|
Plant Physiol, November 2001, Vol. 127, pp. 1157-1166
The Arabidopsis Gene Tardy Asynchronous Meiosis Is
Required for the Normal Pace and Synchrony of Cell Division during Male
Meiosis1
Jean-Louis
Magnard,2
Ming
Yang,3
Yun-Chia
Sophia
Chen,4
Michele
Leary, and
Sheila
McCormick*
Plant Gene Expression Center, United States Department of
Agriculture/Agricultural Research Service, University of California,
800 Buchanan Street, Albany, California 94710
 |
ABSTRACT |
Male meiosis in higher organisms features synchronous cell
divisions in a large number of cells. It is not clear how this synchrony is achieved, nor is it known whether the synchrony is linked
to the regulation of cell cycle progression. Here, we describe an
Arabidopsis mutant, named tardy asynchronous meiosis
(tam), that exhibits a phenotype of delayed and
asynchronous cell divisions during male meiosis. In Arabidopsis, two
nuclear divisions occur before simultaneous cytokinesis yields a tetrad
of haploid cells. In tam, cell divisions are delayed,
resulting in the formation of abnormal intermediates, most frequently
dyad meiotic products, or in rare cases, dyad pollen (two gametophytes
within one exine wall). Temperature-shift experiments showed that the
percentage of the abnormal intermediates increased at 27°C. Analysis
of tam and the
tam/quartet1 double mutant showed that
most of these abnormal intermediates could continue through the normal
rounds of cell divisions and form functional pollen, though at a slower
than normal pace. The asynchrony of cell division started at the G2/M transition, with cells entering metaphase at different time points, during both meiosis I and II. In addition, chromosome condensation defects and mis-segregation were sometimes observed in
tam. These observations suggest that the TAM protein
positively regulates cell cycle progression, perhaps by promoting the
G2/M transition. We speculate that there is a signal, perhaps TAM, that
couples the normal pace of cell cycle progression with the synchrony of cell division during male meiosis.
 |
INTRODUCTION |
Meiosis consists of two nuclear
divisions (karyokinesis) and one simultaneous or two successive
cytoplasmic divisions (cytokinesis). The final product of male meiosis
in flowering plants is a tetrad of haploid microspores enclosed in a
callose wall. Male meiosis usually occurs in a large enough population
of synchronously dividing cells to ensure sufficient fertility of the
organism. The synchrony in cell division is likely to be relevant to
the effectiveness of sexual reproduction, but molecular mechanisms
underlying this synchrony are poorly understood. However, molecular
mechanisms controlling cell cycle progression have been extensively
studied in eukaryotes (den Boer and Murray, 2000 ; Moser and Russell,
2000 ; Nebreda and Ferby, 2000 ; Walworth, 2000 ). Although it has not been shown, it is possible that the regulation of cell cycle
progression is linked to the regulation of synchronous divisions in
male meiosis of higher organisms.
The G2/M transition has been identified as one of the major checkpoints
of cell cycle progression. The mitosis-promoting factor (MPF), which
consists of B-type cyclins and cdc2-related cyclin-dependent kinases,
is the key regulator of the G2/M transition in all eukaryotes (Ohi and
Gould, 1999 ). The kinase component of the MPF phosphorylates numerous
substrates; these phosphorylations are necessary for progression of
multiple events during the onset of mitosis, including nuclear envelope
breakdown, centrosome (spindle pole body) duplication and separation,
spindle assembly, chromosome condensation, and Golgi fragmentation (Ohi
and Gould, 1999 ; Nigg, 2001 ). The extensive literature on factors that
activate and inactivate MPF indicates the importance and complexity of
regulation of MPF activity. In yeast and animals, numerous kinases and
phosphatases have been identified that regulate the function of MPF
(Kishimoto, 1999 ; Ohi and Gould, 1999 ; Nigg, 2001 ). Regulation of MPF
is also linked to MAP kinase-signaling pathways in yeast and mammalian
cells (Wilkinson and Millar, 2000 ). Many other factors regulate the G2/M transition by directly or indirectly regulating the function of
MPF. Examples of these factors include several cell cycle-regulating proteins in budding yeast (Saccharomyces cerevisiae;
Goh and Surana, 1999 ; Loy et al., 1999 ; Richman et al., 1999 ), a
cdc2-binding protein in Xenopus laevis oocytes (Ferby
et al., 1999 ), cyclin A1 in male meiosis of mouse (Mus
musculus; Liu et al., 2000 ), and cancer-related proteins in humans
(Cajone and Sherbet, 1999 ; Rippmann et al., 2000 ). Developmental cues
such as growth factors, hormones, cell adhesion status (Wilkinson and
Millar, 2000 ), and other conditions such as stress (Wilkinson and
Millar, 2000 ), DNA damage (Toyoshima et al., 1998 ), UV irradiation
(Athar et al., 2000 ), and temperature (Kong et al., 2000 ), can all
affect MPF function.
In higher plants, the G2/M transition is thought to operate via MPF
(Joubès et al., 2000 ; Mészáros et al., 2000 ), and
plant hormones such as auxin, cytokinin, and abscisic acid can
apparently regulate the activity of plant MPFs (Stals et al., 2000 ).
However, the underlying mechanisms of MPF regulation by plant hormones are unknown. Several recent studies have examined cell cycle
progression and cell division patterns during specific stages of plant
development. For example, in Arabidopsis, when pollen is released from
the anther, the sperm cells are at G1, but their cell cycle continues to progress during pollen tube growth (Friedman, 1999 ). By monitoring the expression of the CYCLIN B1;1 gene, Boisnard-Lorig et al. (2001) demonstrated that cell divisions in developing endosperm are
synchronous within discrete mitotic domains. However, to our knowledge,
no groups have explored whether cell cycle progression is coupled with
the synchronous cell divisions in male meiosis.
Together with other advantages as a model plant, Arabidopsis provides
an excellent system for molecular genetic studies of meiosis. In each
Arabidopsis flower, male meiosis occurs synchronously in about 500 microspore mother cells in the four medial anthers. Here, we describe a
new mutation in Arabidopsis, tardy asynchronous meiosis
(tam). The tam allele is temperature sensitive,
but tam plants are fertile and even at the restrictive
temperature can set seeds. We show that the tam mutant
exhibits delayed and asynchronous cell divisions during male meiosis.
