|
Plant Physiol, October 2001, Vol. 127, pp. 450-458
Control of Specific Gene Expression by Gibberellin and
Brassinosteroid1
Thomas
Bouquin,
Carsten
Meier,
Randy
Foster,
Mads Eggert
Nielsen, and
John
Mundy*
Department of Plant Physiology, Molecular Biology Institute,
Copenhagen University, Øster Farimagsgade 2A, 1353 Copenhagen K,
Denmark
 |
ABSTRACT |
We identified a recessive, brassinolide-insensitive mutant caused
by a deletion allele (bri1-201) of the brassinosteroid
(BR) receptor BRI1. The bri1-201 mutant
displayed altered expression levels of genes differentially regulated
by gibberellin (GA). RNA-blot analysis revealed that BR and GA
antagonistically regulate the accumulation of mRNAs of the
GA-responsive GASA1 gene, as well as the GA-repressible
GA5 gene. Expression studies with cycloheximide indicated that the antagonistic effects of GA and BR on
GA5 require de novo protein synthesis. Reporter
transgene analyses and RNA-blot analysis showed that BR and GA modulate
GA5 expression, at least in part, at the transcriptional
level, and that the signals are independent and subtractive.
 |
INTRODUCTION |
Brassinosteroids (BR) and
gibberellins (GA) are plant growth regulators controlling cell and
plant size, and mutations impairing their biosynthesis or sensitivity
result in dwarfism. Early physiological work on wild-type (WT) tissues
of different plants showed that GA and BR additively enhance growth,
indicating that the two hormones act independently at the cellular
level (Gregory and Mandava, 1982 ). However, recent molecular work
indicates that cross-talk may occur between BR- and GA-signaling
pathways. For example, mRNA of the GA-responsive -TIP
gene accumulates ectopically in BR-deficient and BR-signaling mutants,
suggesting that BR and GA antagonistically regulate -TIP
expression (Kauschmann et al., 1996 ). -TIP encodes a
tonoplast-intrinsic aquaporin or water channel, and its antagonistic
regulation by BR and GA may reflect differences in the mechanisms by
which the two hormones modulate cell growth and size by regulating
turgor pressure or solute flow. In contrast, mRNA levels of the
MERI-5 gene (Medford et al., 1991 ) are regulated positively
by either BR or GA treatment (Kauschmann et al., 1996 ).
MERI-5 probably encodes a xyloglucan-endohydrolase involved
in cell wall loosening, thereby modulating cell expansion and growth.
If so, MERI-5 expression may be required for growth processes mediated by both GA and BR.
Feedback control of the expression of BR and GA biosynthetic genes
regulates endogenous levels of the growth hormones. For example, BR
negatively controls transcription of the CPD steroidogenic cytochrome P450 (Mathur et al., 1998 ). In a similar manner, GA negatively regulates the expression of the GA4
3 -hydroxylase (Chiang et al., 1995 ) and the GA5 GA
20-oxidase-1 (Phillips et al., 1995 ; Xu et al., 1995 ), which encode
enzymes converting inactive GA precursors into active GAs. If
cross-talk occurs between GA and BR signaling, biosynthetic enzymes
such as CPD, GA4, and GA5 may be potential regulatory targets. Such
cross-talk could occur via shared signaling components, interactions
between components specific for each pathway, or via control of the
transcription or stability of common targets by distinct factors.
During the course of a phenotypic screen of gamma-mutagenized plants,
we isolated a dwarf mutant similar to GA or BR biosynthetic/signaling mutants. Here, we demonstrate that this mutant phenotype is caused by a
novel deletion allele (bri1-201) of the BRI1 BR receptor (Li
and Chory, 1997 ; He et al., 2000 ). RNA-blot analysis with RNAs from WT,
BR-insensitive bri1-201, and BR-deficient cpd
mutants showed that BR and GA antagonistically regulate
GASA1 and GA5. Expression studies with the
protein synthesis inhibitor cycloheximide (CHX) indicated that
GA5 regulation by BR or GA requires de novo protein
synthesis. Transgene reporter analysis and RNA-blot analysis also
indicated that GA5 regulation by BR and GA occurs, at least in part, at the transcriptional level.
 |
RESULTS |
The bri1-201 Mutant and Allele
A screen of 100,000 progeny from gamma-mutagenized plants for
visible mutant phenotypes identified the dwarf shown in Figure 1. This mutant exhibited reduced size at
early stages of development, reduced apical dominance, extreme dwarfism
at flowering, and delayed flowering and leaf senescence (Fig. 1, A and
B). The mutant was apparently male sterile (Fig. 1, E and F) because
homozygous seed was not produced by selfing, although pollination of
the dwarf with WT pollen produced viable seed. F2
progeny from such crosses segregated in a 3:1 ratio (210 mutants out of
949 plants, 2 = 0.04), indicating that the
mutant phenotype was caused by a single recessive allele. The phenotype
of the mutant suggested that it might be the result of a lesion in the
biosynthesis or sensitivity to growth hormones such as BR or
GA.

View larger version (32K):
[in this window]
[in a new window]
|
Figure 1.
