|
Plant Physiol, November 2001, Vol. 127, pp. 1299-1309
Isolation and Characterization of a New Peroxiredoxin from Poplar
Sieve Tubes That Uses Either Glutaredoxin or Thioredoxin as a Proton
Donor1
Nicolas
Rouhier,
Eric
Gelhaye,
Pierre-Eric
Sautiere,
Annick
Brun,
Pascal
Laurent,
Denis
Tagu,
Joelle
Gerard,
Elisabeth
de Fa ,
Yves
Meyer, and
Jean-Pierre
Jacquot*
Unité Mixte de Recherche Interaction Arbres
Microorganisms, Institut National de la Recherche
Agronomique-Université Henri Poincaré Nancy I. Biochimie et Biologie Moléculaire Végétales,
Université Henri Poincaré, 54506 Vandoeuvre cedex, France
(N.R., E.G., A.B., P.L., D.T., J.G., E.d.F., J.-P.J.); Laboratoire
d'Endocrinologie des Annélides Equipe Enseignement
Supérieur Associé 97, Université des Sciences
et Technologies de Lille, 59655 Villeneuve d'Ascq cedex, France
(P.-E.S.); and Laboratoire de Physiologie et de Biologie
Moléculaire des Plantes, Unité Mixte de Recherche 5545, Université de Perpignan, 66025 Perpignan cedex, France
(Y.M.)
 |
ABSTRACT |
A sequence coding for a peroxiredoxin (Prx) was isolated
from a xylem/phloem cDNA library from Populus trichocarpa
and subsequently inserted into an expression plasmid yielding the
construction pET-Prx. The recombinant protein was produced in
Escherichia coli cells and purified to homogeneity with
a high yield. The poplar Prx is composed of 162 residues, a property
that makes it the shortest plant Prx sequence isolated so far. It was
shown that the protein is monomeric and possesses two conserved
cysteines (Cys). The Prx degrades hydrogen peroxide and alkyl
hydroperoxides in the presence of an exogenous proton donor that can be
either thioredoxin or glutaredoxin (Grx). Based on this finding, we
propose that the poplar protein represents a new type of Prx that
differs from the so-called 2-Cys and 1-Cys Prx, a suggestion supported by the existence of natural fusion sequences constituted of a Prx motif
coupled to a Grx motif. The protein was shown to be highly expressed in
sieve tubes where thioredoxin h and Grx are also major
proteins.
 |
INTRODUCTION |
Reactive oxygen, sulfur, and
nitrogen intermediates can cause serious damage to macromolecules such
as proteins, lipids, or nucleic acids, eventually leading to
pathological processes (Halliwell and Gutteridge, 1990 ; Beckman and
Ames, 1997 ; Berlett and Stadtman, 1997 ). Among the antioxidant defense
mechanisms developed by aerobic organisms, nonenzymatic reactions
dependent on glutathione, ascorbate, or -tocopherol play an
important role. Alternatively, enzymatic detoxication reactions that
involve catalases, superoxide dismutases, and ascorbate or glutathione
peroxidases have been extensively studied and documented (Rhee et al.,
1994 ).
A new family of antioxidative enzymes, called peroxiredoxins (Prx),
recently has been characterized in all phyla (Rhee et al., 1999 ). These
enzymes catalyze the reduction of either hydrogen peroxide
(H2O2) or various alkyl
hydroperoxides to water and the corresponding alcohol in the presence
of a hydrogen donor, which is in turn converted to the oxidized form
according to the equation:
Prx associated with catalases or other peroxidases are believed to
participate in signal transduction by regulating the intracellular concentration of H2O2,
which in turn controls gene transcription and cell signaling through
phosphorylation cascades (Jin et al., 1997 ).
Based on amino acid comparisons, Prx can be divided into two to three
main groups: the so-called 2-Cys Prx (referred to as type A in this
manuscript), the 1-Cys Prx (type B), and a new isotype that we will
call type C. All these isoforms can be differentiated by the position
of the Cys (Choi et al., 1999 ; Verdoucq et al., 1999 ; Seo et al.,
2000 ). Prx differ from other peroxidases not only by their unique
primary sequences but also by lacking prosthetic groups containing a
metal ion, normally needed for the catalytic reaction to occur. Prx
overcome this problem by using the conserved N terminus catalytic Cys
that is converted into a sulfenic acid and regenerated via a proton
donor. Site-directed mutagenesis has clearly identified this Cys
residue (Cys 47 in yeast [Saccharomyces cerevisiae]
thiol-specific antioxidant) as the catalytic residue (Chae et
al., 1994a ). In the case of 1-Cys Prx, the hydrogen donor remains
essentially unidentified, but could be Trx for the mammalian mitochondrial enzyme (Pedrajas et al., 2000 ). For the 2-Cys Prx, the
donor is clearly thioredoxin (Trx) and the mechanism involves another
conserved Cys of Prx (Kang et al., 1998 ). The hydrogen donor of the new
isotype is also believed to be Trx (Chae et al., 1994b ). The 2-Cys Prx
exhibits a dimeric structure, with two identical subunits linked by a
disulfide bridge (Choi et al., 1999 ). Biochemical evidence indicates
that 1-Cys Prx are monomeric proteins with an intramolecular disulfide
in the oxidized state (Kang et al., 1998 ). The molecular organization
of type C Prx is still largely unknown. Nevertheless, it appears that
all subunits are organized in a fold similar to Trx with a central
pleated -sheet surrounded by -helices (Schroder and
Pönting, 1998 ).
In mammals, Prx are associated with diverse cellular functions
including apoptosis (Zhang et al., 1997 ; Kim et al., 2000 ), cell
proliferation, and differentiation (Yamamoto et al., 1989 ; Prosperi et
al., 1993 ). In the case of tumor necrosis factor- -induced apoptosis, it was demonstrated recently that in the presence of reactive oxygen intermediates, human Trx peroxidase appears to be
regulated by glutathione conjugation (Sullivan et al., 2000 ). This
protein-glutathione mixed disulfide could then be reduced by
oxidoreductases such as Trx, glutaredoxins (Grx) or protein disulfide
isomerases. This regulatory mechanism of Cys oxidation reduction might
prevent an irreversible oxidation of the concerned Cys into sulfonic or
sulfinic acid.
As a general rule, many Prx sequences coexist in a single organism. For
example, there are at least three Prx in Escherichia coli,
five in yeast, and six isoforms characterized in mammalian cells (Zhou
et al., 2000 ). One of the reasons explaining this multiplicity is the
multiple subcellular localization of these proteins including the
cytosol, peroxisomes, mitochondria, and possibly the nucleus (Stacy et
al., 1999 ; Pedrajas et al., 2000 ; Zhou et al., 2000 ).
The systematic sequencing of Arabidopsis also indicates that there are
many Prx genes in plants. It appears that the expression of some Prx
genes is regulated both temporally and spatially, accounting for the
high number of isoforms. In plants, the three types of Prx described
above have been identified. The 1-Cys Prx, apparently encoded by a
single gene, is expressed specifically in the aleurone layer and embryo
of developing seeds of dicotyledonous and monocotyledonous plants
(Haslekas et al., 1998 ; Stacy et al., 1999 ; Lewis et al., 2000 ). Its
proposed function is to protect these tissues from reactive oxygen
species produced during desiccation or as a by-product of respiration
during imbibition of seeds. Moreover, there is indirect evidence
suggesting that Prx are involved in maintenance of dormancy (Lewis et
al., 2000 ). Apparently in plants, the 2-Cys Prx characterized so far
are nuclear encoded, but localized in the chloroplasts (Baier and
Dietz, 1997 ). The chloroplastic 2-Cys Prx belong to a multigenic family
and seem to be expressed in most plant tissues but the roots (Cheong et al., 1999 ). It is assumed to detoxify products of chloroplastic electron transport (Baier and Dietz, 1999 ). A recent report indicates that antisense plants suppressed for 2-Cys Prx compensate by
overexpressing ascorbate peroxidase and dehydroascorbate reductase,
suggesting that a subtle equilibrium exists between diverse antioxidant
enzymes in chloroplasts (Baier et al., 2000 ).
