|
Plant Physiol, November 2001, Vol. 127, pp. 1030-1043
Response of Arabidopsis to Iron Deficiency Stress as Revealed by
Microarray Analysis1
Oliver
Thimm,
Bernd
Essigmann,
Sebastian
Kloska,
Thomas
Altmann, and
Thomas J.
Buckhout*
Applied Botany, Humboldt University Berlin, Invalidenstrasse 42, 10115 Berlin, Germany (O.T., T.J.B.); and Max Planck Institute of
Molecular Plant Physiology, Am Mühlenberg 1, 14476 Golm,
Germany (B.E., S.K., T.A.)
 |
ABSTRACT |
Gene expression in response to Fe deficiency was analyzed in
Arabidopsis roots and shoots through the use of a cDNA collection representing at least 6,000 individual gene sequences. Arabidopsis seedlings were grown 1, 3, and 7 d in the absence of Fe, and gene expression in roots and shoots was investigated. Following confirmation of data and normalization methods, expression of several sequences encoding enzymes known to be affected by Fe deficiency was investigated by microarray analysis. Confirmation of literature reports,
particularly for changes in enzyme activity, was not always possible,
but changes in gene expression could be confirmed. An expression
analysis of genes in glycolysis, the tricarboxylic acid cycle,
and oxidative pentose phosphate pathway revealed an induction of
several enzymes within 3 d of Fe-deficient growth, indicating an
increase in respiration in response to Fe deficiency. In roots,
transcription of sequences corresponding to enzymes of anaerobic
respiration was also induced, whereas in shoots, the induction of
several genes in gluconeogenesis, starch degradation, and phloem
loading was observed. Thus, it seemed likely that the energy demand in
roots required for the Fe deficiency response exceeded the capacity of
oxidative phosphorylation, and an increase in carbon import and
anaerobic respiration were required to maintain metabolism.
 |
INTRODUCTION |
The role of Fe as an essential
nutrient and its function in metabolism have been investigated in
detail (Marschner, 1995 ; Fox and Guerinot, 1998 ). Fe is abundant
in most soils, and plants can accumulate superoptimal levels of Fe and
suffer from Fe toxicity when grown for example under hypoxia (Drew,
1997 ). However, under aerobic conditions the physical-chemical
properties of Fe dictate the formation of highly insoluble Fe-oxides
and -hydroxides, making Fe limiting for plant growth (Marschner,
1995 ). Mechanisms by which plants adapt to Fe deficiency have
been frequently described in grasses (strategy II) and other plants
(strategy I) and are the subject of comprehensive reviews (e.g.
Guerinot and Yi, 1994 ; Moog and Brüggemann, 1994 ; Schmidt,
1999 ).
The primary visible symptom of Fe deficiency in the field is the
development of intercostal chlorosis principally on young leaves. In
this regard, Fe deficiency stress is correlated with changes in
chloroplast ultrastructure (Spiller and Terry, 1980 ) and decreased
expression of the small and large subunits of Rubisco, of chlorophyll
a/b-binding proteins, and of chlorophyll, among other proteins (Spiller et al., 1987 ; Winder and Nishio, 1995 ). When
grown under Fe-limiting conditions, plants could compensate for the
lack of Fe through an increased Fe uptake capacity. These adaptive
reactions in strategy I plants involved both morphological and
metabolic changes in roots and shoots. Roots of Fe-deficient plants
showed increased numbers and length of root hairs (Landsberg, 1986 ;
Schmidt et al., 2000 ) and the formation of transfer cells (Landsberg,
1982 ; Schmidt and Bartels, 1996 ). In addition, strategy I plants showed
increased rates of Fe reduction at the root surface (Chaney et al.,
1972 ; Robinson et al., 1999 ), increased acidification of the
rhizosphere (Römheld et al., 1984 ), secretion of riboflavin-like compounds (Susin et al., 1993 ), and increased capacity for Fe uptake
(Chaney et al., 1972 ; Eide et al., 1996 ; Eckhardt, et al., 2001 ). These
changes serve primarily to increase the surface area between the plant
and the soil as well as the availability of Fe for uptake.
The biochemical and genetic components that are involved in the
response to Fe deficiency have been identified only in isolated cases.
A correlation exists between the development of
Fe3+-chelate reductase activity, acidification of
the rhizosphere, and the accumulation of citrate and malate in roots
(Landsberg, 1986 ). In particular, the accumulation of malate has been
interpreted in terms of the pH-stat theory (Sakano, 1998 ). As a
consequence of apoplast acidification during the response to Fe
deficiency, the pH of the root cytosol and vacuole increased (Espen et
al., 2000 ). In support of the pH-stat, several
investigations have established a correlation between Fe
deficiency stress and increased non-photosynthetic carbon fixation and
phosphoenolpyruvate (PEP) carboxylase activity (PEPCase;
e.g. Rabotti et al., 1995 ; De Nisi and Zocchi, 2000 ). Increased
activity of three glycolytic enzymes in cucumber (Cucumis
sativus) roots, namely glyceraldehyde-3-phosphate dehydrogenase,
pyruvate kinase, and Fru-6-phosphate kinase, indicated an elevated
glycolysis activity in response to Fe deficiency (Espen et al., 2000 ).
Glyceraldehyde-3-phosphate dehydrogenase was also shown to be increased
in Fe-deficient tomato (Lycopersicon esculentum) roots (Herbik et al., 1996 ). Whether this increase is a result of
decreased oxidative respiration or due to funneling of carbon out of
glycolysis as a result of an increased PEPCase activity was not
entirely clear, although increased formate dehydrogenase and ascorbate
peroxidase in Fe-deficient tomato roots and superoxide dismutase and
plastocyanin in leaves would support a decreased oxidative respiration
and/or photosynthesis due to Fe deficiency (Herbik et al.,
1996 ).
With the goal to better understand the processes involved in the
adaptation to Fe deficiency stress, we have investigated gene
expression using a large collection of Arabidopsis cDNA clones. Using
this approach, we have been able to confirm and extend many of the
observations made using enzymological and molecular biological methods.
 |
RESULTS |
Evaluation of the Response to Fe Deficiency
Induction of Fe3+-chelate reductase activity
was shown to correlate with the Fe deficiency response (Schmidt, 1994 ;
Moog et al., 1995 ) and was used in this study to determine the Fe
nutritional status of Arabidopsis after growth in the absence of Fe.
Compared with control plants (+Fe), the activity of reductase was
induced 1.2-, 3.1-, and 6.3-fold in test plants ( Fe) after 1, 3, and 7 d of Fe-deficient growth, respectively. Root hair development has been described as a morphological response to Fe deficiency and was
observed on roots after 3 d of growth but was less prominent after
7 d of growth in the absence of Fe (Schmidt et al., 2000 ).
