corresponding amino acids and 95.5% of corresponding coding sequences are identical. Identity of third positions of codons
is also quite high, 90%. This similarity extends into the introns as
well. Of the three introns not disturbed by insertions/deletions, 83.5% of the sequences are identical.
Some, but not all, of the variation at the N terminus likely is
associated with the fundamental dichotomy in cell localization among
the AGPs. The data presented here show that exon 1 coding sequences
clearly separate endosperm and nonendosperm AGP small subunits.
Although AGP is in the chloroplasts of spinach (Spinacia
oleracea) leaves (Okita et al., 1979 ) and in the amyloplast of
potato tubers (Kim et al., 1989 ), recent protein (Giroux and Hannah, 1994 ; Villand and Kleczkowski, 1994 ), genetic (Cao et al., 1995 ; Shannon et al., 1996 ), and cell fractionation studies (Denyer et al.,
1996 ; Thorbjornsen et al., 1996b ) provide strong arguments for a
cytosolic localization of AGP activity in cereal endosperms. This
localization is consistent with immunocytological studies in maize
endosperm (Brangeon et al., 1997 ). Furthermore, Choi et al. (2001)
recently transformed tobacco with constructs expressing the N terminus
of BT2 fused to the green flourescent protein. The BT2 N terminus did
not target the green flourescent protein to the plastid. Finally,
Beckles et al. (2001) have concluded that a cytosolic location for AGP
is a feature of graminaceous endosperms but not of other starch-storing
organs. The clear distinction in exon 1 coding sequences reported above
most likely reflects differences in intracellular targeting.
Second, although the sequences of all plant AGP small subunit genes are
not available, the present data suggest that this gene appears to have
evolved as two separate modules. Exon 1 represents one module, whereas
exons 2 through 10 represent the second module. Cereal endosperm genes
define exclusively two of the three exon 1 branches. This strongly
points to two independent origins of exon 1 in the genes encoding the
endosperm AGP small subunit.
Particularly interesting in this regard are the three maize genes
encoding the small subunit. Exon 1 similarities place the embryo and
leaf genes in one group, whereas the similarities in the remaining
coding region place the leaf and endosperm genes into one category.
Separate evolutionary histories are clearly suggested.
Third, although the coding region from exon 2 through 9 exhibits strong
conservation, the variation within this sequence suggests that
duplications giving rise to the small subunit family members expressed
in the various tissues occurred at least twice during plant evolution.
Further, these duplications most likely occurred after the evolutionary
separation of eudicots and cereals. For example, note that the gene
most closely related to the maize form of the leaf small subunit,
Agpslzm, is the maize endosperm gene. The same relationship
holds for the two cloned sweet potato genes. In contrast, the only case
for a gene duplication occurring before plant speciation can be made
for the genes of pea and fava bean. The extant data strongly point to
at least two if not more independent sets of duplications of the
progenitor gene. At least some of these duplications apparently
occurred after the evolutionary separation of monocots and eudicots.
Some gene features, however, suggest an alternative relationship. We
note the pronounced similarity of genes isolated from individual plant
species as well as the high level of sequence identity exhibited by
Bt2 and Agpslzm in internal regions of some introns and in third positions of codons genic regions not normally thought to be under evolutionary pressure. These features suggest that
sequences of small subunit genes may be homogenized, perhaps by gene
conversion or related mechanisms involving nonallelic genes.
However, this model does not explain the conspicuous separation of eudicots from cereals, would have to be limited to only certain regions of the gene, and does not account for the diversity separating Agpsemzm from Bt2 and Agpslzm. Rather,
we favor the hypothesis that the close sequence identity detailed here
reflects relatively recent duplications.
The pattern of gene duplications inferred for the small subunit of AGP
differs markedly from that of other genes. For example, duplications of
the genes encoding Suc synthase, an enzyme involved in the same pathway
and expressed in the same tissues, appear to be much more ancient (Shaw
et al., 1994 ). Furthermore, genes encoding the large subunit of AGP
also exhibit much more sequence diversity compared with those of the
small subunit (Smith-White and Preiss, 1992 ).
Fourth, we note that intron 2 is not present in all gene family
members. This polymorphism, coupled with the sequences at its
exon-intron borders, suggests an interesting origin for this intron as
described below.