Prx of the C type have been isolated recently from a flower bud cDNA
library of Brassica rapa (Choi et al., 1999 ) and also from
Arabidopsis (Verdoucq et al., 1999 ). In a very classic assay, the Prx
from Chinese cabbage (Brassica campestris L. subsp.
pekinensis) protects Gln synthetase from oxidation by
radicals generated by the Fenton reaction. Both the Arabidopsis and
B. rapa enzymes have been described to reduce
H2O2 in the presence of
NADPH, Trx reductase, and Trx. We describe here the isolation and
characterization of a Prx of the type C from poplar
(Populus trichocarpa) phloem and show that this
protein is bifunctional, i.e. it can use either Trx or Grx as a
hydrogen donor. This is discussed in the light of existing homologous
prokaryotic sequences that contain a Grx motif fused to type C Prx. The
protein was shown to be present in the plant and highly expressed in
the sieve tubes of the phloem, which also contains high amounts of Trx
and Grx.
 |
RESULTS |
Sequence Analysis and Cloning
Based on two overlapping expressed sequence tags (ESTs; AI163857
and AI162101) of respectively 458 and 553 nucleotides, a putative
full-length sequence coding for a poplar Prx has been reconstituted.
The corresponding cDNA sequence has been cloned by PCR and inserted
into the expression plasmid pET-3d, yielding the construction pET-Prx.
The open reading frame consists of 489 nucleotides coding for a
polypeptide of 162 amino acids. Figure 1
shows an amino acid sequence comparison that includes plant Prx of the
three types (A, B, and C). The sequence isolated in this study is
strongly associated with the type C Prx from plants. It is clear that
all type A plant Prx possess a N terminus extension of about 75 amino
acids that presumably codes for a chloroplastic transit peptide as
described in Baier and Dietz (1999) . In general, Prx of the B and C
type do not possess similar extensions and are thus probably not routed
to mitochondria, chloroplasts, or to the vacuolar and extracellular
compartments. A remarkable feature of the poplar sequence and all type
C plant Prx is that they are all considerably shorter on the C-terminal
end (type A and B show about 36 and 56 amino acids extensions,
respectively). As a consequence, the type C sequences are among the
shortest isolated for a Prx so far. The poplar Prx isolated in this
work displays strict identity of 80% to the Arabidopsis and
Brassica rapa-type C Prx sequences. On the other
hand, the identities are much lower compared with type A or B Prx
(10%-15% and 13%-19%, respectively). Type A and B are similarly
loosely related (21%-25% identity). Overall, plant Prx of the type A
exhibit 77% to 85% identity, those of type B exhibit 68% to 84%
identity, and those of type C exhibit 80% to 96% identity. At first,
the absence of an N-terminal extension and of identified signals as
Ser-Lys-Leu for the peroxisomes suggest that the subcellular
localization of the poplar Prx might be the cytosol, and the
interrogation of the PSORT site
(http://psort.nibb.ac.jp/form.html) supports this
proposal. A very characteristic feature of all the Prx sequences is
that one Cys residue (Cys 51 in the poplar enzyme) is strictly
conserved with the surrounding consensus sequence: P[G/L][A/D]FT[P/F][T/V]C[S/P/T]. Site-directed
mutagenesis has shown that this residue is the catalytic one in
all Prx characterized so far (Chae et al., 1994a ). The poplar sequence
isolated in this work shows only one additional Cys (Cys 76), which is
strictly conserved among type C Prx.

View larger version (81K):
[in this window]
[in a new window]
|
Figure 1.
Amino acid sequence alignment of plant Prx. The
first three sequences belong to type C Prx, the three following
sequences are 2-Cys Prx (type A), and the last three are 1-Cys Prx
(type B). This alignment was performed using the Clustal W program, and
the accession numbers for these sequences are: Arabidopsis, AAD28242;
B. rapa, AAD33602; 2-Cys B. rapa, AF052202; 2-Cys
Arabidopsis, BAB08951; 2-Cys Spinacia oleracea, O24364;
1-Cys Hordeum vulgare, CAA65387; 1-Cys Oryza
sativa, BAA09947; and 1-Cys Arabidopsis, Y12089. Asterisk,
Indicates strict homologies between all the sequences and conserved Cys
within a Prx subtype.
|
|
Expression of the Recombinant Protein, Purification, and
Physical Characteristics
When the E. coli BL21 (DE3) strain was cotransformed by
the plasmids pET-Prx and pSBET, a huge overexpression of the enzyme was
observed, the recombinant Prx representing more than 50% of the total
protein content (data not shown). This allowed us to purify the protein
with a very high yield using two simple chromatographic steps
consisting of an ACA 44 gel filtration column followed by a
DEAE-Sephacel ion exchange. Nearly 40 mg protein was obtained per liter
culture with a very high purity, based on a calculated molar extinction
coefficient of 10,930 M 1
cm 1 (see Fig. 2).
After staining with Coomassie Blue, the purified protein clearly shows
a doublet band with an apparent molecular mass of about 18 kD, a value
in close agreement with the predicted mass of the polypeptide (17,408 D). The origin of the polypeptide doublet is not fully understood, but
it was observed when lysing whole bacterial cells that a similar
doublet is already present, strongly suggesting that this property is
not an artifact due to proteolysis during the protein purification
process. Nevertheless, an N terminus amino acid analysis of
the recombinant protein indicated a clipping of the N terminus with
the superimposition of the sequences MAPIAV, APIAV, and PIAV, the
MAPIAV sequence being more prevalent, accounting for more than
50% of the whole protein population. A similar doublet has been
observed with various Prx and Kang et al. (1998) have shown that this
doublet can be erased on type B Prx when the samples are treated with a
strong reductant as DTT. However, Figure 2 shows that even when the
samples are treated with a strong reductant (DTT instead of
-mercaptoethanol), at high temperature in the presence of SDS, a
double component is always observed. Extraction of poplar Prx from the
bacterial cells in the presence of 5 mM DTT and
purification in the presence of 1 mM DTT also did
not affect the SDS-PAGE pattern, suggesting that the oxidation of the
highly conserved Cys (Cys 51) was not the cause of this behavior. Even
when the protein was prepared in the absence of a reductant, it was
found to be essentially in the reduced state. This was estimated by
titrating the recombinant enzyme with 5,5',dithiobis-nitrobenzoic acid
(DTNB). In the native state or in the denatured state (in the presence
of 1% [w/v] SDS), 2 mol thiol groups were observed per mole
enzyme, suggesting that the enzyme is fully reduced and that both
thiols are accessible and not buried. The addition of concentrations of
H2O2, ranging from 100 µM to 1 mM, resulted in
the disappearance of 1.5 mol SH per mole enzyme. Thus, it is likely
that the addition of the oxidizing substrate fully oxidizes the
presumed catalytic Cys and partially Cys 76.

View larger version (29K):
[in this window]
[in a new window]
|
Figure 2.
Size determination and purity of recombinant
poplar Prx. The size marker used is Precision Protein
Standards, unstained from Bio-Rad (Hercules, CA). Each lane
contains about 3 µg of Prx. Lane 1, SDS and -mercaptoethanol; lane
2, SDS alone; lane 3, SDS and dithiothreitol (DTT).
|
|
The oligomeric nature of Prx of the C type is not well
documented in the literature so far. On the other hand, it has been proposed that Prx of the A type are dimers of identical subunits linked
by a disulfide bridge. Treating the recombinant enzyme with SDS in the
absence of a reductant (either -mercaptoethanol or DTT) clearly
indicates that such a hypothesis can be ruled out for the poplar enzyme
because the protein always migrates as a monomer (data not shown). When
analyzed on ACA44 gel filtration, the poplar Prx also behaved as a
monomer (data not shown), suggesting that type C Prx is monomeric.