Analysis of the Source of Variability in the Array Data
The signal intensities corresponding to individual cDNA clones
were normalized to relative gene expression levels (REL; S. Kloska, B. Essigmann, and T. Altmann, unpublished data) to allow comparison between experiments as described (see "Materials and Methods," Eqs. 1 and 2). Because the intensity of a signal depended on the efficiency of cDNA synthesis, labeling, and the amount of cDNA
bound to the membrane (Schuchhardt et al., 2000 ), data were normalized
with respect to these parameters. Prior to analysis of the effect of
nutritional status on the expression of individual cDNA clones, the
inherent variability of the data and the effect of normalization were
analyzed in detail. In comparison with scatter plots of raw data,
signal variation of normalized data was improved and allowed comparison
of REL obtained from different hybridization experiments
(data not shown).
For each of the time points, three independent hybridization
experiments were conducted. cDNA clones were spotted twice on the
membrane. To evaluate the magnitude of hybridization effects on signal
variation, REL was analyzed in sequential hybridizations at
the same location on the filter. In Figure
1, A through C, an example is shown of
such comparisons for REL of a clone at position 1 for
control shoots (+Fe) after 3 d of treatment. Each clone was
compared with itself at the same position on the filter for three
hybridizations (i.e. first hybridization versus the second, the first
versus the third, and the second versus the third). As is apparent, the
variability between hybridizations was similar (compare with Fig. 1,
A-C). Thus, variability inherent in the experimental procedure (e.g.
labeling and hybridization conditions) was significant but relatively
constant.

View larger version (53K):
[in this window]
[in a new window]
|
Figure 1.
Scatter plot analysis of signal variability. The
effect of different factors on signal variation was analyzed:
repetition of hybridization (A-C), position on the filter (D-F), and
Fe deficiency (G-I). Quantified and normalized signals were expressed
as REL of control shoot (+Fe) and test shoot ( Fe) arrays
after 1 d Fe (D and G), 3 d Fe (A-C, E, and H), and
7 d Fe (F and I). To analyze the influence of hybridization
repetitions on signal variation, control shoot REL (3 d
Fe) of different hybridizations were scattered: first versus second
(A), first versus third (B), and second versus third (C) hybridization.
cDNA clones were doubly spotted on filters at position 1 and 2. To
exclude position-induced signal variation, REL at position 1 were compared. Position-induced REL variation is shown in D
through F. REL of doubly spotted cDNA clones of one filter
were scattered: position 1 versus 2. Data of control shoot arrays after
1, 3, and 7 d of Fe (D-F, respectively) of the first
hybridization are given as an example. The influence of Fe deficiency
on REL is presented in G through I (1, 3, and 7 d Fe,
respectively). Shoot control (+Fe) versus shoot test ( Fe) arrays were
compared. REL variations due to hybridization repetition and
position on the filter were excluded using REL of the first
hybridization and at position 1. For comparison of signal variation,
guide lines were added to figures (y = 2x,
y = x/2).
|
|
In addition, the effect of the position of a cDNA clone on the filter
on REL was determined for experiments after 1, 3, and 7 d of Fe-deficient growth, respectively (Fig. 1, D and E). Comparisons were made between the single REL of the doubly spotted cDNA
clones at positions 1 and 2 on the same filter. Although
position-related variation was somewhat greater at 3 d compared
with 1 and 7 d, position-related signal variation was generally
minor compared to variations induced by hybridization repetitions
(compare with Fig. 1, A-F).
Finally, the normalized hybridization signals of cDNA clones for
control (+Fe) and test shoots ( Fe) were compared with respect to
hybridization and position on the membrane. Comparisons were made by
scatter plot analysis of REL corresponding to clones of the
first hybridization spotted at position 1 on the filter. Clear changes
in expression levels could be observed for all experiments but were
most prominent after 3 d and least prominent after 1 d of Fe
deficiency (Fig. 1, G-I). Although the variability in REL
related to Fe deficiency was greater than those related to hybridization or clone position, they were not great enough to neglect
variability from other sources.
Because the variability was not distributed over the filter equally,
common statistical methods (e.g. the Student's t test) were
not suitable to select Fe-regulated clones. To take all sources of
variations into consideration, an induction factor (IF) was calculated for each clone as described in "Materials and Methods" (Eq. 3). By this method, dimensionless values were obtained that allowed comparisons of changes in REL between different
treatments and hybridization experiments. Throughout the investigation,
only clones with a mean REL of > 0.1 were further analyzed.
Clones with an IF > ±1 were defined initially as
differentially expressed under Fe deficiency. In specific cases, clones
encoding metabolic enzymes were analyzed regardless of the absolute
value of the IF (see below).
General Changes in REL and IF Related
to Fe Deficiency
A summary of the number of clones that met the criterion
REL > 0 .1 and IF > ±1 is shown in Table
I. In support of the results obtained
from the scatter plot analyses (Fig. 1H), changes in REL
under Fe deficiency were most prominent for both shoot and root after
3 d of Fe-deficient growth. Following 1 d Fe deficiency, the
number of induced and repressed clones was approximately equal. Continued Fe deficiency stress resulted initially in a larger increase
in the number of induced than repressed clones in shoots. In shoots
after 3 d of Fe deficiency, 13.9% of the total cDNA clones
(16,128 clones in total) were induced and 3.8% were repressed, whereas
after 7 d these numbers were reduced to 5.2% induced and 1.9%
repressed. A different trend was found in roots. After 1 and 3 d
Fe deficiency, 0.5% and 4.8% of the clones were induced and an equal
percentage repressed in roots, respectively. The percentage of
repressed clones remained approximately constant (4.6%) after 7d of Fe
deficiency, but the percentage of induced clones decreased to 0.9%. In
light of the clearly visible Fe deficiency symptoms observed in shoots
after 7 d Fe-deficient growth and the increased proportion of
repressed clones in roots, it seems apparent that the plants after
7 d of treatment were severely stressed.
View this table:
[in this window]
[in a new window]
|
Table I.
Differentially expressed cDNA clones in Arabidopsis
shoots and roots after 1-, 3-, and 7-d Fe deficiency
Differential expression was determined by comparison of quantified and
normalized signals from control (+Fe) and test ( Fe) arrays expressed
as IF. cDNA clones were defined as induced or repressed with
a median IF > ±1. Only cDNA clones with a mean
REL > 0.1 were used.
|
|
In an attempt to identify changes in REL associated with the
Fe deficiency response, the published expressed sequence tag (EST)
sequences of approximately 2,800 cDNA clones from all experiments were
compared with databases as described in "Materials and Methods" to
verify their identity and then grouped into eight functional categories
(Fig. 2). The largest group,
"unknown," contained between 27% and 43% of all cDNA clones. The
distribution of the induced clones in the seven remaining groups is
summarized for the three time points in Figure 2. The categories
summarize cDNA clones as follows: metabolism (amino acid, carbon,
lipid, nucleic acid, nucleotide sugar and secondary metabolism,
glycolysis, and respiration- and microbody-associated clones), protein
(protein modification and catabolism), transport (nutrient uptake and
homeostasis), signaling (DNA binding, RNA binding, signal perception,
and transduction cDNA clones), photosynthesis, cellular organization
(cell wall and development, cytoskeleton, and intracellular
trafficking), and stress.

View larger version (28K):
[in this window]
[in a new window]
|
Figure 2.