Two theories explain the relative ages of exons and introns (for
review, see Giroux et al., 1994 ). In the intron early hypothesis, introns came before genes, are ancient, border exons encoding functional domains of the resulting proteins, and were used in evolution to shuffle common exons into different genes. These introns
were then lost in the vast majority of prokaryotic genes in the
streamlining of their rapidly dividing genomes. An alternative explanation, "introns late," is that intron creation is a
relatively late event occurring after the formation of functional
genes. Transposons are usually considered the probable cause. Giroux et
al. (1994) expanded on the "introns late" theory and noted that
transposon insertions that duplicate certain host sequences can give
rise to introns. The duplicate origin of intron termini explains at
least some of the consensus sequences in the intron/exon borders. It is
intriguing that those AGP genes having intron 2 also contain the
duplication TCAGG. The last base of 5' duplication is the terminal base
of the intron donor site and the AG of the 3' duplication terminates
the intron. Splicing then would remove the insertion and effectively
one copy of the duplication.
Finally, we note a possible relationship between AGP sequence and
function. Endosperm AGPs generally exhibit less activation by the
sugar, 3-phos-phoglyceric acid, compared with AGPs from leaves,
tubers, and embryos (for review, see Hannah, 1997 ). Sequence data
summarized here show that AGPs with increased 3-PGA sensitivity contain
more similar exon 1 sequences compared with other AGPs. These data
point to the possible importance of the small subunit N terminus in
controlling the allosteric properties of AGP. This is presently under test.
 |
MATERIALS AND METHODS |
Structure of the Brittle2 Mature Transcript
The sequence of the partial 1.7-kb Bt2 cDNA clone
published earlier (Bae et al., 1990 ) was completed using methods
described therein. The 5' end of the Bt2 transcript was
determined by direct sequencing of the reverse transcriptase products
synthesized with gene-specific primers. The primer complementary to the
cDNA sequence, TTG GCT GCT CGG CGG CGG TGG CAT TCC ATG GCG G, was 5'
end labeled with [ -32P]ATP (specific activity 5,000 Ci
mmol 1, NEN, Boston) and T4 polynucleotide kinase (Life
Tech, Rockville, MD) basically by the methods of Sambrook et al. (1989)
and purified via two rounds of ethanol precipitation.
Poly(A+) RNA was extracted from 22-d-old
sh2-R endosperms by the method of McCarty (1986) . The
Bt2 transcript is enhanced in sh2-R endosperms.
Following annealing, primer extension was performed with Moloney-Murine
Leukemia Virus Reverse Transcriptase (Life Tech) in the presence of
RNasin (Promega, Madison, WI) in conventional dideoxy sequence
reactions. Sequences of resulting DNA fragments were read on 8% (w/v)
polyacrylamide gels.
Structure of the Bt2 Gene
Bt2 genomic clones were isolated from a CLONTECH
(Palo Alto, CA)-prepared library of B73 DNA isolated at the two-leaf
stage. A partial MboI digest cloned into the
BamHI site of EMBL3 was probed with the most 5' 168 bp of Bt2 cDNA. The probe was prepared by PCR using the
Bt2 cDNA clone as template with the pUC19 T7/T3 primer
(5' AAC AGC TATGAC CAT G 3') and a gene-specific primer located 148 to
168 bp from the 5' terminus (5' GAT TCC AAG AAC ACT ATC ATG 3'). The
resulting fragment, corresponding to 153 bp of exon 1 and 15 bp of exon
2, hybridizes to a single fragment on maize (Zea mays)
genomic Southerns and exhibits little if any sequence similarity to
other plant AGP small subunits.
Five genomic clones were isolated from screening 150,000 plaques.
Partial restriction mapping of these clones at the 5' terminus of
Bt2 was performed by use of a probe from the 5'-most 327 bp of Bt2 cDNA. This probe was isolated via PCR from the
Bt2 cDNA clone using the pUC19 T7/T3 primer with a
gene-specific primer (5' GTT AAA TTG CGT TAG CAC ATA 3') located 307 to
327 bp from the transcription start site. Two clones, overlapping in
the region encompassing exon 1, were chosen for subsequent sequence
analysis. Fragments were subcloned into pUC19 and pSPORT vectors (Life
Tech) and were sequenced as described below. The Bt2
gene has been deposited in GenBank (accession no. AF334959).
Structure of the Agpslzm Gene
Maize cv Black Mexican Sweet genomic DNA from a single plant was
partially digested with Sau3A and fractionated on a 5%
to 24% (w/v) NaCl gradient. Three fractions containing DNA of
10 to 20 kb were pooled and ligated to BamHI-cut
EMBL3 vector and packaged as in McCarty et al. (1986) . The resulting
library was probed with Bt2 cDNA to extract the
Agpslzm genomic clone. This was subsequently cloned into
pSPORT using the SalI sites in the lambda's polylinker regions.
