Division of Biology, University of California San Diego, La Jolla,
California 92039-0116 (N.K., I.M.M., M.J.C.); and Research and
Education Center for Genetic Information, Nara Institute of Science and
Technology, 8916-5 Takayama, Ikoma, Nara 630-0101, Japan (Y.K., K.K.,
H.S.)
A major response of eukaryotic cells to the presence of unfolded
proteins in the lumen of the endoplasmic reticulum (ER) is to activate
genes that encode ER-located molecular chaperones, such as the binding
protein. This response, called the unfolded protein response, requires
the transduction of a signal from the ER to the nucleus. In yeast
(Saccharomyces cerevisiae) and mammalian cells, an
ER-located transmembrane receptor protein kinase/ribonuclease called
Ire1, with a sensor domain in the lumen of the ER, is the first
component of this pathway. Here, we report the cloning and derived
amino acid sequences of AtIre1-1 and AtIre1-2, two Arabidopsis homologs
of Ire1. The two proteins are located in the perinuclear ER (based on
heterologous expression of fusions with green fluorescent protein). The
expression patterns of the two genes (using
-glucuronidase fusions)
are nearly nonoverlapping. We also demonstrate functional complementation of the sensor domains of the two proteins in yeast and
show that the Ire1-2 protein is capable of autotransphosphorylation. These and other findings are discussed in relation to the involvement of these genes in unfolded protein response signaling in plants.
 |
INTRODUCTION |
The endoplasmic reticulum (ER),
which in plant cells is composed of numerous distinct morphological
domains with specific functions (Staehelin, 1997
; Zheng and Staehelin,
2001
), is a three-dimensional network of membranous tubules and sheets
that extends throughout the cytoplasm. At the periphery of the cell, it
underlies the plasma membrane, and around the nucleus it links up with
the nuclear envelope. The role of the rough ER in the biosynthesis,
modification, folding, and export of secreted, vacuolar, and membrane
proteins of plant cells has been the subject of numerous studies (for
review, see Vitale and Denecke, 1999
; Vitale and Gallili, 2001
). About one-third of all cellular proteins are thought to be synthesized on the
rough ER. Correct folding of newly synthesized proteins in the lumen of
the ER is a prerequisite for their transport to other cellular
destinations. To promote polypeptide folding and subunit assembly, the
ER lumen contains molecular chaperones, disulfide exchange proteins,
and a system to synthesize and attach Asn-linked glycans to nascent
polypeptides. Malfolded and unassembled proteins are subject to a
quality control process that retains them in the ER to restore them to
normal conformation or that eliminates them via a degradation after
transport to the vacuole, or in the cytosol, after retrotranslocation
across the ER membrane (for review, see Bonifacino and Weissman, 1998
;
Mori, 2000
).
When stress causes protein folding to be slowed, the presence of
unfolded proteins in the ER triggers several cellular responses. One
such response, called the unfolded protein response (UPR), results in
the enhanced expression of a large number of genes. As part of the UPR,
the expression of genes encoding ER chaperones such as the binding
protein (BiP) and protein disulfide isomerase (PDI) is enhanced.
Genome-wide expression studies show that the UPR affects not only ER
chaperone genes, but multiple functions of the ER and the rest of the
secretory pathway as well (Travers et al., 2000
). The second cellular
response to unfolded proteins, so far only described in mammalian
cells, consists of a transient attenuation in the rate of protein
synthesis so that less protein enters the ER (see Brostrom and
Brostrom, 1998
; Harding et al., 2000
). Together, these two responses
minimize the presence of unfolded proteins in the ER.
In yeast (Saccharomyces cerevisiae) and mammalian cells
where the UPR has been studied in some detail, signaling from the ER to
the nucleus is mediated by the transmembrane protein
kinase/ribonuclease Ire1. This protein has a sensor domain in the lumen
of the ER that is thought to sense the presence of unfolded proteins.