Distribution of induced clones. Alteration of
REL was determined by IF > ±1 for each
detectable clone (REL > 0.1). Clones were compared to
online database to predict function by homology and were grouped to
eight functional categories: metabolism (amino acid, carbon, lipid,
nucleic acid, nucleotide sugar and secondary metabolism, glycolysis,
and respiration- and microbody-associated clones), protein (protein
modification and catabolism), transport (nutrient uptake and
homeostasis), signaling (DNA binding, RNA binding, signal perception,
and transduction cDNA clones), photosynthesis, cellular organization
(cell wall and development, cytoskeleton, and intracellular
trafficking), and stress. Shown are data of three experiments (1, 3, and 7 d Fe deficiency) in shoot and root. The number of clones in
each category is expressed in percent (%) of the cDNA clones analyzed
(ranging from 85-363).
|
|
In roots, the proportion of cDNA clones coding for proteins involved in
metabolism and stress reactions increased with increasing Fe-deficient
growth, whereas in shoots, the proportion of induced clones in these
categories remained relatively constant. Particularly noteworthy is the
relatively large proportion of cDNA clones for signaling in root that
were induced already after 1 d. With increased Fe deficiency
growth, the proportion of induced signaling clones decreased. In
shoots, the number of clones in the signaling category was not changed
with increasing Fe deficiency stress.
cDNA clones that were repressed were also analyzed, although except for
clones encoding enzymes involved in photosynthesis, which were
increasingly repressed with increasing stress treatment, no significant
trends could be identified (data not shown). The large number of
repressed cDNA clones encoding photosynthetic enzymes in roots was
somewhat surprising. We have no explanation for this observation.
High-resolution, electrophoretic analyses of all fractions showed no
chloroplast rRNA in the root RNA preparations (data not shown; Agilent
2100 Bioanalyzer, Waldbronn, Germany) The presence of
photosynthetic enzymes in roots has been reported previously
(Silverthorne and Tobin, 1990 ).
A table containing the cDNA clones with the greatest IF in
each category is available from our website
(http://www.biologie.hu-berlin.de/~botanik).
Specific Changes in IF in cDNA Clones for Reference
Genes
Changes in expression were investigated in cDNA clones for enzymes
whose activity, transcription, or translation have been previously
reported to be influenced by Fe nutritional status. Decreased enzyme
activity under Fe deficiency was reported for the heme proteins,
catalase and peroxidase (Machold, 1968 ) and the Fe-sulfur proteins,
ferredoxin (Alcaraz et al., 1986 ), aconitase (De Vos et al., 1986 ), and
we assumed also for Fe-SOD as a Fe-containing protein (Sevilla et al.,
1984 ). Fe-containing lipoxygenase (Hildebrand, 1989 ) and the storage
protein ferritin (Gaymard et al., 1996 ) were also decreased in
Fe-deficient plants. In contrast,
H+-ATPase (Dell'Orto et al., 2000 ),
formate dehydrogenase (Suzuki et al., 1998 ), lysyl-tRNA synthetase
(Giritch et al., 1997 ), and adenine phosphoribosyltransferase (Itai et
al., 2000 ) were shown to be increased in expression or enzyme activity
under Fe deficiency.
REL for all cDNA clones encoding the enzymes mentioned above
were extracted from the microarray data, and an IF was
calculated as described below. Reference clone data for 1-, 3-, and 7-d
Fe deficiency experiments in shoots and roots are shown in Figure 3. Changes in expression were presented
as a mean change in IF for all cDNA clones with homology to
reference genes. In general, changes in REL did not
consistently agree with changes in enzyme activity reported in the
literature. Whereas the REL for ferritin and ferredoxin was
decreased (Fig. 3, D and G), in agreement with published reports, on
average the IF for catalase, aconitase, and lipoxygenase varied little
with the length of Fe deficiency (Fig. 3, A, C, and E). Changes of
±25% were considered of marginal significance. The expression
patterns of other groups of cDNA clones were complex. For example, in
early stages of Fe deficiency, Fe-SOD (Fig. 3E) was induced in shoots
and repressed in roots, whereas after 7 d shoot expression was
repressed and no change was detected in roots. Fe deficiency stress
induced REL of peroxidase in shoots, although depressed
enzyme activities were reported by Machold (1968) . Induction was
found in cDNA clones for H+-ATPase and lysyl-tRNA
synthetase, in shoots after 3 and 7 d of Fe deficiency (Fig. 3, H
and J, respectively) but not in roots. cDNA clones for the formate
dehydrogenase and adenine phosphoribosyltransferase (Fig. 3, I and K,
respectively) revealed no significant changes of REL. In
summary, agreement between changes in REL and reported enzyme activity was not consistent.

View larger version (35K):
[in this window]
[in a new window]
|
Figure 3.
Array data of 1, 3, and 7 d of Fe deficiency
for shoots (S) and roots (R). Extracted were data of clones with
significant homology to reference clones that were described as
repressed (A-G) or induced (H-K) in gene expression, enzyme activity,
or translational level by Fe deficiency. Shown are means of
IF of all detectable cDNA clones (REL > 0.1) as a value for Fe deficiency-induced change of expression level.
Vertical lines separate different experiments (1, 3, and 7 d of
Fe) and indicate a change in expression of ±50%.
|
|
Specific Changes in IF in cDNA Clones Glycolysis,
Tricarboxylic Acid Cycle (TCA), and Oxidative Pentose Phosphate
(OPP) Pathways
The results presented here indicated Fe deficiency induced changes
in root metabolism (Fig. 2). To gain further insight into the nature of
these changes, three pathways were analyzed in detail. As with the
reference cDNA clones investigated above, all cDNA clones with homology
to genes for glycolysis, citric acid cycle, and oxidative pentose
phosphate cycle were extracted from microarray data. Clones with
IF < ±1 were also selected from data, but clones were
excluded with a REL mean < 0.1. In the Figures
4 through 6,
regulation of genes is shown as mean of IF for all homolog clones. Data from 1-, 3-, and 7-d experiments is shown individually and
separated for shoots and roots. Glycolytic reactions, including PEPCase
and pyruvate dehydrogenase, and fermentation were also shown in Figure
4. In general, no changes in REL were found following 1 d of Fe-deficient growth. However, following 3 d the
REL for cDNA clones encoding several glycolysis enzymes
increased. In roots, these changes were found primarily in clones
homologous to enzymes in fermentation (lactate dehydrogenase, pyruvate
decarboxylase, and alcohol dehydrogenase), and in shoots the
REL of clones for hexokinase, Glc-6-phosphate isomerase, Fru
bisphosphate aldolase, and triose phosphate isomerase were increased.
In addition, genes encoding -amylase, the phosphate translocator,
and the H+-Suc symporter were induced after
3 d of Fe deficiency; although no induction was observed for the
Suc phosphate synthase.

View larger version (30K):
[in this window]
[in a new window]
|
Figure 4.