A second genomic clone was obtained by screening a genomic library
(CLONTECH FL1030 D) prepared with DNA of 7-d-old leaves of maize W22.
This library was cloned into the BamHI site of EMBL3 after complete digestion with MboI. Both bacterial
strains Escherichia coli NM539 and NM 538 were used as
hosts following CLONTECH instructions. The partial (0.7 kb) cDNA clone
described in Prioul et al. (1994) was used as a probe. The 0.2-kb leaf
specific region at its 3' terminus was used to distinguish
Bt2 and Agpslzm genomic clones. A 10-kb
Agpslzm genomic clone was subcloned into the
SalI site of pUC19 and propagated in DH5 E.
coli cells. PstI and HindIII fragments were subcloned into pUC18 and sequenced.
Sequencing
Some of the DNA sequencing was done at the University of
Florida, Interdisciplinary Center for Biotechnology Research (ICBR) DNA
Sequencing Core Laboratory (Gainesville), using ABI Prism Dye
Terminator sequencing protocol developed by Applied Biosystems (Foster
City, CA) and gene-specific probes synthesized by the ICBR DNA
Synthesis Core or Life Technologies (Rockville, MD). Double-stranded
sequencing employing pUC19 or pSPORT clones used the dideoxy method and
Sequenase (USB, Cleveland). In some cases, radiolabeled dCTP and
autoradiography were utilized. Some sequencing employed amplification
in a GeneAmp PCR System 9600 (Perkin Elmer, Foster City, CA) and a 373 DNA Sequencer Stretch (Applied Biosystems).
Structure of the Agpslzm Mature Transcript
cDNA Analysis (RT-PCR)
The sequence of the Agpslzm transcript was
determined from total RNA isolated from W64A × 182E maize leaves
using Trizol reagent (Life Technologies) following the manufacturer's
protocol. Exons 2 through 7 were amplified using 4 µg of total RNA, a
3' gene-specific primer (L2UDGRTR, CAU CAU CAU CAU GAT ATG CAA GAA CGG
AGT CC) derived from the cDNA sequence previously published (Prioul et al., 1994 ) and Life Technologies SuperScript Preamplification System to
prepare first strand cDNA. This was used subsequently as template for
PCR amplification with the same 3' primer, a 5' gene-specific primer of
sequence from exon 2 (L2UDGRTF, CUA CUA CUA CUA CTC GGA GGT GGT GCT GGG
AC) and Taq DNA polymerase. The resulting product was
purified for sequencing using Ultrafree-MC 30,000 NMWL filter units
(Millipore, Bedford, MA).
Amplification of the GC-rich exon 1 was attempted using Thermostable
rTth Reverse Transcriptase RNA PCR Kit (PEBiosystems, Foster City, CA). First strand cDNA was prepared using 360 ng W64A × 182E leaf total RNA and either 3' primer L2GSP2 (CCC GTA GGC TCT TGA
GAG GTG ACG G) or L2GSP3UDG (CAU CAU CAU CAU GCG TCG GGG TCG AGG CAG
GTC TGG G). The hot start technique of the kit protocol was followed:
template DNA, primer, and buffer were incubated at 70°C for 5 min
before addition of nucleotides, enzyme, and MnCl2. The
70°C incubation was then continued for 15 min. PCR amplification
following the kit protocol was performed using the same 3' primer and a
5' primer designed around the hypothesized transcription start site
(L2ATGUDGGSP, CUA CUA CUA CUA GAG CAA TGG CGA TGG CAG CC). Products
from the L2GSP3UDG/L2ATGUDGGSP amplification reaction were purified
using Millipore's Ultrafree-MC 30,000 NMWL filter units and cloned
into pAMP1 using Life Technologies CloneAMP PCR Cloning System.
5' RACE
In initial 5' RACE experiments, first strand cDNA was prepared
from 400 ng of W22 poly(A+) RNA using the gene-specific
primer L2GSP1 (CCATCCGGTACAGGTGATCGCCAGC). This is complementary to a
sequence in exon 3. First strand cDNA was prepared, purified, and dC
tailed as per Life Technologies 5' RACE System for Rapid Amplification
of cDNA Ends protocol. The product was amplified via PCR with a nested
3' primer complementary to exon 2 sequence (L2GSP2,
CCCGTAGGCTCTTGAGAGGTGACGG) and the anchor primer designed for the kit.