Catalytic Properties of Type C Poplar Prx
One of the most widely used tests for the detection of Prx
activity is the protection of plasmids in the presence of a thiol metal-catalyzed oxidation (MCO) generating system (generally DTT and
reduced Fe; Fig. 3). Although the strong
oxidizing agents generated by the MCO system are able to destroy the
plasmid, the addition of recombinant Prx clearly has a protective
effect that cannot be reproduced by the addition of similar amounts of
an unrelated protein, BSA. When DTT was replaced by reduced ascorbate, the plasmid was not protected and degraded, confirming the need for a
thiol as a reductant of Prx.

View larger version (28K):
[in this window]
[in a new window]
|
Figure 3.
Prx-dependent inactivation of DNA cleavage by
MCO. Plasmid pLBR19 was added in each reaction mixture after 40 min.
Lane 1, pLBR19 alone; lane 2, DTT alone; lane 3, DTT + FeCl3; lanes 4 through 6, DTT + FeCl3 + various amounts of Prx (10, 20, and 40 µM); lane 7, DTT + FeCl3 + bovine
serum albumin (BSA; 20 µM); lane 8, ascorbate + FeCl3. Nicked form (NF) and supercoiled form (SF)
of pLBR19 are indicated on the left.
|
|
The poplar Prx is able to reduce
H2O2 in the presence of
external hydrogen donors, Trx (Fig. 4) or
Grx (Fig. 5). As shown in Table
I, the Prx can use reduced poplar Trx
h as a proton donor generated by the addition of NADPH and
NTR. Omitting either the NTR or the Trx h components
as well as the substrate
H2O2 results in a complete
loss of the NADPH oxidizing activity. Table I also shows that the C
type poplar Prx can alternatively use reduced poplar Grx as a proton
donor to carry out its catalytic reaction. In this case, the generating
system is composed of NADPH, GR, glutathione, and Grx. Because reduced
glutathione directly reduces
H2O2, a background activity
is observed when either Grx or Prx are omitted. Nevertheless, a full
activity is only observed when all the components of the GSH/Grx chain
are supplied, strongly suggesting that Grx can serve as an alternate
proton donor for type C Prx.

View larger version (17K):
[in this window]
[in a new window]
|
Figure 4.
Trx and Prx dependency of
H2O2 reduction. The
concentrations of the other components are as follows: 150 µM NADPH, 1.6 µM NADPH Trx reductase (NTR),
and 100 µM
H2O2. A, Prx concentration
is 5 µM; B, Trx concentration is 4 µM.
|
|

View larger version (17K):
[in this window]
[in a new window]
|
Figure 5.
Grx and Prx dependency of
H2O2 reduction. The
concentrations/amounts of the other components are as follows: 150 µM NADPH, 0.5 units glutathione reductase (GR), 1 mM GSH, and 100 µM
H2O2. A, Prx concentration
is 40 µM; B, Grx concentration is 12 µM.
The background activities due to reduced glutathione alone (about 0.1 OD/min) have been substracted.
|
|
View this table:
[in this window]
[in a new window]
|
Table I.
Proton donor requirements for the
peroxiredoxin-linked reduction of H2O2
All reactions were carried out at 30°C in a total volume of 500 µL
and followed spectrophotometrically using a Cary 50 spectrophometer
(Varian Mulgrave, Victoria, Australia). The results are expressed in
A340 per minute. The concentrations/amounts
of the various components were as follows: A, 1.6 µM NTR,
15 µM Trx h, 17 µM Prx, 100 µM H2O2 and B, 0.5 units GR, 1 mM GSH, 50 µM Grx, 43 µM Prx;
100 µM H2O2.
|
|
Figure 4A shows the Prx linked reduction of
H2O2 in the presence of
increasing Trx h concentrations. The reaction rate increases as a function of Trx concentrations and saturates at about 10 µM (Fig. 4A). The reaction rate was also
examined as a function of the Prx concentration (Fig. 4B). As expected,
the catalytic activity goes up with increasing Prx concentrations in
the range 0 to 15 µM. The rate of the reaction
was also estimated as a function of the Grx concentrations when reduced
GSH was the donor (Fig. 5). Similar to what was observed with Trx, the
reaction rate increases as a function of the Grx concentration and
saturates at about 30 µM (Fig. 5A). With
glutathione and Grx as electron donor, the reaction rate increased with
increasing Prx concentrations in the range 0 to 80 µM (Fig. 5B).
The capacity of recombinant poplar Prx to reduce various other
peroxides has also been evaluated. Table
II shows that besides H2O2, cumene hydroperoxide
and tert-butyl hydroperoxide can also be used by this
enzyme, with similar efficiency. However, cumene hydroperoxide is
clearly detrimental to proteins of the Trx system because the activity
recorded drops to about 35% of those obtained with either
H2O2 or
tert-butyl hydroperoxide, whereas this activity remains
nearly constant with the Grx system.
View this table:
[in this window]
[in a new window]
|
Table II.
Comparison of various alkylhydroperoxides as
substrates of poplar Prx
Reactions are performed at 30°C in 50 mM phosphate
buffer, pH 7, with 150 µM NADPH, 100 µM
substrates, and in the presence of 1.6 µM NTR, 15 µM Trx, and 25 µM Prx for the Trx system
and 0.5 units of GR, 1 mM GSH, 12.5 µM Grx,
and 25 µM Prx for the Grx system. Reactions were started
after 1 min by adding substrates.
|
|
Expression and Localization in Planta
We have also generated evidence that the type C Prx gene is
efficiently transcribed and translated in planta. Figure
6A shows the results of a northern
experiment made with RNAs isolated from three different poplar organs:
leaves, stems, and roots. A single transcript of about 1 kb was
detected in all organs, and the level of transcription was high in
leaves (lane L), lower in roots (lane R) ,and weak in stems (lane S).
The use of specific polyclonal antibodies allowed us to detect the
presence of the Prx polypeptide in all organs as well (Fig. 6B). The
western-blot experiment matches the results of the northern-blot
experiment, with higher expression in leaves and roots. It was
estimated that there is approximately 500 ng Prx mg
protein 1 in leaves based on a standard curve
established with increasing amounts of the recombinant protein (data
not shown). A single polypeptide was detected in plant extracts with a
size identical to the recombinant protein. Again, this indicates that
there is no cleavage of a signal sequence in the protein. Nevertheless, immunolocalization experiments in leaves indicate the presence of large
amounts of type C Prx in the sieve tubes of the phloem. The gold
particle labeling was extremely specific and essentially restricted to
plastid-like structures present in these cells (Fig. 7).

View larger version (54K):
[in this window]
[in a new window]
|
Figure 6.
: Detection of Prx mRNA and polypeptide in planta.
L, Leaves, S, stems; R, roots. A, Northern-blot analysis: as a control,
28S rRNA stained by Radiant Red RNA gel stain from Bio-Rad before
blotting is shown. B, Western-blot analysis with purified anti-Prx
antibody.
|
|

View larger version (137K):
[in this window]
[in a new window]
|
Figure 7.
Electron micrographs of poplar sieve elements. A,
One sieve element (SE) containing sieve element plastids (Pl) and
parietal P proteins (PP) shown with companion cell (CC). B, Prx
labeling in sieve element plastids.
|
|
 |
DISCUSSION |
The Prx sequence isolated here is neither a so-called 2-Cys Prx
(referred to in this work as type A), nor a 1-Cys Prx (referred here as
type B). The poplar Prx is the shortest among the many isotypes
characterized so far (only 162 amino acids). It lacks especially a
C-terminal extension consistently present in isotypes A and B and there
is no N-terminal extension. The presence in all ESTs of a stop codon in
frame 9 triplets upstream of the initiation codon precludes the
existence of a transit peptide in this protein. Despite the apparent
absence of a signal sequence, the protein was shown by immunochemistry
to be located in plastids of the sieve elements of the
phloem. Thus, either there is a signal internal to the
sequence or the protein is transported through the vesicular pathway
from the companion cell via the branched plasmodesmata. It is
interesting that both Trx and Grx are major soluble protein components
of the phloem sap (Szederkenyi et al., 1997 ; Ishiwatari et al., 1998 ).