The delay occurs in both meiosis I and II, at the G2/M transition. Our
observations suggest a possible link between the control of G2/M
transition and the synchrony of cell division in male meiosis.
 |
RESULTS |
Isolation and Genetic Analysis of tam
In a screen for mutations affecting pollen development,
M2 plants from an ethyl methanesulfonate
(EMS)-mutagenized population were screened for mutant phenotypes at the
mature pollen stage. In one M2 plant, although
the majority of the pollen grains appeared normal (Fig.
1A), we saw a low percentage
(approximately 1%) of abnormal pollen grains that were composed of two
gametophytes within one exine wall (Fig. 1B). This abnormal phenotype
was heritable, indicating that it was caused by a mutation. To
determine how these abnormal pollen grains arose in this mutant, we
analyzed earlier stages of pollen development, starting at the stage
when a callose wall surrounds the microspore mother cells. An apparent abnormality was first observed at the tetrad stage. The WT tetrads had
four equal-sized spores enclosed in a callose wall (Fig. 1C). In the
mutant, instead of tetrads, we saw many dyads (Fig. 1D). Other
cell clusters in the mutant anthers contained different numbers of
spores, ranging from three to seven, and some of them had more than one
nucleus (Table I; see later description
of the mutant phenotype). The aberrant clusters seen at this
developmental stage indicate that the mutant has a meiotic defect.
Because it is easier to score for aberrant clusters than to search for
rare twin gametophytes in mature pollen, in most experiments we used tetrad stage anthers to identify the mutant plants. We named the mutant
tam, for reasons discussed below.

View larger version (165K):
[in this window]
[in a new window]
|
Figure 1.
Formation of double gametophytes and dyad meiotic
products in tam. A, Normal-looking pollen grains in
tam. B, Two pollen grains in one exine wall in
tam. The two brightly fluorescent nuclei visible in the
tricellular pollen grain correspond to the two sperm cells; the
vegetative nucleus is out of the plane of focus. C, Wild-type (WT)
tetrads, showing the characteristic tetrahedral arrangement of the four
microspores enclosed in a callose wall. Usually one or two spores are
out of focus. D, Dyads in tam. Note the callose wall.
4',6-Diamidino-2-phenylindole (DAPI) staining was used. Scale bar, 10 µm.
|
|
View this table:
[in this window]
[in a new window]
|
Table I.
Dynamics of microspore mother cells and meiotic
products in tam anthersa
MMC, Microspore mother cells, which had one to two nuclei; N, nuclear
no. in meiotic products; C, cell no. in meiotic products.
|
|
Because tam was identified in a single
M2 plant, it was unknown whether it was a
dominant or recessive mutation. A plant with the tam
phenotype was outcrossed to WT Columbia. All F1
plants had a WT phenotype, and selfing of each of these
F1 plants gave roughly a 3:1 ratio of
normal:tam progeny (data not shown), indicating that
tam is a recessive mutation.
A mapping population of 100 plants and available simple
sequence-length polymorphism (SSLP), cleaved-amplified polymorphic sequence (CAPS), and RFLP markers were used to map
tam to the long arm of chromosome 1, between SSLP nF22K20
and CAPS agp64. The distance between the two markers is 550 kb
(Arabidopsis Genome Initiative, 2000 ). Another meiotic mutant,
mei1 (He and Mascarenhas, 1998 ), maps in this interval. We
tested whether tam was allelic to mei1 by
crossing tam/tam and
mei1/mei1. All the F1
plants showed WT male meiosis; thus, tam is not allelic to
mei1.
Mutant Phenotype Is Temperature Sensitive
In addition to dyads (Fig. 1D), tam plants have, in
less abundance, other types of aberrant tetrads, including polyads and nontetrahedral tetrads. For simplicity, we group all the types together
and use the term aberrant tetrads to describe the phenotype. We scored
the percentage of aberrant tetrads in tam plants. We noticed
considerable variation in the percentage of aberrant tetrads between
plants when plants were grown at 22°C. As shown in Figure 2, tam plants always had some
aberrant tetrads, but the percentage varied from 5% to more than 90%.
We also noticed that there were always close to 100% aberrant tetrads
in greenhouse-grown tam plants during the warmer summer
months, when the temperature could reach 27°C. Thus, the mutant
phenotype appeared to be sensitive to higher temperature. To determine
more precisely how temperature influences the percentage of aberrant
tetrads, a temperature-shift experiment was conducted. As shown in
Figure 3, 13 plants with less than 30%
aberrant tetrads were first grown at 22°C and then at 27°C for
24 h. We point out that different buds from the same plant were
dissected and scored before and after the temperature shift. If a bud
is dissected and scored before the temperature shift, the microspore
mother cells or tetrads within that bud cannot be followed through the
temperature shift. However, because buds at the same stage on a plant
have a similar percentage of aberrant tetrads on a particular day, we
assumed that all the buds on the plant would respond equivalently to
the temperature shift. The temperature shift dramatically increased the
percentage of aberrant tetrads in each plant. A 12- to 24-h exposure to
27°C induced nearly 100% aberrant tetrads. After the plants were
returned to 22°C for 24 h, the percentage of aberrant tetrads
decreased to a value that was even lower than the starting value in
each plant. In contrast, WT plants never showed aberrant tetrads in all
tested growing conditions (data not shown). These results indicate that
tam is temperature sensitive and suggest that the TAM
protein in the mutant is partially active at the permissive temperature. In later descriptions of the mutant and WT phenotypes, unless noted, we used plants grown in a growth chamber at
27°C.

View larger version (16K):
[in this window]
[in a new window]
|
Figure 3.
Temperature sensitivity of the
tam mutation. Thirteen plants were first grown at 22°C,
then at 27°C for 24 h, and then returned to 22°C. The aberrant
tetrads were scored before the temperature shift to 27°C, after the
8-, 12-, and 24-h time points at 27°C, and 24 h after return to
22°C. The data are expressed as the mean and
SE.
|
|
Male Meiotic Cell Cycle Progression Is Slower in
tam Than in WT
There are two types of cytokinesis in male meiosis in plants:
successive cytokinesis and simultaneous cytokinesis. Successive cytokinesis, as seen in maize (Zea mays; Staiger and Cande,
1991 ), occurs after both the first and second nuclear divisions of
meiosis, whereas simultaneous cytokinesis, as in Arabidopsis (Peirson
et al., 1997 ), occurs only once, after meiosis II.