The resulting products were purified using Millipore's Ultrafree-MC
30,000 NMWL filter units, digested with SalI (a site in
the anchor primer) and PstI (a site in L2 5' to L2GSP2),
and cloned into pUC19.
L2GSP2 was used subsequently to initiate first strand synthesis. The
nested primers L2GSP3 (GCGTCGGGGTCGAGGCAGGTCTGGG), from exon 1, and
L2GSP4 (GAGGAAGGACGAAGGAGGCGAGGCG), 5' to known exon 1 sequences, were
used with the anchor primer for PCR amplification. The resulting
products were electrophoresed on a 1% (w/v) agarose gel for
size selection. Bands of 100 to 300 bp and 300 to 700 bp were extracted
from the gel and the DNA was eluted from the agarose using Millipore's
Ultrafree-MC 0.45-µm filter units. The products were digested with
SstI or SalI and SstI for
cloning into pUC19. A third primer, L2GSP3UDG
(CAUCAUCAUCAUGCGTCGGGGTCGAGGCAGGTCTGGG) was used for amplification
in order to allow the products to be cloned directly into pAMP1 using
Life Technologies CloneAMP PCR Cloning System. These were first
purified using Millipore's Ultrafree-MC 30,000 NMWL filter units.
Finally, the Thermostable rTth Reverse Transcriptase RNA
PCR Kit (PEBiosystems) was used in conjunction with Life Technologies 5' RACE System. First strand synthesis was performed using 360 ng of
W64A × 182E leaf total RNA and L2GSP2 3' primer following the
rTth-RT protocol for hot start (70°C for 15 min) or
cycling the temperature (95°C, 30 s to 70°C, 1 min for 20 cycles). The reaction was then treated with RNase, purified, and dC
tailed with components of the 5' RACE kit. PCR amplification was
performed using the anchor primer and L2GSP3UDG and either
Taq DNA polymerase or rTth DNA
polymerase. The resulting products were purified using Millipore's
Ultrafree-MC 30,000 NMWL filter units and cloned directly into pAMP1
using Life Technologies CloneAMP PCR Cloning System.
Agpslzm has been deposited in GenBank (accession no.
AF334960).
Sequence Comparisons (Alignment and Phylogenetic Trees)
Sequences other than maize were obtained from GenBank. Unique
protein sequences were aligned using Florence Corpet's multiple sequence alignment (Corpet, 1988 ) at
http://www.toulouse.inra.fr/multalin.html. Only full-length or nearly
full-length sequences were used to prepare phylogenetic trees using the
AllAll: Related peptide sequences comparison from the Computational
Biochemistry Research Group Server of ETHZ at
http://cbrg.inf.ethz.ch/subsection311.html. The resulting
PostScript files were visualized using Aladdin Ghostscript 5.50 downloaded from
http://www.cs.wisc.edu/~ghost/aladdin/get550.html. The
Phylip program was obtained from
http://evolution.genetics.washington.edu/phylip.html.
 |
ACKNOWLEDGMENTS |
We thank Tim Helentjaris and Chris Zinselmeier for scanning the
Pioneer/DuPont expressed sequence tag database, Rob Ferl and Don
McCarty for many helpful discussions, Bao-Cai Tan for providing mRNA,
and our colleagues for sequencing the many plant AGP structural genes.
We also thank the ICBR at the University of Florida for DNA primer
synthesis and DNA sequencing.
 |
FOOTNOTES |
Received April 16, 2001; returned for revision May 29, 2001; accepted June 12, 2001.
1
This work was supported in part by the National
Science Foundation (grant nos. IBN-9316887, IBN-960416,
IBN-9982626, and MCB-9420422) and by the U.S. Department of
Agriculture Competitive Grants Program (grant nos.
94-37300-453, 9500836, 95-37301-2080, 9701964, 97-36306-4461, 98-01006, and 2000-01488). This is Florida Agricultural Experiment Station journal series no. R-07950.
2
Present address: P.O. Box 173150, Department of Plant
Sciences and Plant Pathology, Montana State University, Bozeman, MT 59717-3150.
3
Present address: Graduate School of Biotechnology, Korea
University, 5-1, Anam-dong, Sungbuk-ku, Seoul 136-701, South Korea.
4
Present address: One Shields Avenue, Life Sciences
Additions, Section of Plant Biology, University of California, Davis,
CA 95616.