Fe deficiency-induced changes in expression of
genes involved in glycolysis. Shown are means of IF of all
detectable cDNA clones (REL > 0.1) with homology to
the genes shown. Presentation of the data is shown in the standard
graph to the left: IF means of 1, 3, and 7 d of Fe
deficiency for roots (R) and shoots (S). Vertical lines separate
different experiments and indicate a change in expression of ±50%.
|
|
Changes in REL for enzymes in the citrate cycle, including
the available glyoxylate cycle enzymes, isocitrate lyase, malate dehydrogenase, electron transport chain, and cytochrome c
oxidoreductases were summarized in Figure 5. As for glycolysis, no
changes in REL were observed after 1 d of Fe-deficient
growth. The increased REL in roots for succinate
dehydrogenase, cytochrome c reductase/oxidase, and to a
lesser extent fumarate dehydratase and succinyl-CoA ligase were
noteworthy. The REL for shoot enzymes shown in Figure 5 was largely unchanged with the exception of succinate dehydrogenase, cytochrome c, and cytochrome c reductase/oxidase
after 3 d of Fe-deficient growth and isocitrate dehydrogenase
after 7 d. Two available glyoxylate cycle enzymes and the
anaplerotic enzyme, PEP carboxykinase, were largely unchanged
throughout the analysis period.

View larger version (21K):
[in this window]
[in a new window]
|
Figure 5.
Fe deficiency-induced changes in expression of
genes involved in citrate cycle. Shown are means for IF of
all detectable cDNA clones (REL > 0.1) with homology
to the genes shown. Presentation of the data is shown in the standard
graph to the left: IF means of 1, 3, and 7 d of Fe
deficiency for roots (R) and shoots (S). Vertical lines separate
different experiments and indicate a change in expression of
±50%.
|
|
Finally, the expression of enzymes of the OPP pathway was investigated
(Fig. 6). NADPH was reported to be the source of reductant for the
chelated Fe3+ at the plasma membrane. An
increased flow of carbon through the oxidative pentose phosphate
pathway has been observed in Fe-deficient Phaseolus vulgaris
roots, and interpreted in terms of synthesis of NADPH for
Fe3+-chelate reduction (Lubberding et al., 1988 ).
Although cDNA clones for both the Glc-6-phosphate dehydrogenase and
6-phosphogluconate dehydrogenase were induced after 3 d of Fe
deficiency, this increase only occurred in shoots. Thus, either
regulation of the OPP pathway occurred at a level other than gene
expression, or due to lack of Fe in the nutrient media, there was no
increased demand for NADPH in the roots used in this study.

View larger version (23K):
[in this window]
[in a new window]
|
Figure 6.
Fe deficiency-induced changes in expression of
genes involved in oxidative pentose phosphate cycle. Shown are means of
IF of all detectable cDNA clones (REL > 0.1)
with homology to the genes shown. Presentation of the data is shown in
the standard graph to the left: IF means of 1, 3, and 7 d of Fe deficiency for roots (R) and shoots (S). Vertical lines
separate different experiments and indicate a change in expression of
±50%.
|
|
 |
DISCUSSION |
To estimate the reliability of the microarray system used in this
study, an extensive investigation of the variability of signal
intensity and source of errors was conducted. To visually estimate
signal variability, scatter plot analysis proved valuable. As a result
of these investigations, the variability due to cDNA synthesis,
labeling, or hybridization predominated. In fact, this variability in
the data equaled that induced by changes in REL due to Fe
nutritional status (compare Fig. 1, A-C, with G-I). To circumvent
these errors, IF was calculated. IF was useful
for comparison of changes in REL between hybridizations and
experiments but give no estimation of the level of REL.
Using this approach, we have been able to identify steps in metabolic
pathways where induction or repression of specific cDNA clones occurred
(see below). In cases where several clones are present (e.g. alcohol dehydrogenase), the IF represents an average of the behavior
of all clones.
To aid in evaluation of the data, induced or repressed cDNA clones were
identified and categorized (Fig. 2). Using this approach, it was
evident that the proportion of metabolic cDNA clones that were induced
increased with increasing Fe stress in roots, whereas in shoots little
change in distribution over time was observed. Although this general
trend held true, individual clones did not always follow this pattern
(e.g. hexokinase; see below). Data analysis was hampered by the general
disarray of the EST database. A large number of cDNA clones were
incorrectly annotated. Sequencing of approximately 200 cDNA clones of
interest revealed that at least 15% of the sequences obtained did not
correspond to those reported in the EST databases. Therefore, drawing
conclusions from single clones would only be possible after confirming
identity. Sequencing has been done only for selected cDNA clones that
were shown in Figures 4 through 6.
Behavior of Reference cDNA Clones to Fe Deficiency
To verify the reliability of the microarray analysis, it would
have been desirable to investigate cDNA clones such as IRT1 and FRO2,
which encode an Fe transporter and the
Fe3+-chelate reductase, respectively, and whose
expression is induced under Fe deficiency (Eide et al., 1996 ; Robinson
et al., 1999 ). However, these cDNA clones were not included in the
collection available for this study. The clones 117P14T7 and 221A15T7
were identified as FRO2 homolog and FRO1/FRO2-like protein. The
expression levels of these clones were found to be induced in
Fe-deficient roots after 1 d of Fe with an IF of 0.79 and 0.22, respectively. After 7 d of Fe, the clone 117P14T7
showed an IF of 0.26 for shoots, whereas 221A15T7 was not
expressed. As an alternative, reference clones were selected from the
data that have been reported to be induced or repressed by Fe
deficiency (Fig. 3). In most cases, these changes were determined for
enzyme activity. In some examples, the behavior of clones selected did
not correspond to the expected results, based on the literature.
Catalase, peroxidase, and aconitase have been reported to decrease in
activity and expression of formate dehydrogenase shown to increase Fe
deficiency; however, the REL of these cDNA clones remained
unchanged or, in the case of peroxidase, increased over the period
investigated. Other cDNA clones did behave in whole or in part as
expected, particularly when the response to Fe deficiency had progressed.
Ferritin was of particular interest. After 24 h of Fe-deficient
growth, the REL for ferritin already was decreased in roots, and repression was significant in both roots and shoots after 3 and
7 d of Fe-deficient growth. This result confirms the publication of Gaymard et al. (1996) . Thus, for ferritin the response to Fe deficiency developed first in the roots and subsequently in the shoots.
Acidification of the rhizosphere was often correlated with the response
to Fe deficiency in several plants. Acidification of the apoplast was
presumed to increase the solubility of Fe3+
and increase its availability. However, an induction of the plasma membrane H+-ATPase was observed primarily in
shoots and only weakly after 3 d in roots. This finding indicated
that the increase in apoplast acidification in roots was not due to
increased ATPase synthesis. Expression of lysyl-tRNA synthetase was
found to be increased in Fe-deficient tomatoes (Giritch et al., 1997 ),
an observation supported in the present study (Fig. 3K). However the
significance of this increase remains obscure. The expression of
adenine phosphoribosyltransferase, an enzyme in the Yang cycle, was
increased in barley but only weakly in tobacco (Itai et al., 2000 ). Its
increased expression in grasses has been interpreted in the framework
of phytosiderophore synthesis. Nicotianamine is thought to share the
same biosynthetic pathway in dicotyledons as phytosiderophores in
grasses. In agreement with findings in tobacco, adenine
phosphoribosyltransferase was induced in roots and not shoots under Fe
deficiency stress.