The dyads observed in tam could result because an ectopic
cytokinesis occurs after meiosis I, or because meiosis I is slower but
cytokinesis occurs at the normal time. To determine how aberrant
tetrads, mainly the dyads, are formed in tam plants, we
examined the progression of the meiotic cell cycle in two consecutive
buds in inflorescences from both WT and tam plants. During
meiosis in a WT inflorescence, a smaller bud is always less advanced
than the next larger bud in development. We reasoned that comparing the
developmental stages in two consecutive buds might reveal different
paces in stage progression between WT and tam buds. The
younger and older buds are defined as bud 1 and 2, respectively. In WT,
we found that when bud 1 was at interphase I, bud 2 could be at any
stage from leptotene to tetrad (Fig. 4).
When bud 1 in WT was at a later stage than interphase I, bud 2 stages
ranged from telophase I to free spores (Fig. 4). In
contrast, when bud 1 in tam is at interphase I, bud 2 was
never found past the diplotene stage (Fig. 4, solid vertical bar on the
left). When bud 1 in tam is at the leptotene stage, bud 2 could be at any stage from zygotene to cytokinesis. If cytokinesis had
occurred in bud 2, it usually resulted in dyad formation (Fig. 4, solid
vertical bar on the right). These results strongly suggest that in
tam, cell cycle progression in male meiosis is significantly
delayed but that the timing of cytokinesis is not dramatically altered.
Figure 4 suggests that the first obvious delay occurs at the G2/M
transition of meiosis I.

View larger version (21K):
[in this window]
[in a new window]
|
Figure 4.
Comparison of meiotic stages in two consecutive
buds in both WT and tam plants. The lengths of the arrows
represent the ranges of stages of the buds. The numbers above the
arrows are the numbers of buds examined. Small arrowheads indicate bud
1, and large arrowheads indicate bud 2. Int I, Interphase I; Lep,
leptotene; Zyg, zygotene; Pac, pachytene; Dip, diplotene; Tel I,
telophase I; Pro II, prophase II; Tel II, telophase II; Cyt,
cytokinesis; Spores, free spores.
|
|
Dyads Are Not Terminal in Development
Our initial analysis of tam was hampered by the fact
that the percentage of aberrant tetrads fluctuated, even in the same plant grown under controlled temperature conditions. For example, one
plant had 22% aberrant tetrads on the 1st d it was scored. On the 5th
d, the percentage of aberrant tetrads had increased to 79%, but on the
7th d, the percentage of aberrant tetrads dropped to 22.5%. Later, we
noticed that higher percentages of aberrant tetrads were usually found
in tam anthers at early tetrad stages, as indicated by the
presence of microspore mother cells without cytokinesis (Table I, class
2). Conversely, higher percentages of normal tetrads were found in
older anthers, as indicated by the absence of microspore mother cells
without cytokinesis (Table I, classes 3 and 4). We used Alexander's
stain to assess pollen viability (Alexander, 1969 ). Dehiscent anthers
of tam plants had approximately 74% viable pollen when
grown at 22°C and still had approximately 59% viable pollen when
grown at 27°C for 4 d. The tam plants have reasonable
seed set at both the permissive and restrictive temperature.
The developmental fluctuation in the percentage of aberrant tetrads as
well as the pollen viability suggested that aberrant tetrads in the
mutant may not be terminal, i.e. that they may continue to divide to
form normal spores even after release from the callose wall. To confirm
this possibility, we constructed a double mutant with
quartet1 (qrt1; Preuss et al., 1994 ), to keep the
meiotic products together after the callose wall degradation. We
examined male meiosis and pollen development in more than 20 tam/qrt1 double mutant inflorescences. The
tam/qrt1 double mutant showed no morphological
difference from tam before callose degradation. After
callose degradation, clusters with different numbers of spores were
observed (Fig. 5). The percentage of
clusters with four cells increased along with the age of the buds,
whereas the percentages of other clusters decreased. Figure
6 shows that in one of those
inflorescences, the percentage of four-celled clusters in the youngest
bud 1 was 8%, and it increased to 98% in the oldest bud 6. These
results suggest that meiosis II in tam is often not finished
before callose degradation but that it can, like meiosis I, be
completed at a later time. The presence of twin gametophytes within one
exine wall (Fig. 1B) implies that, in rare cases, meiosis II did not
finish until after the exine was formed. It seems likely that the
meiosis II delay also occurred at the G2/M transition because dyads
with a nucleus in each cell could persist through the tetrad and later
developmental stages (Table I, Figs. 5 and 6).

View larger version (108K):
[in this window]
[in a new window]
|
Figure 5.
Variation in number of meiotic products after
callose degradation in the tam/qrt double mutant
following a 1-d temperature shift to 27°C. A, Clusters with four,
three, or two cells. B, Cluster with three cells. DAPI staining was
used. Scale bars, 10 µm.
|
|

View larger version (19K):
[in this window]
[in a new window]
|
Figure 6.
Changes of abundance of clusters with different
numbers of cells in tam/qrt1 double mutant during
pollen development. Six consecutive buds were scored. The plants were
grown at 22°C. A larger bud number corresponds to an older bud. Bud 1 was at the early cytokinesis stage, whereas bud 6 was at almost the
mature pollen stage.
|
|
Male Meiotic Cell Division in tam Is Asynchronous
during M-Phase
Cell divisions in all microspore mother cells in a WT Arabidopsis
anther are highly synchronous at any given stage of the cell cycle
(Fig. 1C; data not shown; Ross et al., 1996 ). In tam, however, we observed asynchronous cell divisions during both meiosis I
and II. This asynchrony did not start until the onset of M-phase. Figure 7A shows a WT microspore mother
cell with condensed chromosomes at the late diplotene stage. All
tam microspore mother cells at the same stage were
morphologically comparable and synchronous (examples shown in Fig. 7B).
However, at the onset of M-phase, some cells in tam were
still at diplotene stage, whereas others were at stages ranging from
metaphase I to prophase II (Fig. 7, C-F), suggesting that microspore
mother cells in tam entered M-phase at different time
points. Chromosomal bridges were infrequently found in tam,
indicating a defect in chromosome separation (Fig. 7D).

View larger version (98K):
[in this window]
[in a new window]
|
Figure 7.