Phenotype of the bri1-201 mutant under
long-day conditions (16 h light/8 h dark). A, Comparative development
of bri1-201 and WT. B, bri1-201 35 d after
germination. C through F, WT (C and D) and bri1-201 flowers
(E and F). In D and F, sepals and petals were removed to show
reproductive organs. Bars represent 1 mm.
|
|
We used two approaches to elucidate the cause of the mutant phenotype:
physiological and molecular studies of BR and GA responses and physical
mapping. To investigate sensitivity to BR, the dwarf, as well as WT,
BR-deficient cpd (Szekeres et al., 1996 ), and BR-insensitive bri1-1 (Clouse et al., 1996 ) controls were grown on
Murashige and Skoog medium for 2 weeks and then transferred to plates
supplemented with 1 µM 24-epibrassinolide
(EBR). WT and cpd plantlets exhibited BR-sensitive growth,
whereas the dwarf and bri1-1 failed to normalize leaf
development (Fig. 2A). When grown on EBR
concentrations inhibiting WT root elongation, both the dwarf and
bri1-1 seedlings also maintained equivalent root growth
(Fig. 2B). Moreover, dark-grown dwarf and bri1-1 seedlings
were shorter than WT and both exhibited skotomorphogenesis, a
characteristic of BR mutants (Fig. 2C). Taken together, these results
indicate that the dwarf is BR insensitive.

View larger version (31K):
[in this window]
[in a new window]
|
Figure 2.
bri1-201 exhibits insensitivity to EBR
and constitutive skotomorphogenesis. A, Two-week-old WT and
bri1-201 were transferred to plates without (con) or with
(+EBR) 0.5 µM EBR and grown for 5 d. B,
Root length of WT, bri1-1 and bri1-201 seedlings
grown 5 d without (control) or with (+EBR) 0.2 µM EBR. Each value represents the mean of 50 independent measurements. C, Skotomorphogenesis of WT and mutant
seedlings. Seedlings were germinated and grown for 5 d in darkness
on Murashige and Skoog medium.
|
|
The dwarf locus was mapped by scoring F2
mutant progeny, from a cross between plants heterozygous for the
dwarfing allele (Columbia-0 [Col-0] ecotype) to WT Landsburg
erecta, for segregation of using simple sequence-length
polymorphism markers spanning the 10 Arabidopsis chromosome arms (Bell
and Ecker, 1994 ). The mutation thus was localized to the lower arm of
chromosome IV, south of marker nga1107 (three recombinants out of 60 mutant plants examined). Because BRI1 maps in this region
(Li and Chory, 1997 ), this suggested that the dwarf might be caused by
an allele of bri1. To test this, the BRI1 genes
from three dwarf plants were PCR amplified and sequenced. An 8-bp
deletion was found in all three mutants 22 nucleotides downstream of
the start ATG, which produced a frame shift in the open reading frame
resulting in a stop codon after 44 amino acid residues. Therefore, we
designated this allele and the mutant bri1-201. RNA-blot
analysis showed that WT and bri1-201 plantlets accumulated
equivalent levels of mRNA hybridizing to a BRI1
3'-untranslated region probe (data not shown). This indicates that
transcription and stability of BRI1 mRNA are not affected by
BR levels or BR-signaling intermediates in WT Arabidopsis plants.
Because bri1-201 lacks any BRI1 protein and is slightly more
dwarfed than bri1 (Fig. 2, B and C), bri1-201 constitutes a null allele similar to the deletion mutant
bri1-4, which exhibits a frame shift in the BRI1 open
reading frame at 140 amino acid residues (Noguchi et al.,
1999 ).
Expression of GA-Regulated Genes in bri1-201
Our interest in plant responses to GAs (Raventos et al., 2000 ;
Meier et al., 2001 ) initially prompted us to examine whether the mutant
was sensitive to the application of exogenous GA prior to our
identification of the bri1-201 allele. Growth assays with seedlings and rosette-stage plants showed that aerosol treatment with
10 5 M
GA3 did not restore WT growth to the mutant,
suggesting that it might be insensitive to GA. We attempted to confirm
this by examining the expression of several GA-regulated genes in the mutant by RNA-blot analysis. These included the GA-responsive GASA1 gene (Herzog et al., 1995 ), the GA feedback-regulated,
biosynthetic genes GA5 and GA4 (Chiang et al.,
1995 ; Phillips et al., 1995 ; Xu et al., 1995 ), and the RGA
and GAI genes encoding GA-signaling components (Peng et al.,
1997 ; Silverstone et al., 1998 ). This revealed that differential gene
expression by GA was not affected in the mutant because accumulation of
GASA1/GAI/RGA was enhanced by
GA3, whereas accumulation of
GA5/GA4 mRNAs was still negatively feedback
regulated by GA3 (Fig.
3). This indicated that the mutant was
sensitive to GA because it was not qualitatively compromised in
responses to GA at the molecular level. Nonetheless, we noted that the
control mRNA levels of GASA1 and GA5 were
significantly different between the mutant and WT. For example,
GA5 mRNA was three times less abundant in
bri1-201 than in WT, whereas GASA1 mRNA was more
than 7-fold higher in the mutant. Moreover, the levels of
GA4, RGA and GAI mRNAs were slightly
lower in bri1-201 than in WT.

View larger version (46K):
[in this window]
[in a new window]
|
Figure 3.
RNA-blot analysis of GA5,
GA4, GASA1, GAI, and RGA
mRNA accumulation in bri1-201 and WT upon
GA3 treatment. Poly(A+) RNA
(1 µg lane 1) from 16-d-old plants grown on
Murashige and Skoog medium without or with 50 µM GA3 added for the last
48 h. Ribonucleic 32P-CTP antisense probes
were synthesized using T7 RNA polymerase from partial cDNA 3' sequences
cloned in the pGEM-Teasy vector. GA5, GA4, and
GASA1 hybridizations were performed on the same filter,
whereas GAI and RGA hybridizations were performed
on independent filters. Radioactive signals were quantified on all
membranes and standardized (WT con = 100) by comparison to signals
obtained after subsequent blotting with the EF1-
probe.
|
|
These results would be consistent with a lesion affecting the amplitude
of GA-dependent responses controlling the expression of both GA
inducible and repressible genes such as GASA1 and
GA5. However, our subsequent finding that the mutant is BR
insensitive indicated that BR affects the expression of these genes
antagonistically to GA. This would explain why GA5 mRNA
levels are lower, whereas GASA1 levels are higher in the
bri1-201 mutant than in WT. In an alternate manner, the
alteration in GASA1 and GA5 mRNA accumulation levels observed in bri1-201 could be due to pleiotropic
effects of the mutation.