*
Corresponding author; e-mail Hannah{at}gnv.ifas.ufl.edu; fax
352-392-5653.
 |
LITERATURE CITED |
-
Anderson JM, Larsen R, Laudencia D, Kim WT, Morrow D, Okita TW, Preiss J
(1991)
Molecular characterization of the gene encoding a rice endosperm- specific ADPglucose pyrophosphorylase subunit and its developmental pattern of transcription.
Gene
97: 199-205[CrossRef][Web of Science][Medline]
-
Bae JM, Giroux M, Hannah LC
(1990)
Cloning and characterization of the brittle-2 gene of maize.
Maydica
35: 317-322[Web of Science]
-
Bae JM, Liu JR
(1997)
Molecular cloning and characterization of two novel isoforms of the small subunit of ADPglucose pyrophosphorylase from sweet potato.
Mol Gen Genet
254: 179-185[CrossRef][Web of Science][Medline]
-
Ballicora MA, Laughlin MJ, Fu Y, Okita TW, Barry GF, Preiss J
(1995)
Adenosine 5'-diphosphate-glucose pyrophosphorylase from potato tuber: significance of the N terminus of the small subunit for catalytic properties and heat stability.
Plant Physiol
109: 245-251[Abstract]
-
Beckles DM, Smith AM, apRees T
(2001)
A cytosolic ADPglucose pyrophosphorylase is a feature of Graminaceous endosperms but not of other starch-storing organs.
Plant Physiol
125: 818-827[Abstract/Free Full Text]
-
Bhave MR, Lawrence S, Barton C, Hannah LC
(1990)
Identification and molecular characterization of shrunken-2 cDNA clones of maize.
Plant Cell
2: 581-588[Abstract/Free Full Text]
-
Brangeon J, Reyss A, Prioul JL
(1997)
In situ detection of ADPglucose pyrophosphorylase expression during maize endosperm development.
Plant Physiol Biochem
35: 847-858
-
Bryce WH, Nelson OE Jr
(1979)
Starch-synthesizing enzymes in the endosperm and pollen of maize.
Plant Physiol
63: 312-317[Abstract/Free Full Text]
-
Burgess D, Penton A, Dunsmuir P, Dooner H
(1997)
Molecular cloning and characterization of ADP-glucose pyrophosphorylase cDNA clones isolated from pea cotyledons.
Plant Mol Biol
33: 431-444[CrossRef][Web of Science][Medline]
-
Cao H, Sullivan TD, Boyer CD, Shannon JC
(1995)
Bt1, a structural gene for the major 39-44 kD amyloplast membrane polypeptides.
Physiol Plant
95: 176-186[CrossRef]
-
Chen BY, Janes HW
(1997)
Multiple forms of ADP-glucose pyrophosphorylase from tomato fruit.
Plant Physiol
113: 235-241[Abstract]
-
Choi SB, Kim KH, Kavakli IH, Lee SK, Okita TW
(2001)
Transcriptional expression characteristics and subcellular localization of ADP-glucose pyrophosphorylase in the oil plant Perilla frutescens.
Plant Cell Physiol
42: 146-153[Abstract/Free Full Text]
-
Corpet F
(1988)
Multiple sequence alignment with hierarchical clustering.
Nucleic Acids Res
16: 10881-10890[Abstract/Free Full Text]
-
Denyer K, Dunlap F, Thorbjornsen T, Keeling P, Smith AM
(1996)
The major form of ADP-glucose pyrophosphorylase in maize endosperm is extra-plastidial.
Plant Physiol
112: 779-785[Abstract]
-
Doan DN, Rudi H, Olsen OA
(1999)
The allosterically unregulated isoform of ADP-glucose pyrophosphorylase from barley endosperm is the most likely source of ADP-glucose incorporated into endosperm starch.
Plant Physiol
121: 965-975[Abstract/Free Full Text]
-
Fuchs RL
(1977)
Purification and characterization of ADP-glucose pyrophosphorylase A from maize endosperm. PhD thesis. Texas A&M University, College Station
-
Giroux MJ, Clancy M, Baier J, Ingham L, McCarty D, Hannah LC
(1994)
De novo synthesis of an intron by the maize transposable element Dissociation.
Proc Natl Acad Sci USA
91: 12150-12154[Abstract/Free Full Text]
-
Giroux MJ, Hannah LC
(1994)
ADP-glucose pyrophosphorylase in shrunken-2 and brittle-2 mutants of maize.