Asynchronous M-phase during meiosis I in
tam. A, WT microspore mother cell at the diplotene stage.
The chromosomes are highly condensed. B, tam microspore
mother cells at a stage similar to that in A. Microspore mother cells
in C through F were found in the same anther but at different stages.
C, At metaphase I. D, At early telophase I. A chromosome bridge was
present. E, At late telophase I. F, At prophase II. DAPI staining was
used. Scale bar, 5 µm.
|
|
In tam, dyads were usually formed before meiosis II, and
thus tam anthers examined at this stage often appeared
synchronous: Almost 100% of the cells were dyads for a period of time
(Fig. 1D). This synchrony is consistent with a delay in cell cycle
progression at prophase II. Figure 8A
shows a dyad at this stage with both cells at prophase II. This dyad
also contained a chromosome or chromosome fragment (Fig. 8A,
arrow) that probably resulted from a defect in chromosome separation
during meiosis I, as shown in Figure 7D. When meiosis II occurred,
however, the asynchrony returned. In most of the dyads, cell division
was more advanced in one of the cells, as shown in Figure 8, B through
E, and only occasionally was cell division more or less synchronous for
the two cells of the dyad, as shown in Figure 8, F and G. These results
demonstrate that asynchrony in cell division also occurs at meiosis II,
even for the two associated cells of the dyad. In addition, several abnormalities in mutant chromosome morphology and segregation were
observed. As shown in Figure 8, A and C, chromosomes may be less
condensed. Chromosome lagging (Fig. 8C, arrow) or scattering (Fig. 8E)
was also apparent in some cells. The defects in chromosome morphology
and segregation resulted in the occasional formation of aberrant
tetrads with more than four spores and sometimes more than one nucleus
in a cell (Table I; data not shown). Figure 8H shows an example of such
an aberrant tetrad with five spores; one spore was much smaller than
the others (Fig. 8H, arrow). We believe that in such cases, the final
number of spores depends on whether there are additional clusters of
chromosome fragments.

View larger version (74K):
[in this window]
[in a new window]
|
Figure 8.
Asynchronous M-phase during meiosis II in
tam. A, Dyad contained a chromosome fragment (arrow). B,
Dyad with one cell at anaphase (top) and the other cell at prophase.
The chromosomes in the top cell were less condensed than is typical for
anaphase. C, Dyad with a phenotype similar to that shown in B. The top
cells contained lagging chromosomes. D, One cell has completed nuclear
division (arrows) and the other cell was still at late prophase or
early metaphase stage. E, An abnormal tetrad with three
cells. The larger cell was at anaphase and contained scattered
chromosomes. The two smaller cells at bottom are out of focus. F and G,
Two focal planes of the same dyad, showing that both cells were at
telophase. H, An abnormal tetrad with five cells. DAPI staining was
used. Scale bar, 5 µm.
|
|
Cytochalasin D Partially Suppresses Meiotic Defect in
tam
The slow G2/M transition, but subsequent normal cytokinesis, leads
to the formation of dyads in tam. We postulated that
devising some way to artificially delay cytokinesis in tam
male meiosis might suppress the dyad phenotype. It is known that
cytochalasin D treatment can arrest mitosis or cytokinesis of tobacco
(Nicotiana tabacum) BY-2 cells (Nebenführ et
al., 2000 ). We tested cytochalasin D on tam to see what
effect it might have on the formation of dyads. We adapted an in vitro
inflorescence culture system (Lardon et al., 1993 ) to deliver the
cytochalasin D. We found that 10 µg mL 1
cytochalasin D treatment of the WT inflorescences (from four different
plants) often resulted in tetrads with misoriented cell walls (Fig.
9A) that were not found in the WT control
(not shown), indicating that this concentration of cytochalasin D was
effective. The same concentration of cytochalasin D, compared with the
tam control (Fig. 9B), resulted in a marked decrease in the
number of dyads in the tam inflorescences and an increase in
tetrahedral, i.e. WT-like, tetrads (Figs. 9C and
10). Cytochalasin D (2.5 or 5 µg
mL 1) was still effective in causing misoriented
cell walls in tetrads of WT inflorescences, and it was mildly effective
in reducing dyad formation in tam inflorescences (not
shown). However, 1 µg mL 1 cytochalasin D had
no effect on the organization of tetrads in WT inflorescences and was
not effective in reducing the percentage of dyads in tam
plants (not shown). Together, these data suggest that cytochalasin D
can significantly suppress dyad formation in tam.

View larger version (55K):
[in this window]
[in a new window]
|
Figure 9.
Effect of cytochalasin D during meiosis. A, Cells
from a WT inflorescence that was maintained for 24 h in medium
supplemented with 10 µg mL 1 cytochalasin D. Note irregularly shaped tetrads. B, Cells from a tam
inflorescence that was maintained for 24 h in control medium. The
percentage of dyads was 96% in this bud. C, Cells from a
tam inflorescence from the same plant as in B, cultivated in
medium supplemented with 10 µg mL 1
cytochalasin D. The percentage of dyads was 20% in this bud. Scale
bar, 10 µm.
|
|

View larger version (36K):
[in this window]
[in a new window]
|
Figure 10.
Effect of cytochalasin D on the percentage of
dyads in tam. Inflorescences from 16 tam plants
and four WT plants were maintained for 24 h in control medium or
in medium supplemented with 10 µg mL 1
cytochalasin D. One to two inflorescences were used for each treatment.
The percentage of aberrant tetrads was scored for each inflorescence
( 1 bud) and is expressed as the mean and SE.
Where no SE value is presented, only one bud was
scored. The control treatment for the WT plants yielded no dyads.
|
|
 |
DISCUSSION |
The tam mutant is defective in cell cycle progression
during male meiosis, and as a consequence dyads are formed when
cytokinesis occurs. By comparing progression through the cell cycle in
consecutive buds of WT and tam flowers, we were able to
detect a delay at the G2/M transition in tam male meiosis.
Although progression through meiosis can be followed in culture in
maize (Yu et al., 1997 ), analysis of consecutive buds appears to be an
attractive alternative for studying progression through male meiosis in
Arabidopsis because it is difficult to track the development of the
same bud through time. It is possible that tam also exhibits
a cell cycle progression defect during female meiosis, but we did not
test for this for technical reasons and because no obvious phenotype was seen in mature siliques.