The fact that the behavior of the reference clones did not agree in
every case with reports in the literature may not be surprising. Expression of changes in REL in the form of an IF
offered no insight into the level of expression. Weakly expressed cDNA
clones, whose expression changed dramatically, would only slightly
affect the mean IF as calculated here. In addition,
transcriptional regulation is only one form of control for enzyme
activity. Posttranscriptional modification and allosteric enzyme
regulation represent equally important mechanisms for control of
activity and flux through an enzyme pathway.
REL in Specific Metabolic Pathways
Because of the proportional increase in expression of metabolic
clones during Fe deficiency stress, the microarray data obtained in
this study were used to analyze the changes in REL in three central metabolic pathways. In glycolysis, as for OPP and TCA cycles,
no clear changes in REL were observed after 1 d.
However, after 3 d of Fe-deficient growth, several steps in these
pathways showed significant changes.
In 3-d Fe-deficient roots, the enzymes associated with anaerobic
metabolism, namely lactate dehydrogenase, pyruvate decarboxylase, and
alcohol dehydrogenase, were induced. In addition, an induction in roots
for several enzymes in the TCA cycle (isocitrate dehydrogenase, succinyl CoA ligase, succinate dehydrogenase, and fumarate hydratase) and in the mitochondrial electron transport chain (cytochrome c reductase and oxidase) were observed. An enhancement of
respiration rate has also been reported in Fe-deficient roots (Espen et
al., 2000 ). Because the hydroponic cultures used in this study were continuously aerated, the transcriptional induction of enzymes associated with anaerobic metabolism was probably not a result of
hypoxia. Rather, these results were interpreted as an attempt to
increase energy production through oxidative phosphorylation. Because
heme synthesis in the absence of Fe was not possible, regulation by de
novo synthesis of electron transport proteins could not occur in roots.
Induction of fermentation reactions would lead to an increased NADH
consumption and maintain carbon flow and energy production by
glycolytic reactions.
In Fe-deficient roots, an increase in dark CO2
fixation has been reported frequently, beginning with Rhoads and
Wallace (1960) . PEP carboxylase activity has also been shown to be
induced in Fe-deficient roots (De Nisi and Zocchi, 2000 ;
Lopéz-Millán et al., 2000 ). Increased PEP carboxylase
activity would lead to increased synthesis of oxalacetate and malate
that has been shown to occur in roots of Fe-deficient strategy I
plants. The microarray data presented here confirmed these reports
(Fig. 3). The PEPCase was shown to be regulated posttranscriptionally
in C4 and CAM plants (Chollet et al., 1996 ). This may explain an
IF of only 0.46 in roots after 3 d of Fe, whereas
enzyme activities were induced about 4-fold in Fe-deficient cucumber
roots (De Nisi and Zocchi, 2000 ) and up to 60-fold in sugar beet root
tips after 10 d of Fe deficiency (Lopéz-Millán et al.,
2000 ).
Despite the induction of PEPCase expression in roots, ultimately the
root must import carbon for energy. This increased demand can only be
met by export from the shoots. In shoots, the IF in the
activation phase of glycolysis was increased for hexokinase, Glc-6-phosphate isomerase, aldolase, and triose phosphate isomerase. In
principle, these changes are consistent with either an increased carbon
flow toward gluconeogenesis or glycolysis. The lack of change in
IF for the anaplerotic step catalyzed by the PEP
carboxykinase (Fig. 5) and in the IF for Suc phosphate
synthase does not argue for an increased flow through gluconeogenesis
in shoots. In fact, the development of chlorosis after 3 d of
Fe-deficient growth and the repression of numerous
photosynthesis-related EST sequences might indicate an increased
respiration in shoots. However, the induction of cDNA clones encoding
the UDP-Glc pyrophosphorylase, the H+-Suc
symporter, the H+-ATPase (Fig. 3 H), the
phosphate translocator, and -amylase would lead to mobilization of
starch and to export of carbon from shoots. This export would be needed
to fuel the increased carbon demand in roots resulting from an
anaerobic respiration.
 |
CONCLUSIONS |
Microarray techniques revealed changes of expression level due to
Fe deficiency and have allowed insights into the transcriptional regulation of most enzymes in glycolysis, the TCA cycle, and the OPP
pathway. These data indicated that previously observed increase in
respiration activity in response to Fe deficiency involved transcriptional regulation of several genes encoding metabolic enzymes.
The dramatic induction in expression for enzymes usually involved in
anaerobic respiration was interpreted as an effect of Fe deficiency on
energy production through oxidative phosphorylation. To maintain carbon
flow through glycolysis under conditions of decreased electron
transport, oxidation of NADH would be necessary.
 |
MATERIALS AND METHODS |
Plant Material and Growth Conditions
Arabidopsis cv Landsberg erecta was grown under controlled
conditions in a growth chamber (day/night regime of 10 h,
21°C/14 h, 18°C, photon flux density of approximately 300 µmol 2 s 1, relative humidity 75%).
The nutrient solution was composed of KNO3 (3 mM), MgSO4 × 7 H2O (0.5 mM), CaCl2 × 6 H2O (1.5 mM), K2SO4 (1.5 mM),
NaH2PO4 × 2 H2O (1.5 mM), H3BO3 (25 µM),
MnSO4 × 4 H2O (1 µM),
ZnSO4 × 7 H2O (0.5 µM),
(NH4)6Mo7O24 (0.05 µM), CuSO4 × 5 H2O (0.3 µM), and Fe-EDTA (40 µM) with pH adjusted
to 6 with KOH (Schmidt, 1994 ). Thirty or 32 d after sowing, Fe was
removed from the media for 1, 3, or 7 d. Shoots and roots were
separated when harvesting the plants at the end of the light period.
From Fe-sufficient and -deficient treatments, a minimum of 40 plants was pooled for RNA preparation to minimize biological variation. The
Fe3+-chelate reductase activity was determined as a measure
of the response to Fe deficiency as described by Moog et al.
(1995) .
RNA Preparation and Radiolabeling
Total RNA was extracted from shoots and roots (RNeasy Midi Kit,
Qiagen GmbH, Hilden, Germany). For reverse transcription and radiolabeling, 10 µg total RNA was used (SuperScript II, GibcoBRL, Karlsruhe, Germany; [33P]CTP, Amersham Pharmacia,
Freiburg, Germany). After transcription, RNA was hydrolyzed with
NaOH (0.25 N) and neutralized with HCl (0.2 N) and sodium phosphate
buffer (40 mM, pH 7.2). Labeling efficiency was controlled
by scintillation countering (LS6500, Beckman, Munich) after removal of
unincorporated oligonucleotides by Sephadex G-50 chromatography (NICK
Columns, Amersham Pharmacia).