Mol Gen Genet
243: 400-408[Web of Science][Medline]
-
Giroux M, Smith-White B, Gilmore V, Hannah LC, Preiss J
(1995)
The large subunit of the embryo isoform of ADP glucose pyrophosphorylase from maize.
Plant Physiol
108: 1333-1334[CrossRef][Web of Science][Medline]
-
Greene TW, Kavakli IH, Kahn ML, Okita TW
(1998)
Generation of up-regulated allosteric variants of potato ADP-glucose pyrophosphorylase by reversion genetics.
Proc Natl Acad Sci USA
95: 10322-10327[Abstract/Free Full Text]
-
Hannah LC
(1997)
Starch synthesis in the maize endosperm.
In
BA Larkins, IK Vasil, eds, Advances in Cellular and Molecular Biology of Plants, Vol. 4. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp 375-405
-
Hannah LC, Nelson OE Jr
(1976)
Characterization of ADP-glucose pyrophosphorylase from shrunken-2 and brittle-2 mutants of maize.
Biochem Genet
14: 547-560[CrossRef][Web of Science][Medline]
-
Hylton C, Smith AM
(1992)
The rb mutation of peas causes structural and regulatory changes in ADP-glucose pyrophosphorylase from developing embryos.
Plant Physiol
99: 1626-1634[Abstract/Free Full Text]
-
Kim WT, Franceschi VR, Okita TW, Robinson NL, Morell M, Preiss J
(1989)
Immunocytochemical localization of ADPglucose pyrophosphorylase in developing potato tuber cells.
Plant Physiol
91: 217-220[Abstract/Free Full Text]
-
La Cognata U, Willmitzer L, Muller-Rober B
(1995)
Molecular cloning and characterization of novel isoforms of potato ADP-glucose pyrophosphorylase.
Mol Gen Genet
246: 538-548[CrossRef][Web of Science][Medline]
-
Lin TP, Caspar T, Somerville C, Preiss J
(1988a)
Isolation and characterization of a starchless mutant of Arabidopsis thaliana (L.) Heynh lacking ADPglucose pyrophosphorylase activity.
Plant Physiol
86: 1131-1135[Abstract/Free Full Text]
-
Lin TP, Caspar T, Somerville CR, Preiss J
(1988b)
A starch deficient mutant of Arabidopsis thaliana with low ADPglucose pyrophosphorylase activity lacks one of the two subunits of the enzyme.
Plant Physiol
88: 1175-1181[Abstract/Free Full Text]
-
McCarty DR
(1986)
A simple method for extraction of RNA from maize tissue.
Maize Genet Coop Newsl
60: 61
-
McCarty DR, Shaw JR, Hannah LC
(1986)
The cloning, genetic mapping, and expression of the constitutive sucrose synthase locus of maize.
Proc Natl Acad Sci USA
83: 9099-9103[Abstract/Free Full Text]
-
Muller-Rober B, Sonnewald U, Willmitzer L
(1992)
Inhibition of the ADP-glucose pyrophosphorylase in transgenic potatoes leads to sugar-storing tubers and influences tuber formation and expression of tuber storage protein genes.
Embo J
11: 1229-1238[Web of Science][Medline]
-
Nakamura Y, Kawaguchi K
(1992)
Multiple forms of ADP-glucose pyrophorylase of rice endosperm.
Plant Physiol
84: 336-342[CrossRef]
-
Okita TW, Greenberg E, Kuhn DN, Preiss J
(1979)
Subcellular localization of the starch degradative and biosynthetic enzymes of spinach leaves.
Plant Physiol
64: 187-192[Abstract/Free Full Text]
-
Okita TW, Nakata PA, Anderson JM, Sowokinos JMM, Preiss J
(1990)
The subunit structure of potato tuber ADP-glucose pyrophosphorylase.
Plant Physiol
93: 785-790[Abstract/Free Full Text]
-
Olive MR, Ellis RJ, Schuch WW
(1989)
Isolation and nucleotide sequences of cDNA clones encoding ADP-glucose pyrophosphorylase polypeptides from wheat leaves and endosperm.
Plant Mol Biol
12: 525-538[CrossRef][Web of Science]
-
Preiss J, Lammel C, Sabraw A
(1971)
A unique adenosine diphosphoglucose pyrophosphorylase associated with maize embryo tissue.
Plant Physiol
47: 104-108[Abstract/Free Full Text]
-
Preiss J, Romeo T
(1994)
Molecular biology and regulatory aspects of glycogen biosynthesis in bacteria.