The dyad phenotype in male meiosis has also been observed in the
Arabidopsis ask1-1 mutant (Yang et al., 1999 ). The
ask1-1 mutation is in an Arabidopsis homolog of the human
and yeast SKP1 genes. Skp1p in yeast has been found to
regulate both the G1/S and G2/M transitions (Bai et al., 1996 ; Connelly
and Hieter, 1996 ), and thus it is plausible that the dyads found in
ask1-1 are also formed due to a defect in cell cycle
progression. In the Arabidopsis mutant dyad, dyads are the
terminal phenotype seen during female meiosis. Siddiqi et al. (2000)
therefore concluded that the dyad phenotype was due to a
defect in cell cycle progression. In the Arabidopsis dmc1
mutant, dyads are formed in both male and female meioses (Couteau et
al., 1999 ). Taken together, it seems that defects in cell cycle
progression during meiosis I often lead to the formation of dyads.
However, tam is clearly distinct from the other mutants that
form dyads during meiosis because those mutants arrest at the dyad
stage and are nearly always sterile. Despite the delay in meiosis and
consequently the delayed formation of microspores, tam has
reasonable fertility. The difference in severity of the other
dyad-forming mutants and tam might be because tam, even at the restrictive temperature, does not behave
like a null allele.
Cytokinesis is successive in most monocots (Skvarla and Larson, 1966 ;
Hogan, 1987 ; Staiger and Cande, 1991 ) and simultaneous in most dicots,
including Arabidopsis (Hogan, 1987 ; Brown and Lemmon, 1988 ; Traas et
al., 1989 ; Peirson et al., 1997 ). Cytokinesis in tam meiosis
is superficially similar to successive cytokinesis because dyads are
first formed after meiosis I. Each dyad can divide again to form
spores, and each spore, when released from the callose wall, can form
functional pollen. The fact that a single mutation can convert the mode
of cell division from simultaneous cytokinesis to almost successive
cytokinesis raises the possibility that the different modes of
cytokinesis during meiosis might be achieved by minimal genetic
modifications. Furthermore, the temperature sensitivity of the cell
cycle progression revealed by the tam mutant allele might
suggest that such different modes of cytokinesis are influenced by
environmental factors such as temperature. Some species of orchid can
undergo either simultaneous or successive cytokinesis (Brown and
Lemmon, 1991 ). It will be interesting to determine whether the
variation in the modes of cytokinesis in such species depends on
environmental factors and whether the choice is attributable to changes
in the pace of cell cycle progression.
The tam inflorescences cultivated in vitro at 22°C in the
presence of cytochalasin D showed a marked reduction in the percentage of aberrant tetrads. In higher plants, it is known that cytochalasin D
can interfere with cytokinesis (Traas et al., 1989 ; Dinis and Mesquita,
1993 ; Nebenführ et al., 2000 ), and assembly of short actin
filaments seems to be a crucial process in normal plant cytokinesis
(Endle et al., 1998 ; Smith, 1999 ). Cytochalasin D prevents extension or
new polymerization of microfilaments by binding to the ends of existing
microfilaments (Flanagan and Lin, 1980 ; Gibbon et al., 1999 ). Thus,
cytochalasin D might interfere with cytokinesis by halting the assembly
of short actin filaments. In our experiments, cytochalasin D clearly
affected cytokinesis as shown in the treated WT inflorescences. It is
possible that cytochalasin D delayed cytokinesis in the treated
tam inflorescences, making cytokinesis better coupled with
meiosis II and resulting in an increase of normal tetrad formation.
Alternatively, cytochalasin D might somehow hasten nuclear division in
tam and thereby make meiosis II better coupled with
cytokinesis. However, the dyad phenotype was not corrected if the
cultured inflorescences were maintained at 27°C during treatment with
10 µg mL 1 cytochalasin D (data not shown).
This suggests that the effect of the cytochalasin D is limited and
could not overcome the more severe delay of cell cycle progression seen
in tam at 27°C.
Although meiosis in tam exhibits abnormal intermediates,
most are able to continue through the normal rounds of cell divisions and form functional pollen. The occasional reduced chromosome condensation, chromosome nondisjunction, and mis-segregation defects are consistent with the notion that some mutant cells are not ready for
the M-phase, even when the nuclear envelope has broken down. It is
possible that the primary defect in tam occurs either before
asynchrony is apparent, or at the G2/M transition. There are two
possible explanations for the asynchronous M-phase, if we assume that
the temperature sensitivity of the tam allele allows a
partially active TAM protein at the permissive temperature. First, it
is possible that the mutant allele is leaky: Even at 27°C, perhaps
some cells have higher residual activity of the mutated TAM protein
than others and are thus able to enter M-phase earlier than other
cells. Alternatively, all cells could have lost TAM function at 27°C,
and the timing of entry into M-phase is stochastic. We think that the
second scenario is more likely. An asynchronous M-phase during meiosis
II was predominant, even between the two adjoined cells of a dyad. It
is unlikely that these two adjoined cells have different levels of the
TAM protein. If the second scenario is true, it would suggest a pathway
that links a signal for synchronous cell division with the activation of the G2/M transition. The MPF has been established as the universal regulator of G2/M transition in all eukaryotes (Ohi and Gould, 1999 ).
In fission yeast (Schizosaccharomyces pombe), a
cdc2 mutant (encoding the kinase component of the MPF)
produces dyads during meiosis, providing a direct link between MPF and
the dyad phenotype (Niwa and Yanagida, 1988 ). If the TAM protein is a
positive regulator of the G2/M transition, it might directly or
indirectly regulate the function of the MPF in Arabidopsis.
 |
MATERIALS AND METHODS |
Plant Materials and Growth Conditions
M2 plants from an EMS-mutagenized population (Columbia ecotype,
generated in Dr. Robert Fischer's laboratory, Berkeley, CA) were initially grown in the greenhouse under continuous fluorescent light. Once we discovered that the tam mutation was
temperature sensitive, plants were grown in a growth chamber at 22°C
or at 27°C, as noted, under a 16-h-light/8-h-dark regime.
To test for allelism with mei1, an
mei1/mei1 plant was crossed as female by
a tam/tam male. Meiotic stage buds of six
F1 plants were scored. To construct the double mutant
between tam and qrt1, tam/tam was crossed as a female by
qrt1/qrt1 (Landsberg ecotype). The
F1 plants were selfed to obtain the F2 progeny.