Effect of BR and GA on GA5 and GASA1
Steady-State mRNA Levels
To investigate whether altered GA-related gene expression in
bri1-201 is correlated to deficiencies in BR signaling, EBR
treatments were performed on WT, bri1-201, and the
BR-deficient cpd mutant (Szekeres et al., 1996 ). mRNA levels
were again monitored by EF1- -normalized RNA-blot
analysis. This showed that EBR treatment increased GA5 mRNA
slightly in WT and more strongly in the BR-deficient cpd mutant, but did not affect GA5 mRNA levels in
bri1-201 (Fig. 4A). In
contrast, accumulation of the GA responsive GASA1 mRNA was reduced by EBR slightly in WT and very strongly in cpd.
These results indicate that BR and GA antagonistically affect
GA5 and GASA1 mRNA levels.

View larger version (42K):
[in this window]
[in a new window]
|
Figure 4.
GASA1 and GA5 mRNA
accumulation is antagonistically controlled by GA and BR. Two-week-old
seedlings grown on Murashige and Skoog were transferred to 50 mL liquid
one-half-strength Murashige and Skoog in flasks for 1 d prior to
treatment. RNA-blot analyses were performed and normalized with
EF1- as described in Figure 3. A, WT, bri1-201
and cpd seedlings were treated with 1 µM EBR for 48 h. B, cpd
seedlings were treated with GA or BR in presence (CHX) or not of
translational inhibitors. CHX (50 µM) and
chloramphenicol (50 µM) were added to the
medium 2 h before GA or BR treatments (50 µM GA3 or 1 µM EBR for 16 h).
|
|
Although GA4 and RGA mRNA levels were somewhat
lower in bri1-201 and cpd than in WT, EBR
treatment failed to restore their mRNA levels in the
cpd mutant, in contrast to GA5 (Fig. 4A). This result indicates that BR effects on GA4 expression are less
pronounced than BR control of GA5.
To assess whether de novo protein synthesis affects the accumulation of
steady-state mRNA levels of GASA1 and GA5, GA and BR treatments were performed in the presence of translational inhibitors, and mRNA levels monitored by EF1- -normalized
RNA-blot analysis. As shown in Figure 4B (top, lanes 1 and 2 versus
lanes 4 and 5), CHX blocked both basal levels of GASA1 mRNA
accumulation in control tissue, as well as the enhancement of
GASA1 mRNA accumulation by GA treatment. This suggests that
GA-responsive GASA1 mRNA accumulation requires the de novo
synthesis of an activator or a factor that stabilizes GASA1
mRNA. However, because CHX abolished and BR treatment decreased
GASA1 mRNA accumulation, these experiments do not indicate whether BR repression of GASA1 mRNA accumulation requires de
novo protein synthesis.
In contrast to GASA1, RNA-blot analysis showed that
CHX alone induced GA5 mRNA accumulation to above-control
levels, and that CHX blocked the repression of GA5
accumulation by GA (Fig. 4B; bottom, lane 2 versus lane 5). This is
consistent with a model in which a labile repressor is required for GA
negative feedback regulation of GA5 (Meier et al., 2001 ).
However, BR induction apparently was blocked by CHX because
GA5 mRNA levels were similar following treatment with CHX
alone, or CHX together with GA or BR (Fig. 4B; bottom, lanes 4-6).
These results do not distinguish between whether BR enhancement of
GA5 mRNA accumulation is effected via a de novo-synthesized
activator or an mRNA-stabilizing factor, or via derepression of GA
negative feedback regulation.
BR Regulation of the GA5 Promoter
We previously have generated transgenic plants expressing
the firefly luciferase (LUC) gene under the control of 0.4 kb of the GA5 promoter, and demonstrated that this promoter
fragment contains cis sequences required for transcriptional regulation of GA5 by GA (Meier et al., 2001 ). This
GA5-LUC reporter was introduced into the
BR-deficient cpd mutant by crossing.
F3 seedlings, homozygous for the
GA5-LUC reporter and exhibiting either WT or
cpd phenotypes, were treated with EBR and their in vivo LUC
expression measured with a CCD camera. EBR treatment of WT plants
carrying GA5-LUC did not significantly affect LUC
reporter activity, although the control level of LUC activity was
3-fold higher in these WT plants than in the cpd plants
expressing the reporter (Fig. 5A). This result is consistent with the low GA5 transcript
accumulation level observed in bri1-201, and suggests that
endogenous BR levels in the WT contribute to basal GA5
expression levels. In contrast, expression of the
GA5-LUC reporter in cpd plants
increased after 2 h of BR treatment and reached up to 11-fold
induction after 32-h treatment (Fig. 5A). This indicates that the
GA5 gene is, at least in part, transcriptionally regulated
by BR, and in an opposite manner to GA. Accumulation of GA5
transcript in cpd seedlings was monitored by RNA-blot
analysis after a short-term treayment (2 h) with EBR and confirmed the
rapid regulation of GA5 transcript levels by BR observed in
the reporter assays (Fig. 5A, inset).

View larger version (40K):
[in this window]
[in a new window]
|
Figure 5.