This has prompted speculation that both proteins are involved in redox
based regulation in phloem cells. It is clear that the Prx isolated
here could participate to such a regulation because it uses both Trx
and Grx as a proton donor. It is interesting that it has been proposed
that upon injury, the sieve element plastids disintegrate and release
their protein content at the level of the sieve plate (Knoblauch and
van Bel, 1998 ). Because type C Prx is specifically located in those
structures, it is tempting to speculate that is should be involved in
the response to oxidative stress generated in such conditions.
A high expression of Prx was obtained by cotransformation with the
plasmid pSBET and the protein could then be purified with a very high
yield. The native enzyme is monomeric in solution and its two Cys
residues are in the reduced form, irrespective of its mode of
purification (inclusion of a reductant as DTT or not). It is
interesting that type A Prx are reported to be dimeric enzymes with a
disulfide bridge connecting the catalytic Cys of one subunit and
another Cys of the other subunit. Because this additional Cys is in the
C terminus extension, a similar organization cannot apply to the type C
Prx described in this work.
We propose that the short length of the sequence is a first criterion
of a type C Prx. Other criteria are the presence of an additional
invariant Cys at position 76 and the capacity to use either Trx or Grx
as a proton donor for the reaction. The poplar enzyme reduces alkyl
hydroperoxides, and especially
H2O2, in the presence of an
exogenous proton donor. This was demonstrated both kinetically,
following the NADPH oxidation linked to the catalytic process, and by
the observation that externally added H2O2 is able to oxidize
critical Cys residues, even at low concentrations. The capacity to
reduce H2O2 was also
confirmed with a widely used plasmid protection assay. The biochemical
data suggest that the poplar Prx is able to use either Trx or Grx as
proton donors, a result that has not been reported before (Fig.
8). This raises the question of the
identity of the physiological proton donor of this new type C
Prx.
The biochemical data presented here do not permit us to determine the
identity of the physiological proton donor in plants because both
systems (Trx and Grx) display similar efficiencies. A further
complication is the high number of Trx h variants in plants
(Buchanan et al., 1994 ; Rivera-Madrid et al., 1995 ), because the
different isoforms could display varying affinities toward type C Prx.
We could not test all isoforms as proton donors at this point, but
could observe that the distant Chlamydomonas reinhardtii Trx
h shows similar reactivity to the poplar Trx h
used in this work (data not shown). This could be an indication that
there should not be a high specificity between the Trx h
isoforms versus type C Prx. In an earlier work, using a Trx modified by
site-directed mutagenesis, a yeast Prx (YLR109) has been identified as
an in vivo target of Trx (Verdoucq et al., 1999 ). It should be
stressed, however, that YLR109 presents lower homologies to type C Prx
because it possesses several sequence insertions and lacks the
additional conserved Cys typical of all plant sequences. As a
consequence, it is not clear whether this result can be extended to the
type C plant Prx exemplified by the sequence studied in this work.
A very interesting piece of information about the nature of the proton
donor can be obtained from sequences available in the nucleotide data
bank. Three of those sequences (Hemophilus influenzae, Neisseria meningitidis, and Vibrio cholerae with
accession nos. AAC22230, CAB94403, and AE004330, respectively) exhibit
a natural fusion between a Prx motif present in the N terminus of the
sequence and a Grx motif that constitutes the C terminus of the
sequence. The N terminus displays strong homology (over 50%) with the
poplar Prx sequence, with no sign of a N terminus extension. In
addition, two of these sequences (V. cholerae and N. meningitidis) possess the conserved additional Cys (equivalent to
Cys 76). This definitely classifies those sequences as a putative ancestor of type C Prx. The existence of these prokaryotic sequences strongly suggests that a Grx could serve as a physiological proton donor to type C Prx, in a manner analogous to the natural fusion protein that exists between Trx reductase and Trx in
Mycobacterium leprae (Wieles et al., 1995 ). Moreover, recent
analyses indicate that in prokaryotes, gene fusion events could
reasonably indicate a functional association of these proteins (Enright
et al., 1999 ; Marcotte et al., 1999 ).
 |
MATERIALS AND METHODS |
Cloning of the cDNA Sequences, Expression in Escherichia
coli of the Recombinant Proteins, and Purification
Procedures
The expression and purification of Chlamydomonas
reinhardtii and poplar (Populus trichocarpa × deltoides) Trx h as well as of
Arabidopsis NTR have been described already (Jacquot et al., 1994 ;
Stein et al., 1995 ; Behm and Jacquot., 2000 ). The procedure for the
overexpression and purification of Grx will be described in a separate paper.
Several ESTs corresponding to poplar Prx were
identified in GenBank
(http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?db=Nucleotide) using the program Advanced Blast 2.0 (http://www.ncbi.nlm.nih.gov:80/BLAST/). Two primers were
designed to amplify the full-length cDNA by PCR using as a template a
phage cDNA xylem/phloem library from poplar provided by Drs. Wout
Boerjan and Hugo Meyermans (University of Gent, Belgium). The forward
oligonucleotide (GGGGCCATGGCCCCGATTGCTGTTGGT) contains an
NcoI restriction site (underlined) with the initial ATG
followed by the 5' sequence of the open reading frame, and the reverse
primer (GGGGGGATCCTCAAAGATCCTTGAGATATCC) contains a
BamHI restriction site followed by sequences
complementary to the stop codon and matching the 3' end of the open
reading frame. The fragment coding for Prx was amplified by PCR, using
2.5 µL of cDNA library as a template. The cDNA library was first
denatured by an initial step of 10 min at 95°C. Taq
polymerase was then added and 35 cycles of amplification were performed
(1 min at 95°C, 2 min at 47°C, and 3 min at 72°C), followed by a
final extension step of 10 min. Overall, the PCR reaction (100 µL)
contained 1 unit of Goldstar DNA polymerase, 200 nM of each
primer, 2 mM MgCl2, and 160 µM
deoxyribonucleotide triphosphate).
The PCR product of about 500 bp was then purified, digested, and cloned
into the pET-3d vector to generate the construction pET-Prx that was
used to transform BL21(DE3). An initial small-scale expression gave
very poor yields, presumably because of the existence of codons poorly
adapted to E. coli translation machinery. It is well
known that several triplets are not frequently used in E.
coli, presumably because of low amounts of the corresponding tRNAs (Makrides, 1996 ). A thorough examination of the poplar Prx sequence indicates that a tandem of AGG triplets coding for the doublet
R128-R129 should be extremely unfavorable for a high yield expression.
In accordance, the E. coli BL21 (DE3) strain was
cotransformed by pET-Prx and by the plasmid pSBET that encodes the tRNA
needed to recognize the AGG and AGA triplets (Schenk et al., 1995 ). The E. coli BL21(DE3) strain, cotransformed with pSBET
(Schenk et al., 1995 ), was transformed by electroporation by pET-Prx.