The F2 was scored for the qrt phenotype.
Homozygous qrt1/qrt1 F2
plants were then exposed to 27°C for 24 h and tetrad stage
anthers were scored to identify tam/tam plants.
Light Microscopy
Both fresh and fixed anthers were used. For fresh anthers, their
contents were released into 2 µL of DAPI (Molecular Probes, Eugene,
OR; 1 µg mL 1 in water) staining solution, using
a needle under a dissecting scope. An additional 5 µL of DAPI was
then added to the sample. Fixed anthers were analyzed as previously
described (Yang et al., 1999 ). An Axiophot compound microscope (Zeiss,
Jena, Germany) was used for the light and fluorescent
microscopy. Images were photographed with Kodak Ektachrome 160T color
slide film (Eastman Kodak, Rochester, NY) or with a digital camera.
Stages of meiosis were determined according to Ross et al. (1996) .
Pollen viability was assessed with Alexander's stain (Alexander,
1969 ).
Inflorescence Culture and Treatment with Cytochalasin D
Inflorescences were cultured using a culture system developed
for Brassica napus flowers (Lardon et al., 1993 ). The
culture medium was 1× Murashige and Skoog salt mixture (Invitrogen,
Carlsbad, CA), 3% (w/v) Suc, and 1× vitamins (Feldmann,
1991 ). The pH was adjusted to 5.8 with NaOH before filter
sterilization. Each well of a 24-well tissue culture plate (Corning,
Palo Alto, CA) was filled with approximately 3 mL of culture
medium. For each well, an opening was drilled into the lid of the
culture plate with a hot needle. The inflorescences were cut from the
plants and all open flowers were removed. The peduncles of the
inflorescences were immediately placed in the culture medium through
the hole in the lid of the plate. The plate was incubated in the 22°C
growth chamber. New flowers opened 1 d after the cultures were
started and were then continuously produced. These flowers were
fertile, and up to 25 siliques could be produced per peduncle. The
inflorescence culture system thus mimics development on the intact plant.
In some experiments, the peduncle of the inflorescence was
surface-sterilized for 10 min in a sodium hypochlorite solution (1%
[v/v] available chlorine) containing traces of Triton X-100 and was subsequently washed four times with sterile water. Surface sterilization was not necessary for cultures maintained 24 h or less.
For treatment with cytochalasin D, the tissue culture plate was covered
with aluminum foil to prevent photodegradation of the chemical. The
stock solution of 10 mg mL 1 cytochalasin D (Sigma, St.
Louis) was prepared in dimethyl sulfoxide. When appropriate,
dimethyl sulfoxide was added to the control.
Mapping
tam/tam plants were outcrossed as
female by WT Landsberg erecta ecotype. The
F1 plants were backcrossed either as females or males to
tam/tam to generate the mapping
population. The genotypes of the plants of the backcross progeny
(tam/tam or +/tam) were determined by examination of the tetrad stage after a 24-h temperature shift to 27°C. The backcross progeny was tested for linkage of tam to CAPS (Konieczny and Ausubel, 1993 ),
SSLP (Bell and Ecker, 1994 ), and RFLP markers available from The
Arabidopsis Information Resource (http://www.Arabidopsis.org) following
standard protocols. The RFLP marker agp64 was converted into a CAPS
marker. The sequences of primers used for DNA amplification for CAPS
agp64 were as follows: CGAGGTATGTTCGGCTTGAT and CAAGGTGAGATTTCCCATTGAG.
The PCR conditions were: 95°C for 5 min (initial denaturation);
95°C for 40 s, 50°C for 40 s, and 72°C for 1 min
30 s (25 cycles); and 72°C for 10 min (final elongation). The
polymorphism was detected after digestion of the PCR products with
EcoRI: The Columbia ecotype gives bands of 175, 300, and
800 bp, and the Landsberg erecta ecotype gives bands of
175 and 1,100 bp.
 |
ACKNOWLEDGMENTS |
We thank Robert Fischer for the M2 seeds of the EMS-mutagenized
population, Andrea Prescott and the John Innes Centre for agp64 and
agp15e markers, Daphne Preuss for providing the qrt1 seeds, David Hantz and his staff for excellent care of the plants, and
Abdul Jandali for assistance with mapping. We also thank Robyn Cotter,
Ines Ezcurra, and Sheila Johnson for helpful discussions during the
course of this work.
 |
FOOTNOTES |
Received May 29, 2001; returned for revision July 10, 2001; accepted August 13, 2001.
1
This work was supported by the U.S. Department
of Agriculture Current Research Information System (grant no.
5335-21000-011-00D). M.L. was a participant in the Undergraduate
Research Apprentice Program (URAP) at the University of California
(Berkeley) and was supported by a URAP fellowship.
2
Present address: Reproduction et Développement des
Plantes, Ecole Normale Superieure de Lyon, 46 Allee d'Italie,
Lyon, France, 69364.
3
Present address: Department of Botany, Oklahoma State
University, 104 Life Sciences East, Stillwater, OK 74078-3013.
4
Present address: Monsanto, 700 Chesterfield Village
Parkway, St. Louis, MO 63198.
*
Corresponding author; e-mail sheilamc{at}nature.berkeley.edu; fax
510-559-5678.
Article, publication date, and citation information can be found at
www.plantphysiol.org/cgi/doi/10.1104/pp.010473.
 |
LITERATURE CITED |
-
Alexander MP
(1969)
Differential staining of aborted and nonaborted pollen.
Stain Technol
44: 117-122[ISI][Medline]
-
Arabidopsis Genome Initiative
(2000)
Analysis of the genome sequence of the flowering plant Arabidopsis thaliana.
Nature
408: 796-815[CrossRef][Medline]
-
Athar M, Kim AL, Ahmad N, Mukhtar H, Gautier J, Bickers DR
(2000)
Mechanism of ultraviolet B-induced cell cycle arrest in G2/M phase in immortalized skin keratinocytes with defective p53.
Biochem Biophys Res Commun
277: 107-111[CrossRef][Medline]
-
Bai C, Sen P, Hofmann K, Ma L, Goebl M, Harper JW, Elledge SJ
(1996)
SKP1 connects cell cycle regulators to the ubiquitin proteolysis machinery through a novel motif, the F-box.