Effects of BR and GA on GA5-LUC
expression. A, LUC imaging of the GA5-LUC
reporter in 16-d-old WT-GA5-LUC and
cpd-GA5-LUC seedlings treated with 1 µM EBR for various times. Insert in A,
GA5 transcript accumulation monitored by RNA-blot analysis
from 16-d-old cpd seedlings treated with 1 µM EBR for 2 h. Hybridization conditions
and normalization with EF1- were performed as described
in Figure 3. B, One-week-old cpd-GA5-LUC seedlings grown on
Murashige and Skoog plates were transferred to liquid one-half-strength
Murashige and Skoog in presence or absence of ancymidol (1 mg
L 1) and grown for 7 more d. BR (0.1 µM EBR) and GA (50 µM
GA3) treatments were performed for 16 h by
adding the hormones to the medium. C, GA5 transcript
accumulation in 16-d-old cpd-ga1-1 double mutant seedlings
treated with 1 µM EBR for 16 h.
Hybridization conditions and normalization with EF1- were
performed as described in Figure 3. In A and B, bioluminescent LUC
images (displayed in pseudocolors) acquired by CCD camera are shown
below the quantification (average gray values) of LUC
images.
|
|
If GA and BR antagonistically regulate GA5
transcription via independent pathways, the two signals may be
subtractive. To investigate this possibility,
cpd-GA5-LUC seedlings were subjected to GA3 and EBR treatments in the presence or
absence of the GA biosynthesis inhibitor ancymidol (Rademacher, 1989 ).
As expected, GA3 treatment down-regulated
GA5-LUC activity, whereas EBR treament up-regulated reporter
activity (Fig. 5B, bar 1 versus bars 2 and 3). In the presence of both
hormones, LUC activity was reduced to the same extent in WT and WT
treated with GA3 (Fig. 5B, bars 1 and 2 versus
bars 3 and 4). As we have observed previously (Meier et al., 2001 ), LUC
reporter activity was also up-regulated by ancymidol treatment (bar 1 versus bar 5). This indicates that the basal levels of active GAs in
seedlings contribute to negative feedback of the GA5 gene.
It is interesting that reporter activity was increased to the same
extent upon EBR treatment of cpd seedlings grown in the
presence or absence of ancymidol (Fig. 5B, bars 1 and 3 versus bars 5 and 7). Moreover, in the presence of ancymidol, GA3 reduced reporter activity to the same extent
in plants treated with (Fig. 5B, bar 7 versus bar 8) or without (bar 5 versus bar 6) EBR.
To assess the specificity of the ancymidol treatment on the inhibition
of GA biosynthesis, and to rule out the possibility of side effects on
other hormone biosynthetic pathways (i.e. BR), we generated
cpd-ga1-1 double mutants in which both active GA and BR
levels are dramatically reduced. Accumulation of GA5 mRNA upon EBR treatment in the cpd-ga1-1 double mutant was
investigated by means of RNA-blot analysis. As shown in Figure 5C, EBR
treatment induced GA5 mRNA accumulation in
cpd-ga1-1 seedlings, indicating that BR-induced
GA5 expression is GA independent. This result is consistent
with the additivity of the EBR and ancymidol treatments on the
GA5-LUC reporter activation observed in Figure 5B. Taken together, these results show that GA and BR modulate GA5
transcription in a subtractive manner.
 |
DISCUSSION |
Dwarfism is a commonly identified mutant phenotype and can result
from lesions in phytohormone synthesis or sensitivity (Li and Chory,
1997 ; Peng et al., 1997 ; Johnson and Ecker, 1998 ), or in potentially
pleiotropic stress signaling (Bowling et al., 1994 ). Therefore, we
undertook two approaches to determine the lesion causing dwarfism in a
mutant identified in a phenotypic screen of gamma-mutagenized seeds.
First, map-based cloning and genomic sequencing identified the mutation
as a novel deletion allele (bri1-201) of the BRI1
gene encoding the BRI1 BR receptor (Li and Chory, 1997 ; Friedrichsen et
al., 2000 ; He et al., 2000 ). Second, physiological analyses showed that
bri1-201 is insensitive to BR, as expected. In addition, and
prior to our identification of the bri1-201 allele, our
interest in GA action (Raventos et al., 2000 ; Meier et al., 2001 )
prompted us to examine GA responses at the molecular level in
bri1-201. RNA-blot analysis revealed that mRNA levels of
GA-inducible GASA1 (Herzog et al., 1995 ) were higher,
whereas mRNA levels of GA-repressible GA5 (Phillips et al.,
1995 ; Xu et al., 1995 ) were lower in bri1-201 compared with WT. These results indicated that although bri1-201 is
qualitatively sensitive to GA, the expression of specific genes is
antagonistically affected by BR and GA. This was
confirmed by transgenic experiments showing that expression of a fusion
between the GA5 promoter and the LUC reporter was
antagonistically regulated by GA and BR in cpd seedlings. In
addition, endogenous GA5 up-regulation was observed in
cpd-ga1-1 double mutants upon EBR treatment, confirming that BR and GA effects on GA5 expression are independent and subtractive.
These results indicate that cross-talk exists between these two
important growth hormones, and that GA and BR modulate the expression
of GA5, at least in part, at the transcriptional level. A
result of this cross-talk may be that BR potentiates GA action by
positively affecting GA5, a key GA biosynthetic enzyme whose activity regulates active GA levels (Phillips et al., 1995 ; Xu et al.,
1995 ). This is consistent with phenotypic studies of the BR-deficient
dwf4 mutant showing that a fully active BR pathway is
required for cell elongation as a response to GA (Azpiroz et al.,
1998 ). Using reporter transgenes, we have observed that GA4 is expressed in the hypocotyl of young seedlings (data not shown), which is also the case for GA1 (Silverstone et al., 1997 )
and for GA5 (Meier et al., 2001 ). This suggests that active
GAs are produced in the hypocotyl. These data are consistent with the results of (Ephritikhine et al., 1999 ) showing that in the BR-deficient sax1 mutant, GA-insensitive cell elongation is restricted to
the hypocotyl and is reversible by BR application. Moreover, Goetz et
al. (2000) have recently shown that the Lin6 gene, encoding an extracellular invertase responsible for phloem unloading, was specifically induced in the hypocotyl in response to BR treatment.