One ampicillin- and kanamycin-resistant clone was amplified up to 5 L
in Luria-Bertani medium at 25°C and induced during 4 h
with 100 µM
isopropyl- -D-thiogalactopyranoside. The bacterial cells were collected by centrifugation (5,000g, 15 min) and
resuspended in TE buffer (30 mM Tris-HCl, pH8, and 1 mM EDTA) to a final volume of about 80 mL. The cell
suspension was sonicated on ice by 30-mL batches for 3 min using an
Ultrasonic XL Sonicator with an output of 4 and a duty cycle of 50. Solid ammonium sulfate was then added and the proteins precipitating
between 40% and 80% (w/v) of the saturation were collected by
centrifugation (30,000g, 20 min). The protein pellet was
then resuspended in about 20 mL of TE. The purification of recombinant
poplar Prx requires two chromatographic steps. First, the sample was
loaded onto an ACA44 column (70 × 5 cm) and then the fractions
containing the recombinant protein were pooled and laid onto a DEAE
Sepharose fast-flow column (10 × 2.5 cm). The protein was eluted
with a 0 to 0.4 M NaCl gradient in buffer TE (250-250 mL),
and then concentrated and dialyzed against TE buffer on a cell (Amicon,
Beverly, MA) equipped with a YM10 membrane. The protein was kept
frozen at 20°C and stored as 50-µL aliquots at a concentration of
about 30 mg mL 1.
In Vitro Peroxidase Assays
The reduction of H2O2 or alkyl
hydroperoxides was first estimated indirectly by measuring NADPH
oxidation at 340 nm. It is based on the property that Prx uses a
hydrogen donor to carry out catalysis (most often reduced Trx generated
via NADPH and NTR), but also in this study, reduced Grx in the presence
of glutathione, which is itself maintained reduced by NADPH and GR.
The reaction mixture (500 µL) for the Trx-dependent assay was as
follows: 50 mM Na-K phosphate buffer, pH 7.0; 150 µM NADPH; 0 to 50 µM poplar or C.
reinhardtii Trx h; 0 to 50 µM Prx;
and 1.5 µM Arabidopsis Trx reductase. The reaction was
initiated by adding 1 mM H2O2 and
the NADPH oxidation was followed spectrophotometrically at 340 nm using
a Cary 50 apparatus at 30°C.
When Grx was tested as the proton donor, the reaction medium had the
following composition: 50 mM Na-K phosphate buffer, pH 7.0;
150 µM NADPH; 1 mM reduced glutathione; 0.5 units GR; 0 to 50 µM Grx; and 0 to 80 µM
Prx. As described above, the reaction was carried out in 500 µL,
initiated with H2O2, and its rate followed spectrophotometrically at 340 nm.
A second possible test is the protection of plasmids against radicals
generated by MCO. H2O2 can be formed by a
reaction occurring between DTT, Fe3+, and O2,
and then transformed into hydroxyl radical by the Fenton reaction
(Halliwell and Gutteridge, 1990 ). These radicals are able to damage
nucleic acids or inactivate enzymes as Gln synthetase.
Plasmid pLBR19 was used to measure the capacity of Prx to eliminate
H2O2 before its tranformation in radicals. A
reaction mixture of 20 µL includes 3.3 µM
FeCl3, 10 mM DTT for the thiol MCO system, or
10 mM ascorbate for the non-thiol MCO system, different Prx
concentrations (10-40 µM), or 20 µM BSA,
in 50 mM HEPES
[4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid]-[NaOH], pH
7.2. The reaction was initiated by incubating the mixture for 40 min
before adding about 1 µg of plasmid for 7 h at 37°C. The
plasmid degradation was evaluated on 1% (w/v) agarose gel after
staining with ethidium bromide (Sambrook et al., 1989 ).
Thiol Content Titration
The free thiol content of recombinant poplar Prx was estimated
using DTNB as described by Jacquot et al. (1984) . One milligram of Prx
dissolved in 1 mL of Tris-HCl (100 mM, pH 8.0) was reacted with 10 µL of 20 mM DTNB in the presence of various
H2O2 concentrations (ranging from 100 µM to 1 mM). An assay was performed in the
presence of 1% (w/v) SDS to denature the protein and estimate
whether it contains buried thiol groups. The cleavage of DTNB to
TNB was followed by measuring the
A412 after 30 min reaction in the dark, and
the thiol content was determined using a molar extinction coefficient
of 13,600 M 1 cm 1 at 412 nm.
Protein Extraction from Poplar Tissues
Four-hundred milligrams of 2-month-old poplar leaves, stems, and
roots was used for protein extraction. Tissues were ground into powder
in the presence of liquid nitrogen and suspended in the extraction
buffer (50 mM Tris-HCl, pH 7.5; 14 mM
phenylmethylsulfonyl fluoride; and 0.05% [v/v]
-mercaptoethanol). Soluble proteins were obtained in the supernatant
by two successive centrifugation steps (14,000g, 10 min)
and then precipitated in the presence of acetone (4 volumes). Proteins
were pelleted by centrifugation, the pellet was then washed by a novel
centrifugation step in the presence of acetone, and dried after
eliminating the supernatant. Proteins were resuspended in a
solubilization buffer composed of 125 mM Tris HCl, pH 6.8;
20% (v/v) glycerol; 2% (w/v) SDS; 5% (v/v)
-mercaptoethanol; and 0.05% (w/v) bromophenol blue. Protein
concentrations in the extracts were determined by the Bradford reaction
as described in the Bio-Rad kit.
Antibody Purification
The antibodies have been purified from the serum by
immuno-adsorption on a Prx-Sepharose column generated by coupling 35 mg of Prx to 2.5 g of CNBr Sepharose gel (Amersham Pharmacia Biotech, Uppsala). Fractions of 4 mL of the rabbit serum were applied
onto the column (1 × 5 cm) and the antibodies were allowed to
react with the matrix for 30 min. After washing the column with TE
buffer, antibodies were eluted with 50 mM acetic acid in
fractions of 1 mL in tubes containing 200 µL of 1 M
Tris-HCl, pH 8. Fractions containing the antibodies were pooled and
dialyzed against TE buffer.
SDS-PAGE and Western Blotting
Proteins from poplar tissues (10 µg) were separated by 14%
(w/v) SDS-PAGE following the procedure of Laemmli (1970) and
transferred onto a polyvinylidene difluoride membrane during the night
in the presence of transfer buffer (25 mM Tris, 192 mM Gly, and 20% [v/v] ethanol). Blocking of the
membrane was achieved at room temperature during 4 h with the
blocking buffer (20 mM Tris-HCl, pH 7.5; 500 mM
NaCl; 0.05% [w/v] milk powder; and 0.05% [v/v] Tween 20).
The membrane was then incubated with purified anti-Prx antibodies
(equivalent to 1.10 3 OD at 280 nm) in 15 mL of blocking
buffer during at least 2 h, and extensively washed before reaction
with anti-rabbit secondary antibodies provided in the Immune Star Goat
Anti Rabbit Detection Kit from Bio-Rad. The bioluminescence reaction
was done according to the instructions of the manufacturer.
RNA Extraction and Northern Blotting
Total RNA was extracted from 100 mg of leaves, stems, and roots
from 2-month-old poplar grown in hydroponic medium, with the RNeasy
Plant Mini Kit (Qiagen USA, Valencia, CA) with addition of
polyethylene glycol 8000 to the extraction buffer at a concentration of
20 mg mL 1. Ten micrograms of total RNA was separated and
blotted by capillarity onto a nylon membrane from Amersham Pharmacia
Biotech. The probe, consisting of about 100 ng of a PCR fragment
(identical to the Prx fragment cloned), was labeled with
32P dATP following the instructions provided in the kit
Prime a Gene Labeling System (Promega, Madison, WI). The probe
was then purified with the QIAquick Nucleotides Removal Kit from
Qiagen, and was estimated to contain 30 million cpm. Hybridization was performed at 42°C in the presence of 5× SSPE and 0.5% (w/v)
SDS, and washing at 65°C with a solution of 2× SSPE and 0.1%
(w/v) SDS.
Immunolocalization Procedures
Samples were dissected from young poplar leaves in a drop of
fixation solution and then fixed by immersion for 3 h at 4°C in
4% (w/v) paraformaldehyde and 0.5% (v/v) glutaraldehyde in 0.1 M cacodylate buffer, pH 7.4. Leaf samples were subsequently rinsed in 0.1 M of the above buffer, treated with 2%
(w/v) OsO4, dehydrated in a series of alcohol and
propylene oxide, embedded in Durcupan, and finally polymerized at 56°
for 48 h.