Reference and Complex Hybridization
A set of 16,128 cDNA clones from the Michigan State University
(East Lansing) collection, characterized by EST analysis (Newman et al., 1994 ), was provided by the Arabidopsis Biological Resource Center (Columbus, OH). The cDNA was amplified by PCR using
LacZ-specific primers (forward LacZ1 5' GCTTCCGGCTC GTATGTTGTGTG 3' and
reverse LacZ2 5' AAAGGGGGATGTGCTGCAAGGCG 3'). The PCR products were
spotted automatically onto nylon membranes (Biogrid, Biorobotics,
Cambridge, UK; Nytran Supercharge, 22.2 × 22.2 cm,
Schleicher and Schüll, Dassel, Germany). PCR products were
not checked on an agarose gel for contamination before spotting. To
normalize the amount of spotted cDNA, a reference hybridization for
each filter was carried out using [33P]-labeled PCR
product-specific primer (T4 polynucleotide kinase, New England
Biolabs, Beverly, MA; [33P]ATP, Amersham
Pharmacia; 5' TTCCCAGTCACGA 3'). The filters were hybridized at 5°C
overnight and washed for 40 min at 5°C in SSarc (4× SSC, 7%
[v/v] Sarcosyl NL30, and 4 µM EDTA). Filters were exposed for 16 h on imaging plates and detected with a
phosphorimager (BAS-1800, Fuji, Tokyo). Radioactivity was removed from
filters by washing two times in SSarc at 65°C for 30 min. After
prehybridization for 2 h at 65°C in Church buffer (7% [w/w]
SDS, 1 mM EDTA, pH 8.0, and 0.5 M sodium
phosphate, pH 7.2) containing salmon sperm DNA (100 ng
ml 1, Roth, Carl GmbH & Co, Karlsruhe, Germany),
filters were hybridized with the labeled cDNA probe at 65°C for
36 h. Washing steps were carried out at 65°C for 20 min each
with 1× SSC, 0.1% (w/v) SDS, 4 mM
Na2PO4 (pH 7.2); 0.2× SSC, 0.1% (w/v)
SDS, 4 mM Na2PO4 (pH 7.2);
and 0.1× SSC, 0.1% (w/v) SDS, 4 mM
Na2PO4 (pH 7.2). The filters were exposed on
imaging plates for 16 h and signals were detected using a
phosphorimager (BAS-1800 II, Fuji) followed by stripping for 1 h
at 65°C (0.1% [w/v] SDS and 5 mM
Na2PO4, pH 7.2) as above. Hybridization of each
filter was repeated three times with a newly synthesized and labeled
cDNA probe of the corresponding RNA pool.
Data Analysis
For data analysis, the signal intensities of the reference and
test hybridization were quantified using the software Arrayvision (Imaging Research Inc., Haverhill, UK). A predefined grid,
determining the area of signal quantification, was manually optimized
to ensure correct signal recording. The quantified signal, defined as
photostimulated luminescence mm 2, was
linked to the corresponding cDNA clone ID in the database.
The cDNA on the filter were arranged as 4 × 4 arrays, each
containing seven doubly spotted clones, a human gene (desmin) to control nonspecific hybridization (not used in this study), and an
empty field to determine specific local background
(LBx). In this manner,
LB was determined at 2,304 positions on each filter. To
improve comparability of different hybridizations, the quantified signals were normalized. Normalization of the total radioactivity bound
to the nylon membrane was conducted according to the formula (S. Kloska, B. Essigmann, and T. Altmann, unpublished data):
|
(1)
|
where RAWx was the activity detected at a
specific position "x" on the filter and corresponded to a unique
cDNA clone and LBx was the local
background corresponding to
RAWx.
To correct for the amount of spotted cDNA (REF)
on the filter andfor the spotting and PCR efficiency, the signals were
evaluated as follows:
|
(2)
|
where REFx is the
activity of a unique clone derived from the reference hybridization and
LBx is the local background for the
reference hybridization corresponding to
REFx. The quotient of
RAWnorm and
REFnorm was defined as
REL.
To identify cDNA clones that were differentially expressed
under Fe deficiency, the REL from control (+Fe) and test
( Fe) roots and shoots were compared at 1, 3, and 7 d of
Fe-deficient growth. To determine differential expression, an
IF for each cDNA clone was calculated from the
REL in control (RELT) and test
(RELC) arrays:
|
(3)
|
An IF > 1 indicates induction and
IF < 0 indicates repression. Single values of the
doubly spotted cDNA clones as well as repetition of hybridization were
treated individually to minimize signal variation. Thus, six
IF were obtained, from which a median was calculated.
Means of the REL were used to confirm expression levels;
cDNA clones with a REL mean < 0.1 were not analyzed further.
Possible functions of ESTs were obtained via clone
identification numbers or sequences from online databases (TIGR
Arabidopsis Gene Index, Institute for Genomic Research,
Rockville, MD; The Arabidopsis Information Resource, Stanford,
CA; and BLAST, National Center for Biotechnology Information, Bethesda, MD).
Throughout this manuscript, mention of EST clone
ID has not been made. RAW data of all experiments
as well as most induced clones shown in Figure 2 are available from our
website (http://www.biologie.hu-berlin.de/~botanik).
 |
ACKNOWLEDGMENTS |
We gratefully acknowledge Prof. H.-P. Herzel and Dieter
Beule for their advice, encouragement, and support with the analysis of
the data. We thank Sabine Fischer, Jeane Heyd, Peggy Lange, and Susanne
Olstowski-Jacoby for their expert technical assistance.
 |
FOOTNOTES |
Received February 22, 2001; returned for revision May 25, 2001; accepted July 12, 2001.
1
This work was supported in part by the Deutsche
Forschungsgemeinschaft (to T.A. and T.J.B.).
*
Corresponding author; e-mail h1131dqy{at}rz.hu-berlin.de; fax
49-03-2093-8725.
Article, publication date, and citation information can be found at
www.plantphysiol.org/cgi/doi/10.1104/pp.010191.
 |
LITERATURE CITED |
-
Alcaraz CF, Martinez-Sanchez F, Sevilla F, Hellin E
(1986)
Influence of ferredoxin levels on nitrate reductase activity in iron deficient lemon leaves.
J Plant Nutr
9: 1405-1413
-
Chaney RL, Brown JC, Tiffin LO
(1972)
Obligatory reduction of ferric chelates in iron uptake by soybeans.
Plant Physiol
50: 208-213[Abstract/Free Full Text]
-
Chollet R, Vidal J, O'Leary MH
(1996)
Phosphoenolpyruvate carboxylase: a ubiquitous, highly regulated enzyme in plants.
Annu Rev Plant Physiol Plant Mol Biol
47: 273-298[CrossRef][Web of Science]
-
Dell'Orto M, Santi S, De Nisi P, Cesco S, Varanini Z, Zocchi G, Pinton R
(2000)
Development of Fe-deficiency responses in cucumber (Cucumis sativus L.) roots: involvement of plasma membrane H(+)-ATPase activity.
J Exp Bot
51: 695-701[Abstract/Free Full Text]
-
De Nisi P, Zocchi G
(2000)
Phosphoenolpyruvate carboxylase in cucumber (Cucumis sativus L.) roots under iron deficiency: activity and kinetic characterization.
J Exp Bot
51: 1903-1909[Abstract/Free Full Text]
-
De Vos CR, Lubberding HJ, Bienfait HF
(1986)
Rhizosphere acidification as a response to iron deficiency in bean plants.