The antagonistic effects of BR and GA on GA5 transcription
may be explained via interaction(s) between upstream signaling components, or transcription factor(s) binding to common or distinct GA5 promoter elements. Our data do not distinguish between
these possibilities, although reporter analysis and RNA-blot analysis, performed either in the presence of ancymidol, which depletes endogenous GA levels, or in a double mutant impaired in GA and BR
synthesis, show that the two hormones affect GA5
transcription in a subtractive manner. More detailed promoter
analysis is required to determine whether cis elements responsive to GA
or BR are separable. To this end, we are introducing deletion
derivatives of GA5-LUC into the cpd mutant.
Our current CHX experiments do not determine whether GASA1
is a primary GA or BR response gene because the presence of
translational inhibitors abolished its transcript levels. This does,
however, suggest that labile factor(s) are required either for
GASA1 transcription or RNA stability. The effect of BR on
GASA1 expression appears similar to BR repression of
transcription of the CPD steroid hydroxylase, whose
expression also requires de novo protein synthesis (Mathur et al.,
1998 ). We recently showed that GA induction of GASA1 occurs at the transcriptional level using a GASA1
promoter-LUC fusion (Raventos et al., 2000 ). However, it is
unlikely that GASA1 regulation by GA and BR are mediated
through a common cis element because GASA1 mRNA accumulation
was repressed by BR, whereas BR failed to affect
GASA1-LUC reporter activity in a transgenic
cpd mutant line (data not shown). GASA1
regulation by BR therefore may occur via a silencer located elsewhere
in the GASA1 gene, or at the posttranscriptional level. In a
similar manner, posttranscriptional regulation of the BRU1
gene by BR has been reported (Zurek and Clouse, 1994 ).
In contrast to GASA1, GA5 mRNA levels were
increased by CHX alone. In addition, mRNA levels seemed unaffected by
GA or BR in the presence of CHX. This indicates that de novo protein
synthesis is required for GA repression and BR induction of
GA5 transcription or mRNA accumulation. Regardless of
whether GA5 is a primary or late GA reponse gene, this is
consistent with a simple model in which a labile repressor is required
for GA negative feedback regulation of GA5 (Meier et al.,
2001 ).
Both GA5-LUC activity and endogenous GA5
transcripts levels increased upon BR treatment, indicating that
GA5 is transcriptionally regulated by this hormone.
However, GA5 mRNA levels are only moderately increased by BR
in the cpd mutant upon long-term EBR treatment, whereas
GA5-LUC activity was induced up to 11-fold after 32 h (Fig. 5A). This suggests that GA5 mRNA levels are regulated
both at the transcriptional and posttranscriptional levels, whereas the
GA5-LUC transgene lacks the corresponding
posttranscriptional control. We have observed a similar result with new
alleles of the late-flowering fpa mutant (Koornneef et al.,
1991 ) in which the GA5-LUC reporter is highly expressed,
whereas GA5 transcripts levels are only slightly higher than
in WT (Meier et al., 2001 ). In an alternate manner, it is possible that
the GA5-LUC reporter used here lacks cis elements that
negatively regulate GA5 transcriptional induction by BR. In
addition, BR regulation of both GA5 and GASA1 was
clearly visible in cpd, whereas it was only moderate in WT (Fig. 4A). Moreover, the GA5-LUC reporter lacked apparent BR
regulation in WT seedlings, whereas a strong BR up-regulation was
detected in cpd (Fig. 5A). In a similar manner, BR induction
of the xyloglucan endotransglycosylase homologs MERI-5 and
TCH4 was only visible in BR-deficient mutants (Kauschmann et
al., 1996 ). Two complementary explanations may account for these
differences. First, hormonal desensitization pathways necessary for
homeostatic growth control may be less active in hormone deficient
mutants than in WT. Second, tissue-specific hormonal effects may be
masked in WT if both hormonal and other signals contribute to basal
levels of target gene expression.
In conclusion, results presented here confirm and extend earlier
reports of interactions between the important plant growth regulators
GA and BR. Although certain of these interactions appear to be
antagonistic, BR induction of GA5 indicates that BR
potentiates GA activity, at least in certain tissues. Elucidation of
both transcriptional and posttranscriptional mechanisms will be
required to understand how BR and GA regulate common targets involved
in the control of cell elongation and plant growth.
 |
MATERIALS AND METHODS |
Plant Material and Hormone Treatments
The T4 Arabidopsis ecotype Col-0 line carrying 400 bp of the GA5 promoter driving the expression of the
FF-LUC reporter (GA5-LUC) is described elsewhere (Meier et al., 2001 ). This line is homozygous for a single locus carrying the kanamycin resistance marker and exhibits sufficient LUC activity for bioluminescence imaging. The
GA5-LUC reporter was introduced by
crossing into the T-DNA-tagged cpd mutant (a gift from
Csaba. Koncz, Max-Planck Institut fur Zuchtungsforschung, Koln,
Germany), followed by segregation analysis for kanamycin
resistance and cpd dwarfism in the F3
population. Double mutants impaired in both GA and BR synthesis were
generated by fertilizing the GA-treated ga1-1 mutant
(Koornneef and van der Veen, 1980 ) with cpd pollen.
F1 generation seedlings were selected for hygromycin
resistance, which cosegregates with the cpd mutation.