Ultrathin sections were successively floated for 15 min in a 0.05 M Gly, 0.05 M Tris-phosphate-buffered saline
(TPBS) solution, 30 min on a blocking solution of 1% (w/v) BSA
in TPBS (TPBS/BSA), and then treated for 2 h with the purified
rabbit Prx-antibodies (diluted 1:100 [v/v] in TPBS/BSA). This
step was omitted in the controls. After washing, sections were
incubated for 2 h in a solution of 0.05 M Tris-HCl
buffer containing 0.05% (w/v) polyethylene glycol with
gold-labeled goat anti-rabbit IgG (10 nm, dilution 1:20
[v/v], Sigma, St. Louis). Sections were then rinsed,
dried, and stained with uranyl acetate and lead citrate.
 |
ACKNOWLEDGMENTS |
The authors would like to thank Matthieu Behm for initial
cloning experiments, Eliane Keryer for DNA sequencing, Marine
Wasniewski for invaluable help with the northern experiments, Arnaud
Javelle for helpful discussions, and Dr. Hugo Meyermans for
providing the poplar cDNA library.
 |
FOOTNOTES |
Received July 2, 2001; returned for revision July 10, 2001; accepted August 15, 2001.
1
This work was supported by Centre National de la
Recherche Scientifique grant no. PCV 98-099 and by the credit
d'installation from the Ministère de l'Education Nationale, de
la Recherche et de la Technologie.
*
Corresponding author; e-mail j2p{at}scbiol.uhp-nancy.fr; fax 33383912243.
Article, publication date, and citation information can be found at
www.plantphysiol.org/cgi/doi/10.1104/pp.010586.
 |
LITERATURE CITED |
-
Baier M, Dietz KJ
(1997)
The plant 2-Cys peroxiredoxin BAS1 is a nuclear-encoded chloroplast protein: its expressional regulation, phylogenetic origin, and implications for its specific physiological function in plants.
Plant J
12: 179-190[CrossRef][Web of Science][Medline]
-
Baier M, Dietz KJ
(1999)
Protective function of chloroplast 2-cysteine peroxiredoxin in photosynthesis: evidence from transgenic Arabidopsis.
Plant Physiol
119: 1407-1414[Abstract/Free Full Text]
-
Baier M, Noctor G, Foyer CH, Dietz KJ
(2000)
Antisense suppression of 2-cysteine peroxiredoxin in Arabidopsis specifically enhances the activities and expression of enzymes associated with ascorbate metabolism but not glutathione metabolism.
Plant Physiol
124: 823-832[Abstract/Free Full Text]
-
Beckman KB, Ames BN
(1997)
Oxidative decay of DNA.
J Biol Chem
272: 19633-19636[Free Full Text]
-
Behm M, Jacquot JP
(2000)
Isolation and characterization of thioredoxin h from poplar xylem.
Plant Physiol Biochem
38: 363-369[CrossRef]
-
Berlett BS, Stadtman ER
(1997)
Protein oxidation in aging, disease, and oxidative stress.
J Biol Chem
272: 20313-20316[Free Full Text]
-
Buchanan BB, Schürmann P, Decottignies P, Lozano RM
(1994)
Thioredoxin: a multifunctional regulatory protein with a bright future in technology and medicine.
Arch Biochem Biophys
314: 257-260[CrossRef][Web of Science][Medline]
-
Chae HZ, Chung SJ, Rhee SG
(1994a)
Thioredoxin-dependent peroxide reductase from yeast.
J Biol Chem
269: 27670-27678[Abstract/Free Full Text]
-
Chae HZ, Uhm TB, Rhee SG
(1994b)
Dimerization of thiol-specific antioxidant and the essential role of cysteine 47.
Proc Natl Acad Sci USA
91: 7022-7026[Abstract/Free Full Text]
-
Cheong NE, Choi YO, Lee KO, Kim WY, Jung BG, Chi YH, Jeong JS, Kim K, Cho MJ, Lee SY
(1999)
Molecular cloning, expression, and functional characterization of a 2 Cys-peroxiredoxin in Chinese cabbage.
Plant Mol Biol
40: 825-834[CrossRef][Web of Science][Medline]
-
Choi YO, Cheong NE, Lee KO, Jung BG, Hong CH, Jeong JH, Chi YH, Kim K, Cho MJ, Lee SY
(1999)
Cloning and expression of a new isotype of the peroxiredoxin gene of Chinese cabbage and its comparison to 2 Cys-peroxiredoxin isolated from the same plant.
Biochem Biophys Res Commun
258: 768-771[CrossRef][Web of Science][Medline]
-
Enright AJ, Iliopoulos I, Kyrpides NC, Ouzounis CA
(1999)
Protein interaction maps for complete genomes based on gene fusion events.
Nature
402: 86-90[CrossRef][Medline]
-
Halliwell B, Gutteridge JM
(1990)
Role of free radicals and catalytic metal ions in human disease: an overview.
Methods Enzymol
186: 1-85[CrossRef][Medline]
-
Haslekas C, Stacy RA, Nygaard V, Culianez-Macia FA, Aalen RB
(1998)
The expression of a peroxiredoxin antioxidant gene, AtPer1, in Arabidopsis thaliana is seed-specific and related to dormancy.
Plant Mol Biol
36: 833-845[CrossRef][Web of Science][Medline]
-
Jacquot JP, Gadal P, Nishizawa AN, Yee BC, Crawford NA, Buchanan BB
(1984)
Enzyme regulation in C4 photosynthesis: mechanism of activation of NADP-malate dehydrogenase by reduced thioredoxin.
Arch Biochem Biophys
228: 170-178[Medline]
-
Jacquot JP, Rivera-Madrid R, Marinho P, Kollarova M, Le Marechal P, Miginiac-Maslow M, Meyer Y
(1994)
Arabidopsis thaliana NAPHP thioredoxin reductase. cDNA characterization and expression of the recombinant protein in Escherichia coli.
J Mol Biol.
235: 1357-1363[CrossRef][Web of Science][Medline]
-
Ishiwatari Y, Fujiwara T, McFarland KC, Nemoto K, Hayashi H, Chino M, Lucas WJ
(1998)
Rice phloem thioredoxin h has the capacity to mediate its own cell-to-cell transport through plasmodesmata.
Planta
205: 12-22[CrossRef][Web of Science][Medline]
-
Jin DY, Chae HZ, Rhee SG, Jeang KT
(1997)
Regulatory role for a novel human thioredoxin peroxidase in NF-kappaB activation.
J Biol Chem
272: 30952-30961[Abstract/Free Full Text]
-
Kang SW, Baines IC, Rhee SG
(1998)
Characterization of a mammalian peroxiredoxin that contains one conserved cysteine.
J Biol Chem
273: 6303-6311[Abstract/Free Full Text]
-
Kim H, Lee TH, Park ES, Suh JM, Park SJ, Chung HK, Kwon OY, Kim YK, Ro HK, Shong M
(2000)
Role of peroxiredoxins in regulating intracellular hydrogen peroxide and hydrogen peroxide-induced apoptosis in thyroid cells.
J Biol Chem
275: 18266-18270[Abstract/Free Full Text]
-
Knoblauch M, van Bel AJ
(1998)
Sieve tubes in action.
Plant Cell
10: 35-50[Abstract/Free Full Text]
-
Laemmli UK
(1970)
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227: 680-685[CrossRef][Medline]
-
Lewis ML, Miki K, Ueda T
(2000)
FePer 1, a gene encoding an evolutionarily conserved 1-Cys peroxiredoxin in buckwheat (Fagopyrum esculentum Moench) is expressed in a seed-specific manner and induced during seed germination.
Gene
246: 81-91[CrossRef][Web of Science][Medline]
-
Makrides SC
(1996)
Strategies for achieving high-level expression of genes in Escherichia coli.