Prog Nucleic Acid Res Mol Biol
47: 299-329[Web of Science][Medline]
-
Preiss J, Sivak M
(1996)
Starch synthesis in sinks and sources.
In
E Zamski, ed, Photoassimilate Distribution in Plants and Crops: Source-Sink Relationships. Marcel Dekker Inc., New York, pp 139-168
-
Prioul JL, Jeannette E, Reyss A, Gregory N, Giroux M, Hannah LC, Causse M
(1994)
Expression of ADP-glucose pyrophosphorylase in maize (Zea mays L.) grain and source leaf during grain filling.
Plant Physiol
104: 179-87[Abstract]; erratum Prioul JL, Jeannette E, Reyss A, Gregory N, Giroux M, Hannah LC, Causse M (1994) Plant Physiol 105: 1465; erratum Prioul JL, Jeannette E, Reyss A, Gregory N, Giroux M, Hannah LC, Causse M (1994) Plant Physiol 106: 405
-
Sambrook J, Fritsch EF, Maniatis T
(1989)
Molecular Cloning, Ed 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
-
Shannon JC, Fang-Mei P, Kang-Chein L
(1996)
Nucleotides and nucleotide sugars in developing maize endosperms.
Plant Physiol
110: 835-843[Abstract]
-
Shaw JR, Ferl RJ, Baier J, St. Clair D, Carson C, McCarty DR, Hannah LC
(1994)
Structural features of the maize sus1 gene and protein.
Plant Physiol
106: 1659-1665[Abstract]
-
Singletary GW, Banisadr R, Keeling PL
(1997)
Influence of gene dosage on carbohydrate synthesis and enzymatic activities in endosperm of starch-deficient mutants of maize.
Plant Physiol
113: 293-304[Abstract]
-
Smith AM, Bettey M, Bedford ID
(1989)
Evidence that the rb locus alters starch content of developing pea embryos through an effect on ADP-glucose pyrophosphorylase.
Plant Physiol
89: 1279-1284[Abstract/Free Full Text]
-
Smith-White BJ, Preiss J
(1992)
Comparison of proteins of ADP-glucose pyrophosphorylase from diverse sources.
J Mol Evol
34: 449-464[CrossRef][Web of Science][Medline]
-
Thorbjornsen T, Villand P, Denyer K, Olsen O, Smith AM
(1996b)
Distinct isoforms of ADPglucose pyrophosphorylase occur inside and outside the amyloplast in barley endosperm.
Plant J
10: 243-250
-
Thorbjornsen T, Villand P, Kleczkowski LA, Olsen OA
(1996a)
A single gene encodes two different transcripts for the ADP-glucose pyrophosphorylase small subunit from barley (Hordeum vulgare).
Biochem J
313: 149-154
-
Tsai CY, Nelson OE
(1966)
Starch-deficient maize mutant lacking adenosine dephosphate glucose pyrophosphorylase activity.
Science
151: 341-343[Abstract/Free Full Text]
-
Villand P, Aalen R, Olsen OA, Luthi E, Lonneborg A, Kleczkowski LA
(1992)
PCR amplification and sequences of cDNA clones for the small and large subunits of ADP-glucose pyrophosphorylase from barley tissues.
Plant Mol Biol
19: 381-389[CrossRef][Web of Science][Medline]
-
Villand P, Kleczkowski LA
(1994)
Is there an alternative pathway for starch biosynthesis in cereal seeds?
Z Naturforsch
49: 215-219
-
Villand P, Olsen OA, Kleczkowski LA
(1993)
Molecular characterization of multiple cDNA clones for ADP-glucose pyrophosphorylase from Arabidopsis thaliana.
Plant Mol Biol
23: 1279-1284[CrossRef][Web of Science][Medline]
-
Weber H, Heim U, Borisjuk L, Wobus U
(1995)
Cell-type specific, coordinate expression of two ADP-glucose pyrophosphorylase genes in relation to starch biosynthesis during seed development of Vicia faba L.