F2 generation seedlings homozygous for ga1-1
(i.e. required exogenous GA for flowering) and heterozygous for
cpd (i.e. hygomycin resistant, not cpd
phenotype) were amplified to produce the F3 population,
from which double mutants (25%) were visually selected. Joanne Chory
(The Salk Institute for Biological Studies, La Jolla, CA)
provided bri1-1 seeds. Seeds were surface sterilized and
germinated on Murashige and Skoog medium supplemented with 0.7%
(w/v) agar and 1% (w/v) Suc. Unless specified, hormone treatments were performed on 2-week-old seedlings, which were transferred to liquid Murashige and Skoog medium 24 h prior to treatment. Exogenous application of GA (50 µM
GA3, Sigma-Aldrich, Vallenbæk, Strand, Denmark) and
BR (0.1-1 µM 24-EBR, Sigma) was performed by adding the
hormones to the medium for various times as indicated.
Generation of Arabidopsis Mutants
Approximately 25,000 bulked seeds were -irradiatiated (60 kRad) from a cobalt60 source (RISØ Industrial Irradiation,
Risø, Denmark). M1 seeds were bulked in pools of
1,250 seeds each and propagated in a long-day greenhouse. The
bri1-201 mutant was visually selected from
M2 progeny.
Reporter Assays
LUC bioluminescence imaging was performed as previously
described (Raventos et al., 2000 ; Meier et al., 2001 ). In brief,
bioluminescence was measured after spraying transgenic plants
expressing either the GA5-LUC or the
GA4-LUC reporters uniformly with 5 mM
luciferin (JBL/Promega, Madison, WI) in 0.01% (w/v) Triton
X-100. Plates were imaged three times for 5 min, and a
bright-field reference image was taken thereafter. The first image was
discarded due to chlorophyll phosphorescence, and the two remaining LUC
images analyzed with the image-1/Metamorph system version 3.0 (Universal Imaging Corp., Downingtown, PA).
RNA Analysis
Total RNA was extracted from plant tissue using the RNAgent kit
(Promega) and Poly-A RNAs isolated using the PolyA-tract kit IV
(Promega). Poly-A RNA samples (1 µg) were size fractionated on 1.2%
(w/v) agarose/formaldehyde gel and blotted onto Hybond N+
membranes (Amersham, Pharmacia Biotech, Horsholm, Denmark).
Transcript levels of genes involved in GA and BR biosynthesis
(GA5, GA4, and CPD), genes encoding
GA-signaling pathway components (RGA and GAI), as
well as GA-regulated genes (GASA-1) were investigated. Ribonucleic 32P-CTP antisense probes were synthesized using
T7 RNA polymerase (Ribokit, Promega) from partial cDNA 3' sequences
cloned in the pGEM-Teasy vector (Promega) using the following primer
combinations: GA5, aaggcctttgtggtcaatatcggc and
gagatgctaaaaggtgttattgcc; GA4, ggtccgaaggtttcaccatcac and
gagctttgttgaagtgagttgc; RGA, tggttcgtccggtttagcgccg and
cagttcggtttaggtcttggtcc; GAI, cgggtctgctgggtttgcgg and
tagtttggcttcggtcggaaatc; and GASA-1, ctctccttggagaatcatggct and
acactcacaacgacaacgtacg. Hybridization and washing conditions were
performed as recommended by the manufacturer. As a control, radioactive
signals were quantified on all membranes by comparison to signals
obtained after subsequent blotting with an elongation factor alpha
probe (EF1- , Axelos et al., 1989 ), whose transcript levels appeared
unaffected by either GA3 or EBR treatment (not shown).
Mapping of the Dwarf Mutant
Plants heterozygous for the bri1-201 allele
conferring dwarfism (Col-0 ecotype) were crossed to the Landsburg
erecta ecotype. Mapping of the mutation was performed on
F2 progeny exhibiting the dwarf phenotype using simple
sequence-length polymorphism markers (Bell and Ecker, 1994 ). Sequencing
of the BRI gene from the bri1-201 mutant was performed with an ABI
prism sequencer (Perkin Elmer, Nærum, Denmark).
ACKNOWLEDGMENTS
We are grateful to Joanne Chory and Csaba Koncz for
supplying bri1-1 and cpd seeds, Suksawad
Vongvisuttikun for excellent technical assistance, and Henrik Næsted
for stimulating discussions.
 |
FOOTNOTES |
Received February 20, 2001; returned for revision April 10, 2001; accepted June 18, 2001.
1
This research was funded by the European Union
(grant nos. CT96-0062 and CT96-0621 to J.M.) and by a Danish research
grant (no. 93524444A98000040 to R.F.). T.B. was funded by a
postdoctoral Marie Curie Research training grant.
*
Corresponding author; e-mail mundy{at}biobase.dk; fax
45-35322128.
Article, publication date, and citation information can be found at
www.plantphysiol.org/cgi/doi/10.1104/pp.010173.
 |
LITERATURE CITED |
-
Axelos M, Bardet C, Liboz T, Le Van Thai A, Curie C, Lescure B
(1989)
The gene family encoding the Arabidopsis thaliana translation elongation factor EF-1 alpha: molecular cloning, characterization and expression.
Mol Gen Genet
219: 106-112[CrossRef][ISI][Medline]
-
Azpiroz R, Wu Y, LoCascio JC, Feldmann KA
(1998)
An Arabidopsis brassinosteroid-dependent mutant is blocked in cell elongation.
Plant Cell
10: 219-230[Abstract/Free Full Text]
-
Bell CJ, Ecker JR
(1994)
Assignment of 30 microsatellite loci to the linkage map of Arabidopsis.
Genomics
19: 137-144[CrossRef][ISI][Medline]
-
Bowling SA, Guo A, Cao H, Gordon AS, Klessig DF, Dong X
(1994)
A mutation in Arabidopsis that leads to constitutive expression of systemic acquired resistance.
Plant Cell
6: 1845-1857[Abstract/Free Full Text]
-
Chiang HH, Hwang I, Goodman HM
(1995)
Isolation of the Arabidopsis GA4 locus.