Microbiol Rev
60: 512-538[Abstract/Free Full Text]
-
Marcotte EM, Pellegrini M, Ng HL, Rice DW, Yeates TO, Eisenberg D
(1999)
Detecting protein function and protein-protein interactions from genome sequences.
Science
285: 751-753[Abstract/Free Full Text]
-
Pedrajas JR, Miranda-Vizuete A, Javanmardy N, Gustafsson JA, Spyrou G
(2000)
Mitochondria of Saccharomyces cerevisiae contain one-conserved cysteine type peroxiredoxin with thioredoxin peroxidase activity.
J Biol Chem
275: 16296-16301[Abstract/Free Full Text]
-
Prosperi MT, Ferbus D, Karczinski I, Goubin G
(1993)
A human cDNA corresponding to a gene overexpressed during cell proliferation encodes a product sharing homology with amoebic and bacterial proteins.
J Biol Chem
268: 11050-11056[Abstract/Free Full Text]
-
Rhee SG, Kang SW, Netto LE, Seo MS, Stadtman ER
(1999)
A family of novel peroxidases, peroxiredoxins.
Biofactors
10: 207-209[Web of Science][Medline]
-
Rhee SG, Kim KH, Chae HZ, Yim MB, Uchida K, Netto LE, Stadtman ER
(1994)
Antioxidant defense mechanisms: a new thiol-specific antioxidant enzyme.
Ann N Y Acad Sci
738: 86-92[Web of Science][Medline]
-
Rivera-Madrid R, Mestres D, Marinho P, Jacquot JP, Decottignies P, Miginiac-Maslow M, Meyer Y
(1995)
Evidence for five divergent thioredoxin h sequences in Arabidopsis thaliana.
Proc Natl Acad Sci USA
92: 5620-5624[Abstract/Free Full Text]
-
Sambrook J, Fritsch EF, Maniatis T
(1989)
Molecular cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
-
Schenk PM, Baumann S, Mattes R, Steinbiss HH
(1995)
Improved high-level expression system for eukaryotic genes in Escherichia coli using T7 RNA polymerase and rare ArgtRNAs.
Biotechniques
19: 196-200[Web of Science][Medline]
-
Schröder E, Ponting CP
(1998)
Evidence that peroxiredoxins are novel members of the thioredoxin fold superfamily.
Protein Sci
7: 2465-2468[Web of Science][Medline]
-
Seo MS, Kang SW, Kim K, Baines IC, Lee TH, Rhee SG
(2000)
Identification of a new type of mammalian peroxiredoxin that forms an intramolecular disulfide as a reaction intermediate.
J Biol Chem
381: 20346-20354
-
Stacy RA, Nordeng TW, Culianez-Macia FA, Aalen RB
(1999)
The dormancy-related peroxiredoxin anti-oxidant, PER1, is localized to the nucleus of barley embryo and aleurone cells.
Plant J
19: 1-8[CrossRef][Web of Science][Medline]
-
Stein M, Jacquot JP, Jeannette E, Decottignies P, Hodges M, Lancelin JM, Mittard V, Schmitter JM, Miginiac-Maslow M
(1995)
Chlamydomonas reinhardtii thioredoxins: structure of the genes coding for the chloroplastic m and cytosolic h isoforms; expression in Escherichia coli of the recombinant proteins, purification and biochemical properties.
Plant Mol Biol
28: 487-503[CrossRef][Web of Science][Medline]
-
Sullivan DM, Wehr NB, Fergusson MM, Levine RL, Finkel T
(2000)
Identification of oxidant-sensitive proteins: TNF-alpha induces protein glutathiolation.
Biochemistry
39: 11121-11128[CrossRef][Medline]
-
Szederkenyi J, Komor E, Schobert C
(1997)
Cloning of the cDNA for glutaredoxin, an abundant sieve-tube exudate protein from Ricinus communis L. and characterization of the glutathione-dependent thiol-reduction system in sieve tubes.
Planta
202: 349-356[CrossRef][Web of Science][Medline]
-
Verdoucq L, Vignols F, Jacquot JP, Chartier Y, Meyer Y
(1999)
In vivo characterization of a thioredoxin h target protein defines a new peroxiredoxin family.
J Biol Chem
274: 19714-19722[Abstract/Free Full Text]
-
Wieles B, Van Noort J, Drijfhout JW, Offringa R, Holmgren A, Ottenhoff TH
(1995)
Purification and functional analysis of the Mycobacterium leprae thioredoxin/thioredoxin reductase hybrid protein.
J Biol Chem
270: 25604-25606[Abstract/Free Full Text]
-
Yamamoto T, Matsui Y, Natori S, Obinata M
(1989)
Cloning of a housekeeping-type gene (MER5) preferentially expressed in murine erythroleukemia cells.
Gene
80: 337-343[CrossRef][Web of Science][Medline]
-
Zhang P, Liu B, Kang SW, Seo MS, Rhee SG, Obeid LM
(1997)
Thioredoxin peroxidase is a novel inhibitor of apoptosis with a mechanism distinct from that of Bcl-2.
J Biol Chem
272: 30615-30618[Abstract/Free Full Text]
-
Zhou Y, Kok KH, Chun AC, Wong CM, Wu HW, Lin MC, Fung PC, Kung H, Jin DY
(2000)
Mouse peroxiredoxin V is a thioredoxin peroxidase that inhibits p53-induced apoptosis.
Biochem Biophys Res Commun
268: 921-927[CrossRef][Web of Science][Medline]
© 2001 American Society of Plant Physiologists
This article has been cited by other articles:

|
 |

|
 |
 
M. E. Perez-Perez, A. Mata-Cabana, A. M. Sanchez-Riego, M. Lindahl, and F. J. Florencio
A Comprehensive Analysis of the Peroxiredoxin Reduction System in the Cyanobacterium Synechocystis sp. Strain PCC 6803 Reveals that All Five Peroxiredoxins Are Thioredoxin Dependent
J. Bacteriol.,
December 15, 2009;
191(24):
7477 - 7489.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Shahpiri, B. Svensson, and C. Finnie
From Proteomics to Structural Studies of Cytosolic/Mitochondrial-Type Thioredoxin Systems in Barley Seeds
Mol Plant,
May 1, 2009;
2(3):
378 - 389.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X.-H. Gao, M. Bedhomme, D. Veyel, M. Zaffagnini, and S. D. Lemaire
Methods for Analysis of Protein Glutathionylation and their Application to Photosynthetic Organisms
Mol Plant,
March 1, 2009;
2(2):
218 - 235.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Kirchsteiger, P. Pulido, M. Gonzalez, and F. J. Cejudo
NADPH Thioredoxin Reductase C Controls the Redox Status of Chloroplast 2-Cys Peroxiredoxins in Arabidopsis thaliana
Mol Plant,
March 1, 2009;
2(2):
298 - 307.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Lepisto, S. Kangasjarvi, E.-M. Luomala, G. Brader, N. Sipari, M. Keranen, M. Keinanen, and E. Rintamaki
Chloroplast NADPH-Thioredoxin Reductase Interacts with Photoperiodic Development in Arabidopsis
Plant Physiology,
March 1, 2009;
149(3):
1261 - 1276.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Dayer, B. B. Fischer, R. I. L. Eggen, and S. D. Lemaire
The Peroxiredoxin and Glutathione Peroxidase Families in Chlamydomonas reinhardtii
Genetics,
May 1, 2008;
179(1):
41 - 57.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Traverso, F. Vignols, R. Cazalis, A. J. Serrato, P. Pulido, M. Sahrawy, Y. Meyer, F. J. Cejudo, and A. Chueca
Immunocytochemical localization of Pisum sativum TRXs f and m in non-photosynthetic tissues
J. Exp. Bot.,
April 1, 2008;
59(6):
1267 - 1277.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. A. Eckardt
Oxidation Pathways and Plant Development: Crosstalk between Thioredoxin and Glutaredoxin Pathways
PLANT CELL,
June 1, 2007;
19(6):
1719 - 1721.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-P. Reichheld, M. Khafif, C. Riondet, M. Droux, G. Bonnard, and Y. Meyer