Plant Physiol
81: 842-846[Abstract/Free Full Text]
-
Drew MC
(1997)
Oxygen deficiency and root metabolism: injury and acclimation under hypoxia and anoxia.
Annu Rev Plant Physiol Plant Mol Biol
48: 223-250[CrossRef][Web of Science][Medline]
-
Eckhardt U, Mas Marques A, Buckhout TJ
(2001)
Two iron-regulated cation transporters from tomato complement metal uptake-deficient yeast mutants.
Plant Mol Biol
45: 437-448[CrossRef][Web of Science][Medline]
-
Eide D, Broderius M, Feit J, Guerinot ML
(1996)
A novel iron-regulated metal transporter from plants identified by functional expression in yeast.
Proc Natl Acad Sci USA
93: 5624-5628[Abstract/Free Full Text]
-
Espen L, Dell'Orto M, De Nisi P, Zocchi G
(2000)
Metabolic responses in cucumber (Cucumis sativus L.) roots under Fe-deficiency: a 31P-nuclear magnetic resonance in-vivo study.
Planta
210: 985-992[CrossRef][Web of Science][Medline]
-
Fox TC, Guerinot ML
(1998)
Molecular biology of cation transport in plants.
Annu Rev Plant Physiol Plant Mol Biol
49: 669-696[CrossRef][Web of Science]
-
Gaymard F, Boucherez J, Briat JF
(1996)
Characterization of a ferritin mRNA from Arabidopsis thaliana accumulated in response to iron through an oxidative pathway independent of abscisic acid.
Biochem J
15: 67-73
-
Giritch A, Herbik A, Balzer H-J, Ganal M, Stephan UW, Bäumlein H
(1997)
A root-specific iron-regulated gene of tomato encodes a lysyl-tRNA-synthetase-like protein.
Eur J Biochem
244: 310-317[Medline]
-
Guerinot ML, Yi Y
(1994)
Iron: nutritious, noxious and not readily available.
Plant Physiol
104: 815-820[CrossRef][Web of Science][Medline]
-
Herbik A, Giritch A, Horstmann C, Becker R, Balzer H-J, Bäumlein H, Stephan UW
(1996)
Iron and copper nutrition-dependent changes in protein expression in a tomato wild type and the nicotianamine-free mutant chloronerva.
Plant Physiol
111: 533-540[Abstract]
-
Hildebrand DF
(1989)
Lipoxygenases.
Physiol Plant
76: 249-253[CrossRef]
-
Itai R, Suzuki K, Yamaguchi H, Nakanishi H, Nishiyawa H-K, Yoshimura E, Mori S
(2000)
Induced activity of adenine phosphoribosyltransferase (APRT) in iron-deficient barley roots: a possible role for phytosiderophore production.
J Exp Bot
51: 1179-1188[Abstract/Free Full Text]
-
Landsberg EC
(1982)
Transfer cell formation in the root epidermis: a prerequisite for Fe-efficiency?
J Plant Nutr
5: 415-432
-
Landsberg EC
(1986)
Function of rhizodermal transfer cells in the Fe stress response mechanism of Capsicum annuum L.
Plant Physiol
82: 511-517[Abstract/Free Full Text]
-
Lopéz-Millán AF, Morales F, Andaluz S, Gogorcena Y, Abadía A, De Las Rivas J, Abaía J
(2000)
Responses of sugar beet roots to iron deficiency: changes in carbon assimilation and oxygen use.
Plant Physiol
124: 885-897[Abstract/Free Full Text]
-
Lubberding HJ, de Graf FHJM, Bienfait HF
(1988)
Ferric reducing activity in roots of Fe-deficient Phaseoulus vulgaris: source of reducing equivalents.
Biochem Physiol Pflanzen
183: 271-276
-
Machold O
(1968)
Einfluss der ernährungsbedingungen auf den zustand des eisens in den blättern, den chlorophyllgehalt und die katalase-, sowie peroxidaseaktivität.
Flora
159: 1-25
-
Marschner H
(1995)
Mineral Nutrition of Higher Plants. Academic Press, London
-
Moog PR, Brüggemann W
(1994)
Iron reductase systems on the plant plasma membrane: a review.
Plant Soil
165: 241-260
-
Moog PR, van der Kooij TAW, Brüggemann W, Schiefelbein JW, Kuiper PJC
(1995)
Responses to iron deficiency in Arabidopsis thaliana: the turbo iron reductase does not depend on the formation of root hairs and transfer cells.
Planta
195: 505-513[Medline]
-
Newman T, de Bruijn FJ, Green P, Keegstra K, Kende H, McIntosh L, Ohlrogge J, Raikhel N, Somerville S, Thomashow M
(1994)
Genes galore: a summary of methods for accessing results from large-scale partial sequencing of anonymous Arabidopsis cDNA clones.
Plant Physiol
106: 1241-1255[Abstract]
-
Rabotti G, De Nisi P, Zocchi G
(1995)
Metabolic implications in the biochemical responses to iron deficiency in cucumber (Cucumis sativus L.) roots.
Plant Physiol
107: 1195-1199[Abstract]
-
Rhoads WA, Wallace A
(1960)
Possible involvement of dark fixation of CO2 in lime-induced chlorosis.
Soil Sci
89: 248-256
-
Robinson NJ, Procter CM, Conolly EL, Guerinot ML
(1999)
A ferric-chelate reductase for iron uptake from soils.
Nature
397: 694-697
-
Römheld V, Müller C, Marschner H
(1984)
Localization and capacity of proton pumps in roots of intact sunflower plants.
Plant Physiol
76: 603-606[Abstract/Free Full Text]
-
Sakano K
(1998)
Revision of biochemical pH-stat: involvement of alternative pathway metabolism.
Plant Cell Physiol
39: 467-473[Abstract/Free Full Text]
-
Schmidt W
(1994)
Root-mediated ferric reduction: responses to iron deficiency, exogenously induced changes in hormonal balance and inhibition of protein synthesis.
J Exp Bot
45: 725-731[Abstract/Free Full Text]
-
Schmidt W
(1999)
Mechanisms and regulation of reduction-based iron uptake in plants.
New Phytol
141: 1-26[CrossRef]
-
Schmidt W, Bartels M
(1996)
Formation of root epidermal transfer cells in Plantago.
Plant Physiol
110: 217-225[Abstract]
-
Schmidt W, Tittel J, Schikora A
(2000)
Role of hormones in the induction of Fe deficiency responses in Arabidopsis root.
Plant Physiol
122: 1109-1118[Abstract/Free Full Text]
-
Schuchhardt J, Beule D, Malik A, Wolski E, Eickhoff H, Lehrach H, Herzel H
(2000)
Normalization strategies for cDNA microarrays.
Nucleic Acids Res
28: E47
-
Sevilla F, del Rio LA, Hellin E
(1984)
Superoxide dismutases from a citrus plant: presence of two iron-containing isoenzymes in leaves of lemon trees (Citrus limonum L.).