Plant Cell
7: 195-201[Abstract]; erratum Chiang HH, Hwang I, Goodman HM (1997) Plant Cell 9: 979-980
-
Clouse SD, Langford M, McMorris TC
(1996)
A brassinosteroid-insensitive mutant in Arabidopsis thaliana exhibits multiple defects in growth and development.
Plant Physiol
111: 671-678[Abstract]
-
Ephritikhine G, Fellner M, Vannini C, Lapous D, Barbier-Brygoo H
(1999)
The sax1 dwarf mutant of Arabidopsis thaliana shows altered sensitivity of growth responses to abscisic acid, auxin, gibberellins and ethylene and is partially rescued by exogenous brassinosteroid.
Plant J
18: 303-314[CrossRef][ISI][Medline]
-
Friedrichsen DM, Joazeiro CA, Li J, Hunter T, Chory J
(2000)
Brassinosteroid-insensitive-1 is a ubiquitously expressed leucine-rich repeat receptor serine/threonine kinase.
Plant Physiol
123: 1247-1256[Abstract/Free Full Text]
-
Goetz M, Godt DE, Roitsch T
(2000)
Tissue-specific induction of the mRNA for an extracellular invertase isoenzyme of tomato by brassinosteroids suggests a role for steroid hormones in assimilate partitioning.
Plant J
22: 515-522[CrossRef][ISI][Medline]
-
Gregory LE, Mandava N
(1982)
The activity and interaction of brassinolide and gibberellic acid in mung bean (Phaseolus aureus) epicotyls.
Physiol Plant
54: 239-243
-
He Z, Wang ZY, Li J, Zhu Q, Lamb C, Ronald P, Chory J
(2000)
Perception of brassinosteroids by the extracellular domain of the receptor kinase BRI1.
Science
288: 2360-2363[Abstract/Free Full Text]
-
Herzog M, Dorne AM, Grellet F
(1995)
GASA, a gibberellin-regulated gene family from Arabidopsis thaliana related to the tomato GAST1 gene.
Plant Mol Biol
27: 743-752[CrossRef][ISI][Medline]
-
Johnson PR, Ecker JR
(1998)
The ethylene gas signal transduction pathway: a molecular perspective.
Annu Rev Genet
32: 227-254[CrossRef][ISI][Medline]
-
Kauschmann A, Jessop A, Koncz C, Szekeres M, Willmitzer L, Altmann T
(1996)
Genetic evidence for an essential role of brassinosteroids in plant development.
Plant J
9: 701-713[CrossRef]
-
Koornneef M, Hanhart CJ, van der Veen JH
(1991)
A genetic and physiological analysis of late flowering mutants in Arabidopsis thaliana.
Mol Gen Genet
229: 57-66[ISI][Medline]
-
Koornneef M, van der Veen JH
(1980)
Induction and analysis of gibberellin sensitive mutants in Arabidopsis thaliana (L.) Heynh.
Theor Appl Genet
58: 257-263[CrossRef][ISI]
-
Li J, Chory J
(1997)
A putative leucine-rich repeat receptor kinase involved in brassinosteroid signal transduction.
Cell
90: 929-938[CrossRef][ISI][Medline]
-
Mathur J, Molnar G, Fujioka S, Takatsuto S, Sakurai A, Yokota T, Adam G, Voigt B, Nagy F, Maas C
(1998)
Transcription of the Arabidopsis CPD gene, encoding a steroidogenic cytochrome P450, is negatively controlled by brassinosteroids.
Plant J
14: 593-602[CrossRef][ISI][Medline]
-
Medford JI, Elmer JS, Klee HJ
(1991)
Molecular cloning and characterization of genes expressed in shoot apical meristems.
Plant Cell
3: 359-370[Abstract/Free Full Text]
-
Meier C, Bouquin T, Nielsen ME, Raventos D, Mattsson O, Rocher A, Schomburg F, Amasino R, Mundy J
(2001)
Gibberellin response mutants identified by luciferease imaging.
Plant J
25: 509-519[CrossRef][ISI][Medline]
-
Noguchi T, Fujioka S, Choe S, Takatsuto S, Yoshida S, Yuan H, Feldmann KA, Tax FE
(1999)
Brassinosteroid-insensitive dwarf mutants of Arabidopsis accumulate brassinosteroids.
Plant Physiol
121: 743-752[Abstract/Free Full Text]
-
Peng J, Carol P, Richards DE, King KE, Cowling RJ, Murphy GP, Harberd NP
(1997)
The Arabidopsis GAI gene defines a signaling pathway that negatively regulates gibberellin responses.
Genes Dev
11: 3194-3205[Abstract/Free Full Text]
-
Phillips AL, Ward DA, Uknes S, Appleford NE, Lange T, Huttly AK, Gaskin P, Graebe JE, Hedden P
(1995)
Isolation and expression of three gibberellin 20-oxidase cDNA clones from Arabidopsis.
Plant Physiol
108: 1049-1057[Abstract]
-
Rademacher M
(1989)
Gibberellins: metabolic pathways and inhibitors of biosynthesis.
In
B Sandman, ed, Target Sites of Herbicide Action. CRC Press, Inc., Boca Raton, FL, pp 127-145
-
Raventos D, Meier C, Jensen AB, Mattsson O, Mundy J
(2000)
Fusion genetic analysis of gibberellin signaling mutants.
Plant J
22: 427-438[CrossRef][ISI][Medline]
-
Silverstone AL, Chang C, Krol E, Sun TP
(1997)
Developmental regulation of the gibberellin biosynthetic gene GA1 in Arabidopsis thaliana.
Plant J
12: 9-19[CrossRef][ISI][Medline]
-
Silverstone AL, Ciampaglio CN, Sun T
(1998)
The Arabidopsis RGA gene encodes a transcriptional regulatorrepressing the gibberellin signal transduction pathway.