Inactivation of Thioredoxin Reductases Reveals a Complex Interplay between Thioredoxin and Glutathione Pathways in Arabidopsis Development
PLANT CELL,
June 1, 2007;
19(6):
1851 - 1865.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Traverso, F. Vignols, R. Cazalis, A. Pulido, M. Sahrawy, F. J. Cejudo, Y. Meyer, and A. Chueca
PsTRXh1 and PsTRXh2 Are Both Pea h-Type Thioredoxins with Antagonistic Behavior in Redox Imbalances
Plant Physiology,
January 1, 2007;
143(1):
300 - 311.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Navrot, V. Collin, J. Gualberto, E. Gelhaye, M. Hirasawa, P. Rey, D. B. Knaff, E. Issakidis, J.-P. Jacquot, and N. Rouhier
Plant Glutathione Peroxidases Are Functional Peroxiredoxins Distributed in Several Subcellular Compartments and Regulated during Biotic and Abiotic Stresses
Plant Physiology,
December 1, 2006;
142(4):
1364 - 1379.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Noguera-Mazon, J. Lemoine, O. Walker, N. Rouhier, A. Salvador, J.-P. Jacquot, J.-M. Lancelin, and I. Krimm
Glutathionylation Induces the Dissociation of 1-Cys D-peroxiredoxin Non-covalent Homodimer
J. Biol. Chem.,
October 20, 2006;
281(42):
31736 - 31742.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C Doering-Saad, H. Newbury, C. Couldridge, J. Bale, and J Pritchard
A phloem-enriched cDNA library from Ricinus: insights into phloem function
J. Exp. Bot.,
September 1, 2006;
57(12):
3183 - 3193.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Hancock, R. Desikan, J. Harrison, J. Bright, R. Hooley, and S. Neill
Doing the unexpected: proteins involved in hydrogen peroxide perception
J. Exp. Bot.,
May 1, 2006;
57(8):
1711 - 1718.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K.-J. Dietz, S. Jacob, M.-L. Oelze, M. Laxa, V. Tognetti, S. M. N. de Miranda, M. Baier, and I. Finkemeier
The function of peroxiredoxins in plant organelle redox metabolism
J. Exp. Bot.,
May 1, 2006;
57(8):
1697 - 1709.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Rouhier, J. Couturier, and J.-P. Jacquot
Genome-wide analysis of plant glutaredoxin systems
J. Exp. Bot.,
May 1, 2006;
57(8):
1685 - 1696.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Majeran, Y. Cai, Q. Sun, and K. J. van Wijk
Functional Differentiation of Bundle Sheath and Mesophyll Maize Chloroplasts Determined by Comparative Proteomics
PLANT CELL,
November 1, 2005;
17(11):
3111 - 3140.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Goes da Silva, A. Iandolino, F. Al-Kayal, M. C. Bohlmann, M. A. Cushman, H. Lim, A. Ergul, R. Figueroa, E. K. Kabuloglu, C. Osborne, et al.
Characterizing the Grape Transcriptome. Analysis of Expressed Sequence Tags from Multiple Vitis Species and Development of a Compendium of Gene Expression during Berry Development
Plant Physiology,
October 1, 2005;
139(2):
574 - 597.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. H. Foyer and G. Noctor
Redox Homeostasis and Antioxidant Signaling: A Metabolic Interface between Stress Perception and Physiological Responses
PLANT CELL,
July 1, 2005;
17(7):
1866 - 1875.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Finkemeier, M. Goodman, P. Lamkemeyer, A. Kandlbinder, L. J. Sweetlove, and K.-J. Dietz
The Mitochondrial Type II Peroxiredoxin F Is Essential for Redox Homeostasis and Root Growth of Arabidopsis thaliana under Stress
J. Biol. Chem.,
April 1, 2005;
280(13):
12168 - 12180.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Lindermayr, G. Saalbach, and J. Durner
Proteomic Identification of S-Nitrosylated Proteins in Arabidopsis
Plant Physiology,
March 1, 2005;
137(3):
921 - 930.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Hosoya-Matsuda, K. Motohashi, H. Yoshimura, A. Nozaki, K. Inoue, M. Ohmori, and T. Hisabori
Anti-oxidative Stress System in Cyanobacteria: SIGNIFICANCE OF TYPE II PEROXIREDOXIN AND THE ROLE OF 1-Cys PEROXIREDOXIN IN SYNECHOCYSTIS SP. STRAIN PCC 6803
J. Biol. Chem.,
January 7, 2005;
280(1):
840 - 846.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Gelhaye, N. Rouhier, J. Gerard, Y. Jolivet, J. Gualberto, N. Navrot, P.-I. Ohlsson, G. Wingsle, M. Hirasawa, D. B. Knaff, et al.
A specific form of thioredoxin h occurs in plant mitochondria and regulates the alternative oxidase
PNAS,
October 5, 2004;
101(40):
14545 - 14550.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-M. Wong, K.-L. Siu, and D.-Y. Jin
Peroxiredoxin-null Yeast Cells Are Hypersensitive to Oxidative Stress and Are Genomically Unstable
J. Biol. Chem.,
May 28, 2004;
279(22):
23207 - 23213.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M.-K. Cha, S.-K. Hong, D.-S. Lee, and I.-H. Kim
Vibrio cholerae Thiol Peroxidase-Glutaredoxin Fusion Is a 2-Cys TSA/AhpC Subfamily Acting as a Lipid Hydroperoxide Reductase
J. Biol. Chem.,
March 19, 2004;
279(12):
11035 - 11041.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Rouhier, E. Gelhaye, J. M. Gualberto, M.-N. Jordy, E. De Fay, M. Hirasawa, S. Duplessis, S. D. Lemaire, P. Frey, F. Martin, et al.
Poplar Peroxiredoxin Q. A Thioredoxin-Linked Chloroplast Antioxidant Functional in Pathogen Defense
Plant Physiology,
March 1, 2004;
134(3):
1027 - 1038.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Brehelin, E. H. Meyer, J.-P. de Souris, G. Bonnard, and Y. Meyer
Resemblance and Dissemblance of Arabidopsis Type II Peroxiredoxins: Similar Sequences for Divergent Gene Expression, Protein Localization, and Activity
Plant Physiology,
August 1, 2003;
132(4):
2045 - 2057.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Pauwels, B. Vergauwen, F. Vanrobaeys, B. Devreese, and J. J. Van Beeumen
Purification and Characterization of a Chimeric Enzyme from Haemophilus influenzae Rd That Exhibits Glutathione-dependent Peroxidase Activity
J. Biol. Chem.,
May 2, 2003;
278(19):
16658 - 16666.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. J. Kim, J. R. Woo, Y. S. Hwang, D. G. Jeong, D. H. Shin, K. Kim, and S. E. Ryu
The Tetrameric Structure of Haemophilus influenza Hybrid Prx5 Reveals Interactions between Electron Donor and Acceptor Proteins
J. Biol. Chem.,
March 14, 2003;
278(12):
10790 - 10798.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Horling, P. Lamkemeyer, J. Konig, I. Finkemeier, A. Kandlbinder, M. Baier, and K.-J. Dietz
Divergent Light-, Ascorbate-, and Oxidative Stress-Dependent Regulation of Expression of the Peroxiredoxin Gene Family in Arabidopsis
Plant Physiology,
January 1, 2003;
131(1):
317 - 325.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Rouhier, E. Gelhaye, and J. P. Jacquot
Glutaredoxin-dependent Peroxiredoxin from Poplar. PROTEIN-PROTEIN INTERACTION AND CATALYTIC MECHANISM
J. Biol. Chem.,
April 12, 2002;
277(16):
13609 - 13614.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|