J Plant Physiol
116: 381-387
-
Silverthorne J, Tobin EM
(1990)
Post-transcriptional regulation of organ-specific expression of individual rbc mRNAs in Lemna gibba.
Plant Cell
12: 1181-1190[CrossRef]
-
Spiller SC, Kaufman LS, Thompson WF, Briggs WR
(1987)
Specific mRNA and rRNA levels in greening pea leaves during recovery from iron stress.
Plant Physiol
84: 409-414[Abstract/Free Full Text]
-
Spiller SC, Terry N
(1980)
Limiting factors of photosynthesis II: iron stress diminishes photochemical capacity by reducing the number of photosynthetic units.
Plant Physiol
65: 121-125[Abstract/Free Full Text]
-
Susin S, Abián J, Sánchez-Baeza F, Peleato JL, Abadia A, Gelpi E, Abadia J
(1993)
Riboflavin 3'- and 5'- sulfate, two novel flavins accumulating in the roots of iron-deficient sugar beet (Beta vulgaris).
J Biol Chem
268: 20958-20965[Abstract/Free Full Text]
-
Suzuki K, Itai R, Suzuki K, Nakanishi H, Nishizawa N-K, Yoshimura E, Mori S
(1998)
Formate dehydrogenase, an enzyme of anaerobic metabolism, is induced by iron deficiency in barley roots.
Plant Physiol
116: 725-732[Abstract/Free Full Text]
-
Winder TL, Nishio JN
(1995)
Early iron deficiency stress response in leaves of sugar beet.
Plant Physiol
108: 1487-1494[Abstract]
© 2001 American Society of Plant Physiologists
This article has been cited by other articles:

|
 |

|
 |
 
L. Zheng, F. Huang, R. Narsai, J. Wu, E. Giraud, F. He, L. Cheng, F. Wang, P. Wu, J. Whelan, et al.
Physiological and Transcriptome Analysis of Iron and Phosphorus Interaction in Rice Seedlings
Plant Physiology,
September 1, 2009;
151(1):
262 - 274.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Jain, M. D. Poling, A. P. Smith, V. K. Nagarajan, B. Lahner, R. B. Meagher, and K. G. Raghothama
Variations in the Composition of Gelling Agents Affect Morphophysiological and Molecular Responses to Deficiencies of Phosphate and Other Nutrients
Plant Physiology,
June 1, 2009;
150(2):
1033 - 1049.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. B. Tognetti, M. D. Zurbriggen, E. N. Morandi, M. F. Fillat, E. M. Valle, M.-R. Hajirezaei, and N. Carrillo
From the Cover: Enhanced plant tolerance to iron starvation by functional substitution of chloroplast ferredoxin with a bacterial flavodoxin
PNAS,
July 3, 2007;
104(27):
11495 - 11500.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Zocchi, P. De Nisi, M. Dell'Orto, L. Espen, and P. M. Gallina
Iron deficiency differently affects metabolic responses in soybean roots
J. Exp. Bot.,
March 1, 2007;
58(5):
993 - 1000.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Zhu, D. Schraut, W. Hartung, and A. R. Schaffner
Differential responses of maize MIP genes to salt stress and ABA
J. Exp. Bot.,
November 1, 2005;
56(421):
2971 - 2981.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Kobayashi, M. Suzuki, H. Inoue, R. N. Itai, M. Takahashi, H. Nakanishi, S. Mori, and N. K. Nishizawa
Expression of iron-acquisition-related genes in iron-deficient rice is co-ordinately induced by partially conserved iron-deficiency-responsive elements
J. Exp. Bot.,
May 1, 2005;
56(415):
1305 - 1316.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Liu, Z. Popovich, and D. M. Templeton
Global Genomic Approaches to the Iron-Regulated Proteome
Ann. Clin. Lab. Sci.,
January 1, 2005;
35(3):
230 - 239.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. P. Colangelo and M. L. Guerinot
The Essential Basic Helix-Loop-Helix Protein FIT1 Is Required for the Iron Deficiency Response
PLANT CELL,
December 1, 2004;
16(12):
3400 - 3412.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. E. Salt
Update on Plant Ionomics
Plant Physiology,
September 1, 2004;
136(1):
2451 - 2456.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. J. Nikiforova, B. Gakiere, S. Kempa, M. Adamik, L. Willmitzer, H. Hesse, and R. Hoefgen
Towards dissecting nutrient metabolism in plants: a systems biology case study on sulphur metabolism
J. Exp. Bot.,
August 1, 2004;
55(404):
1861 - 1870.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Shin and D. P. Schachtman
Hydrogen peroxide mediates plant root cell response to nutrient deprivation
PNAS,
June 8, 2004;
101(23):
8827 - 8832.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Hesse, V. Nikiforova, B. Gakiere, and R. Hoefgen
Molecular analysis and control of cysteine biosynthesis: integration of nitrogen and sulphur metabolism
J. Exp. Bot.,
June 1, 2004;
55(401):
1283 - 1292.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Muller and W. Schmidt
Environmentally Induced Plasticity of Root Hair Development in Arabidopsis
Plant Physiology,
January 1, 2004;
134(1):
409 - 419.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Rabbani, K. Maruyama, H. Abe, M. A. Khan, K. Katsura, Y. Ito, K. Yoshiwara, M. Seki, K. Shinozaki, and K. Yamaguchi-Shinozaki
Monitoring Expression Profiles of Rice Genes under Cold, Drought, and High-Salinity Stresses and Abscisic Acid Application Using cDNA Microarray and RNA Gel-Blot Analyses
Plant Physiology,
December 1, 2003;
133(4):
1755 - 1767.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
P. Casati and V. Walbot
Gene Expression Profiling in Response to Ultraviolet Radiation in Maize Genotypes with Varying Flavonoid Content
Plant Physiology,
August 1, 2003;
132(4):
1739 - 1754.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. K. Singh, L. M. McIntyre, and L. A. Sherman
Microarray Analysis of the Genome-Wide Response to Iron Deficiency and Iron Reconstitution in the Cyanobacterium Synechocystis sp. PCC 6803
Plant Physiology,
August 1, 2003;
132(4):
1825 - 1839.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. A. Vert, J.-F. Briat, and C. Curie
Dual Regulation of the Arabidopsis High-Affinity Root Iron Uptake System by Local and Long-Distance Signals
Plant Physiology,
June 1, 2003;
132(2):
796 - 804.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Uhde-Stone, K. E. Zinn, M. Ramirez-Yanez, A. Li, C. P. Vance, and D. L. Allan
Nylon Filter Arrays Reveal Differential Gene Expression in Proteoid Roots of White Lupin in Response to Phosphorus Deficiency
Plant Physiology,
March 1, 2003;
131(3):
1064 - 1079.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Gaballa, T. Wang, R. W. Ye, and J. D. Helmann
Functional Analysis of the Bacillus subtilis Zur Regulon
J. Bacteriol.,
December 1, 2002;
184(23):
6508 - 6514.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Brandt, S. Kloska, T. Altmann, and J. Kehr
Using array hybridization to monitor gene expression at the single cell level
J. Exp. Bot.,
December 1, 2002;
53(379):
2315 - 2323.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|