Planta
195: 352-361[Web of Science][Medline]
© 2001 American Society of Plant Physiologists
This article has been cited by other articles:

|
 |

|
 |
 
D. M. Braun and T. L. Slewinski
Genetic Control of Carbon Partitioning in Grasses: Roles of Sucrose Transporters and Tie-dyed Loci in Phloem Loading
Plant Physiology,
January 1, 2009;
149(1):
71 - 81.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. L. Slewinski, Y. Ma, R. F. Baker, M. Huang, R. Meeley, and D. M. Braun
Determining the Role of Tie-dyed1 in Starch Metabolism: Epistasis Analysis with a Maize ADP-Glucose Pyrophosphorylase Mutant Lacking Leaf Starch
J. Hered.,
November 1, 2008;
99(6):
661 - 666.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Cossegal, P. Chambrier, S. Mbelo, S. Balzergue, M.-L. Martin-Magniette, A. Moing, C. Deborde, V. Guyon, P. Perez, and P. Rogowsky
Transcriptional and Metabolic Adjustments in ADP-Glucose Pyrophosphorylase-Deficient bt2 Maize Kernels
Plant Physiology,
April 1, 2008;
146(4):
1553 - 1570.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. T. Hamblin, M. G. Salas Fernandez, M. R. Tuinstra, W. L. Rooney, and S. Kresovich
Sequence Variation at Candidate Loci in the Starch Metabolism Pathway in Sorghum: Prospects for Linkage Disequilibrium Mapping
Crop Sci.,
July 16, 2007;
47(S2):
S-125 - S-134.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Georgelis, E. L. Braun, J. R. Shaw, and L. C. Hannah
The Two AGPase Subunits Evolve at Different Rates in Angiosperms, yet They Are Equally Sensitive to Activity-Altering Amino Acid Changes When Expressed in Bacteria
PLANT CELL,
May 1, 2007;
19(5):
1458 - 1472.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. M. Bejar, X. Jin, M. A. Ballicora, and J. Preiss
Molecular Architecture of the Glucose 1-Phosphate Site in ADP-glucose Pyrophosphorylases
J. Biol. Chem.,
December 29, 2006;
281(52):
40473 - 40484.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Ohdan, P. B. Francisco Jr, T. Sawada, T. Hirose, T. Terao, H. Satoh, and Y. Nakamura
Expression profiling of genes involved in starch synthesis in sink and source organs of rice
J. Exp. Bot.,
December 1, 2005;
56(422):
3229 - 3244.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. R. L. Linebarger, S. K. Boehlein, A. K. Sewell, J. Shaw, and L. C. Hannah
Heat Stability of Maize Endosperm ADP-Glucose Pyrophosphorylase Is Enhanced by Insertion of a Cysteine in the N Terminus of the Small Subunit
Plant Physiology,
December 1, 2005;
139(4):
1625 - 1634.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. K. Boehlein, A. K. Sewell, J. Cross, J. D. Stewart, and L. C. Hannah
Purification and Characterization of Adenosine Diphosphate Glucose Pyrophosphorylase from Maize/Potato Mosaics
Plant Physiology,
July 1, 2005;
138(3):
1552 - 1562.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Ballicora, J. R. Dubay, C. H. Devillers, and J. Preiss
Resurrecting the Ancestral Enzymatic Role of a Modulatory Subunit
J. Biol. Chem.,
March 18, 2005;
280(11):
10189 - 10195.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Cross, M. Clancy, J. R. Shaw, T. W. Greene, R. R. Schmidt, T. W. Okita, and L. C. Hannah
Both Subunits of ADP-Glucose Pyrophosphorylase Are Regulatory
Plant Physiology,
May 1, 2004;
135(1):
137 - 144.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. E. Johnson, N. J. Patron, A. R. Bottrill, J. R. Dinges, B. F. Fahy, M. L. Parker, D. N. Waite, and K. Denyer
A Low-Starch Barley Mutant, Riso 16, Lacking the Cytosolic Small Subunit of ADP-Glucose Pyrophosphorylase, Reveals the Importance of the Cytosolic Isoform and the Identity of the Plastidial Small Subunit
Plant Physiology,
February 1, 2003;
131(2):
684 - 696.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. A. Burton, P. E. Johnson, D. M. Beckles, G. B. Fincher, H. L. Jenner, M. J. Naldrett, and K. Denyer
Characterization of the Genes Encoding the Cytosolic and Plastidial Forms of ADP-Glucose Pyrophosphorylase in Wheat Endosperm
Plant Physiology,
November 1, 2002;
130(3):
1464 - 1475.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Tiessen, J. H. M. Hendriks, M. Stitt, A. Branscheid, Y. Gibon, E. M. Farre, and P. Geigenberger
Starch Synthesis in Potato Tubers Is Regulated by Post-Translational Redox Modification of ADP-Glucose Pyrophosphorylase: A Novel Regulatory Mechanism Linking Starch Synthesis to the Sucrose Supply
PLANT CELL,
September 1, 2002;
14(9):
2191 - 2213.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|