Cell
86: 263-274[CrossRef][ISI][Medline]
-
Bell CJ, Ecker JR
(1994)
Assignment of 30 microsatellite loci to the linkage map of Arabidopsis.
Genomics
19: 137-144[CrossRef][ISI][Medline]
-
Boisnard-Lorig C, Colon-Carmona A, Bauch M, Hodge S, Doerner P, Bancharel E, Dumas C, Haseloff J, Berger F
(2001)
Dynamic analysis of the expression of the HISTONE::YFP fusion protein in Arabidopsis shows that syncytial endosperm is divided in mitotic domains.
Plant Cell
13: 495-509[Abstract/Free Full Text]
-
Brown RC, Lemmon BE
(1988)
Microtubules associated with simultaneous cytokinesis of coenocytic microsporocytes.
Am J Bot
75: 1848-1856[CrossRef]
-
Brown RC, Lemmon BE
(1991)
Pollen development in orchids: I. Cytoskeleton and the control of division plane in irregular patterns of cytokinesis.
Protoplasma
163: 9-18[CrossRef]
-
Cajone F, Sherbet GV
(1999)
Stathmin is involved in S100A4-mediated regulation of cell cycle progression.
Clin Exp Metastasis
17: 865-871[CrossRef][ISI][Medline]
-
Connelly C, Hieter P
(1996)
Budding yeast SKP1 encodes an evolutionarily conserved kinetochore protein required for cell cycle progression.
Cell
86: 275-285[CrossRef][ISI][Medline]
-
Couteau F, Belzile F, Horlow C, Grandjean O, Vezon D, Doutriaux M-P
(1999)
Random chromosome segregation without meiotic arrest in both male and female meiocytes of a dmc1 mutant of Arabidopsis.
Plant Cell
11: 1623-1634[Abstract/Free Full Text]
-
den Boer BGW, Murray JAH
(2000)
Triggering the cell cycle in plants.
Trends Cell Biol
10: 245-250[CrossRef][ISI][Medline]
-
Dinis AM, Mesquita JF
(1993)
The F-actin distribution during microsporogenesis in Magnolia soulangeana Soul. (Magnoliaceae).
Sex Plant Reprod
6: 57-63
-
Endle M-C, Stoppin V, Lambert A-M, Schmit A-C
(1998)
The growing cell plate of higher plants is a site of both actin assembly and vinculin-like antigen recruitment.
Eur J Cell Biol
77: 10-18[Medline]
-
Feldmann KA
(1991)
T-DNA insertion mutagenesis in Arabidopsis: mutational spectrum.
Plant J
1: 71-82
-
Ferby I, Blazquez M, Palmer A, Eritja R, Nebreda AR
(1999)
A novel p34(cdc2)-binding and activating protein that is necessary and sufficient to trigger G(2)/M progression in Xenopus oocytes.
Genes Dev
13: 2177-2189[Abstract/Free Full Text]
-
Flanagan MD, Lin S
(1980)
Cytochalasins block actin filament elongation by binding to high affinity sites associated with F-actin.
J Biol Chem
255: 835-838[Abstract/Free Full Text]
-
Friedman WE
(1999)
Expression of the cell cycle in sperm of Arabidopsis: implications for understanding patterns of gametogenesis and fertilization in plants and other eukaryotes.
Development
126: 1065-1075[Abstract]
-
Gibbon BC, Kovar DR, Staiger CJ
(1999)
Latrunculin B has different effects on pollen germination and tube growth.
Plant Cell
11: 2349-2363[Abstract/Free Full Text]
-
Goh PY, Surana U
(1999)
Cdc4, a protein required for the onset of S phase, serves an essential function during G(2)/M transition in Saccharomyces cerevisiae.
Mol Cell Biol
19: 5512-5522[Abstract/Free Full Text]
-
He C, Mascarenhas JP
(1998)
MEI1, an Arabidopsis gene required for male meiosis: isolation and characterization.
Sex Plant Reprod
11: 199-207[CrossRef]
-
Hogan CJ
(1987)
Microtubule patterns during meiosis in two higher plant species.
Protoplasma
138: 126-136[CrossRef]
-
Joubès J, Chevalier C, Dudits D, Heberle-Bors E, Inzé D, Umeda M, Renaudin J-P
(2000)
CDK-related protein kinases in plants.
Plant Mol Biol
43: 607-620[CrossRef][ISI][Medline]
-
Kishimoto T
(1999)
Activation of MPF at meiosis re-initiation in starfish oocytes.
Dev Biol
214: 1-8[CrossRef][ISI][Medline]
-
Kong WH, Zheng G, Lu JN, Tso JK
(2000)
Temperature dependent expression of cdc2 and cyclin B1 in spermatogenic cells during spermatogenesis.
Cell Res
10: 289-302[CrossRef][ISI][Medline]
-
Konieczny A, Ausubel FM
(1993)
A procedure for mapping Arabidopsis mutations using co-dominant ecotype-specific PCR-based markers.
Plant J
4: 403-410[CrossRef][ISI][Medline]
-
Lardon A, Triboi-Blondel AM, Dumas C
(1993)
A model for studying pollination and pod development in Brassica napus: the culture of isolated flowers.
Sex Plant Reprod
6: 52-56
-
Liu D, Liao C, Wolgemuth DJ
(2000)
A role for cyclin A1 in the activation of MPF and G2-M transition during meiosis of male germ cells in mice.
Dev Biol
224: 388-400[CrossRef][ISI][Medline]
-
Loy CJ, Lydall D, Surana U
(1999)
NDD1, a high-dosage suppressor of cdc28-1N, is essential for expression of a subset of late-S-phase-specific genes in Saccharomyces cerevisiae.
Mol Cell Biol
19: 3312-3327[Abstract/Free Full Text]
-
Mészáros T, Miskolczi P, Ayaydin F, Pettkó-Szandtner A, Peres A, Magyar Z, Horváth GV, Bakó L, Fehér A, Dudits D
(2000)
Multiple cyclin-dependent kinase complexes and phosphatases control G2/M progression in alfalfa cells.
Plant Mol Biol
43: 595-605[CrossRef][ISI][Medline]
-
Moser BA, Russell P
(2000)
Cell cycle regulation in Schizosaccharomyces pombe.
Curr Opin Microbiol
3: 631-636[CrossRef][Medline]
-
Nebenführ A, Frohlick JA, Staehelin LA
(2000)
Redistribution of Golgi stacks and other organelles during mitosis and cytokinesis in plant cells.