Plant Cell
10: 155-169[Abstract/Free Full Text]
-
Szekeres M, Nemeth K, Koncz-Kalman Z, Mathur J, Kauschmann A, Altmann T, Redei GP, Nagy F, Schell J, Koncz C
(1996)
Brassinosteroids rescue the deficiency of CYP90, a cytochrome P450, controlling cell elongation and de-etiolation in Arabidopsis.
Cell
85: 171-182[CrossRef][ISI][Medline]
-
Xu YL, Li L, Wu K, Peeters AJ, Gage DA, Zeevaart JA
(1995)
The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: molecular cloning and functional expression.
Proc Natl Acad Sci USA
92: 6640-6644[Abstract/Free Full Text]
-
Zurek DM, Clouse SD
(1994)
Molecular cloning and characterization of a brassinosteroid-regulated gene from elongating soybean (Glycine max L) epicotyls.
Plant Physiol
104: 161-170[Abstract]
© 2001 American Society of Plant Physiologists
This article has been cited by other articles:

|
 |

|
 |
 
D. Huang, W. Wu, S. R. Abrams, and A. J. Cutler
The relationship of drought-related gene expression in Arabidopsis thaliana to hormonal and environmental factors
J. Exp. Bot.,
August 1, 2008;
59(11):
2991 - 3007.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Hu, M. G. Mitchum, N. Barnaby, B. T. Ayele, M. Ogawa, E. Nam, W.-C. Lai, A. Hanada, J. M. Alonso, J. R. Ecker, et al.
Potential Sites of Bioactive Gibberellin Production during Reproductive Growth in Arabidopsis
PLANT CELL,
February 1, 2008;
20(2):
320 - 336.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Weiss and N. Ori
Mechanisms of Cross Talk between Gibberellin and Other Hormones
Plant Physiology,
July 1, 2007;
144(3):
1240 - 1246.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Roxrud, S. E. Lid, J. C. Fletcher, E. D. L. Schmidt, and H.-G. Opsahl-Sorteberg
GASA4, One of the 14-Member Arabidopsis GASA Family of Small Polypeptides, Regulates Flowering and Seed Development
Plant Cell Physiol.,
March 1, 2007;
48(3):
471 - 483.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Marti, C. Gisbert, G. J. Bishop, M. S. Dixon, and J. L. Garcia-Martinez
Genetic and physiological characterization of tomato cv. Micro-Tom
J. Exp. Bot.,
June 1, 2006;
57(9):
2037 - 2047.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Assmann
G Protein Signaling in the Regulation of Arabidopsis Seed Germination
Sci. Signal.,
November 1, 2005;
2005(308):
cm11 - cm11.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Lange, J. Kappler, A. Fischer, A. Frisse, T. Padeffke, S. Schmidtke, and M. J. P. Lange
Gibberellin Biosynthesis in Developing Pumpkin Seedlings
Plant Physiology,
September 1, 2005;
139(1):
213 - 223.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Villalobos, D. Bartels, and G. Iturriaga
Stress Tolerance and Glucose Insensitive Phenotypes in Arabidopsis Overexpressing the CpMYB10 Transcription Factor Gene
Plant Physiology,
May 1, 2004;
135(1):
309 - 324.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Goda, S. Sawa, T. Asami, S. Fujioka, Y. Shimada, and S. Yoshida
Comprehensive Comparison of Auxin-Regulated and Brassinosteroid-Regulated Genes in Arabidopsis
Plant Physiology,
April 1, 2004;
134(4):
1555 - 1573.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Alabadi, J. Gil, M. A. Blazquez, and J. L. Garcia-Martinez
Gibberellins Repress Photomorphogenesis in Darkness
Plant Physiology,
March 1, 2004;
134(3):
1050 - 1057.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Mora-Garcia, G. Vert, Y. Yin, A. Cano-Delgado, H. Cheong, and J. Chory
Nuclear protein phosphatases with Kelch-repeat domains modulate the response to brassinosteroids in Arabidopsis
Genes & Dev.,
February 15, 2004;
18(4):
448 - 460.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Mussig, G.-H. Shin, and T. Altmann
Brassinosteroids Promote Root Growth in Arabidopsis
Plant Physiology,
November 1, 2003;
133(3):
1261 - 1271.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Perez-Flores, F. Carrari, R. Osuna-Fernandez, M. V. Rodriguez, S. Enciso, R. Stanelloni, R. A. Sanchez, R. Bottini, N. D. Iusem, and R. L. Benech-Arnold
Expression analysis of a GA 20-oxidase in embryos from two sorghum lines with contrasting dormancy: possible participation of this gene in the hormonal control of germination
J. Exp. Bot.,
September 1, 2003;
54(390):
2071 - 2079.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Bouquin, O. Mattsson, H. Naested, R. Foster, and J. Mundy
The Arabidopsis lue1 mutant defines a katanin p60 ortholog involved in hormonal control of microtubule orientation during cell growth
J. Cell Sci.,
March 1, 2003;
116(5):
791 - 801.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Ullah, J.-G. Chen, S. Wang, and A. M. Jones
Role of a Heterotrimeric G Protein in Regulation of Arabidopsis Seed Germination
Plant Physiology,
June 1, 2002;
129(2):
897 - 907.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Olszewski, T.-p. Sun, and F. Gubler
Gibberellin Signaling: Biosynthesis, Catabolism, and Response Pathways
PLANT CELL,
May 1, 2002;
14(90001):
S61 - 80.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. J. Bishop and C. Koncz
Brassinosteroids and Plant Steroid Hormone Signaling
PLANT CELL,
May 1, 2002;
14(90001):
S97 - 110.
[Full Text]
[PDF]
|
 |
|
|