Plant Physiol
124: 135-151[Abstract/Free Full Text]
-
Nebreda AR, Ferby I
(2000)
Regulation of the meiotic cell cycle in oocytes.
Curr Opin Cell Biol
12: 666-675[CrossRef][ISI][Medline]
-
Nigg EA
(2001)
Mitotic kinases as regulators of cell division and its checkpoints.
Nat Rev Mol Cell Biol
2: 21-32[CrossRef][ISI][Medline]
-
Niwa O, Yanagida M
(1988)
Universal and essential role of MPF/cdc2+.
Nature
336: 430
-
Ohi R, Gould KL
(1999)
Regulating the onset of mitosis.
Curr Opin Cell Biol
11: 267-273[CrossRef][ISI][Medline]
-
Peirson BN, Bowling SE, Makaroff CA
(1997)
A defect in synapsis causes male sterility in a T-DNA-tagged Arabidopsis thaliana mutant.
Plant J
11: 659-669[CrossRef][ISI][Medline]
-
Preuss D, Rhee SY, Davis RW
(1994)
Tetrad analysis possible in Arabidopsis with mutation of the QUARTET (QRT) genes.
Science
264: 1458-1460[Abstract/Free Full Text]
-
Richman TJ, Sawyer MM, Johnson DI
(1999)
The Cdc42p GTPase is involved in a G2/M morphogenetic checkpoint regulating the apical-isotropic switch and nuclear division in yeast.
J Biol Chem
274: 16861-16870[Abstract/Free Full Text]
-
Rippmann JF, Hobbie S, Daiber C, Cuilliard B, Bauer M, Birk J, Nar H, Garin-Chesa P, Rettig WJ, Schnapp A
(2000)
Phosphorylation-dependent proline isomerization catalyzed by Pin1 is essential for tumor cell survival and entry into mitosis.
Cell Growth Differ
11: 409-416[Abstract/Free Full Text]
-
Ross KJ, Fransz P, Jones GH
(1996)
A light microscopic atlas of meiosis in Arabidopsis thaliana.
Chromosome Res
4: 507-516[CrossRef][ISI][Medline]
-
Siddiqi I, Ganesh G, Grossniklaus U, Subbiah V
(2000)
The dyad gene is required for progression through female meiosis in Arabidopsis.
Development
127: 197-207[Abstract]
-
Skvarla JJ, Larson DA
(1966)
Fine structural studies of Zea mays pollen I: cell membranes and exine ontogeny.
Am J Bot
53: 1112-1125[CrossRef][ISI]
-
Smith LG
(1999)
Divide and conquer: cytokinesis in plant cells.
Curr Opin Plant Biol
2: 447-453[CrossRef][Medline]
-
Staiger CJ, Cande WZ
(1991)
Microfilament distribution in maize meiotic mutants correlates with microtubule organization.
Plant Cell
3: 637-644[Abstract/Free Full Text]
-
Stals H, Casteels P, Van Montagu M, Inzé D
(2000)
Regulation of cyclin-dependent kinases in Arabidopsis thaliana.
Plant Mol Biol
43: 583-593[CrossRef][ISI][Medline]
-
Toyoshima F, Moriguchi T, Wada A, Fukuda M, Nishida E
(1998)
Nuclear export of cyclin B1 and its possible role in the DNA damage-induced G2 checkpoint.
EMBO J
17: 2728-2735[CrossRef][ISI][Medline]
-
Traas JA, Burgain S, Dumas De Vaulx R
(1989)
The organization of the cytoskeleton during meiosis in eggplant (Solanum melongena (L)): microtubules and F-actin are both necessary for coordinated meiotic division.
J Cell Sci
92: 541-550[Abstract/Free Full Text]
-
Walworth NC
(2000)
Cell-cycle checkpoint kinases: checking in on the cell cycle.
Curr Opin Cell Biol
12: 697-704[CrossRef][ISI][Medline]
-
Wilkinson MG, Millar JBA
(2000)
Control of the eukaryotic cell cycle by MAP kinase signaling pathways.
FASEB J
14: 2147-2157[Abstract/Free Full Text]
-
Yang M, Hu Y, Lodhi M, McCombie WR, Ma H
(1999)
The Arabidopsis SKP1-LIKE1 gene is essential for male meiosis and may control homologue separation.
Proc Natl Acad Sci USA
96: 11416-11421[Abstract/Free Full Text]
-
Yu HG, Hiatt EN, Chan A, Sweeney M, Dawe RK
(1997)
Neocentromere-mediated chromosome movement in maize.
J Cell Biol
139: 831-840[Abstract/Free Full Text]
© 2001 American Society of Plant Physiologists
This article has been cited by other articles:

|
 |

|
 |
 
J. Liu and L.-J. Qu
Meiotic and Mitotic Cell Cycle Mutants Involved in Gametophyte Development in Arabidopsis
Mol Plant,
July 1, 2008;
1(4):
564 - 574.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Ressayre, L. Dreyer, S. Triki-Teurtroy, A. Forchioni, and S. Nadot
Post-meiotic cytokinesis and pollen aperture pattern ontogeny: comparison of development in four species differing in aperture pattern
Am. J. Botany,
April 1, 2005;
92(4):
576 - 583.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Wang, J.-L. Magnard, S. McCormick, and M. Yang
Progression through Meiosis I and Meiosis II in Arabidopsis Anthers Is Regulated by an A-Type Cyclin Predominately Expressed in Prophase I
Plant Physiology,
December 1, 2004;
136(4):
4127 - 4135.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. V. Reddy, J. Kaur, B. Agashe, V. Sundaresan, and I. Siddiqi
The DUET gene is necessary for chromosome organization and progression during male meiosis in Arabidopsis and encodes a PHD finger protein
Development,
December 15, 2003;
130(24):
5975 - 5987.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Yang, C. A. Makaroff, and H. Ma
The Arabidopsis MALE MEIOCYTE DEATH1 Gene Encodes a PHD-Finger Protein That Is Required for Male Meiosis
PLANT CELL,
June 1, 2003;
15(6):
1281 - 1295.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
S. B. Preuss and A. B. Britt
A DNA-Damage-Induced Cell Cycle Checkpoint in Arabidopsis
Genetics,
May 1, 2003;
164(1):
323 - 334.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|