BiP itself has been shown to be the ligand for this sensor domain (Bertolotti et al., 2000
; Okamura et al., 2000
). In yeast, the nuclease
domain initiates the splicing of the mRNA that encodes a transcription
factor (Hac1p) that is ultimately responsible for the transcriptional
activation of the UPR target genes. Yeast has only one Ire1
gene, but humans and mice have at least two genes for this protein (for
review, see Kaufman, 1999
; Silverman and Williams, 1999
). Given the
complex nature of the UPR, the two mammalian IRE1 proteins may affect
different downstream processes. Both proteins appear to signal the
induction of chaperones as shown by their expression in cultured cells
(Tirasophon et al., 1998
; Wang et al., 1998
). Iwawaki et al. (2001)
recently reported that human IRE1
induces translational repression
through 28S rRNA cleavage in response to ER stress. The attenuation
of protein synthesis is also signaled via the protein kinase
dsRNA-dependent (PKR)-like ER kinase (PERK) in mammalian cells. This
kinase has a related lumenal sensor domain (Harding et al., 1999
), but
lacks a ribonuclease domain. In mammals, under unstressed condition, BiP represses UPR signaling through the association with the lumenal regions of PERK and IRE1, but the accumulation of mis-folded proteins in the ER relieves this repression by bringing about the release of BiP
from the lumenal domains of PERK and IRE1 (Harding et al., 2000
).
Similar regulation is also observed in yeast (Okamura et al.,
2000
).
A variety of stress conditions, including treatment with tunicamycin,
inhibit the proper folding and oligomerization of proteins in the lumen
of the ER (Pelham, 1989
) and tunicamycin is routinely used as a way to
induce the UPR. Treatment of plant cells or tissues with tunicamycin
induces BiP and other ER chaperones (Fontes et al., 1991
; Shorrosh and
Dixon, 1992
). D'Amico et al. (1992)
showed that treatment of bean
(Phaesoleus vulgaris) cotyledons with tunicamycin not only
induces BiP, but that BiP can be co-immunoprecipitated with the newly
synthesized (unglycosylated and presumably malfolded) polypeptides present in the ER. More recent evidence suggests that
BiP and calreticulin form an abundant complex in the ER (Crofts et al.,
1998
). In tobacco (Nicotiana tabacum) and soybean
(Glycine max), BiP is encoded by a small gene family
(Denecke et al., 1991
; Kalinski et al., 1995
), whereas in Arabidopsis
there are only two BiP genes (Koizumi, 1996
). These early
investigations set the stage for all later work on the role of
chaperones in protein folding, protein assembly, and quality control in
the ER of plant cells (for review, see Vitale and Denecke,
1999
).
With respect to the UPR itself, there is almost no information
regarding plant cells. The floury-2 endosperm mutant of
maize (Zea mays) presents an interesting case of ER stress
in plants. This mutant produces an aberrant zein storage protein with a
defective signal peptide-processing site (Coleman et al., 1995
) and the seeds have dramatically increased levels of BiP and other chaperones (Boston et al., 1991
; Li and Larkins, 1996
; Coleman et al., 1997
; Gillikin et al., 1997
). This system was recently used to show that the
enzymes of lipid metabolism associated with the ER are up-regulated
(Shank et al., 2001
). Tunicamycin, which inhibits the synthesis of
dolichol-linked glycans (Takatsuki et al., 1975
), has been most widely
used to induce the UPR in plant cells. Overexpression of the gene
encoding the enzyme that is inhibited by tunicamycin makes plants less
sensitive to this antibiotic and obviates the UPR (Koizumi et al.,
1999
).
The role of BiP in ER stress was explored by Leborgne-Castel et al.
(1999)
who created lines of tobacco that overexpress BiP. They found
that overexpression from a transgene caused down-regulation of the
endogenous BiP genes and greatly reduced the UPR. They also observed
that tunicamycin down regulated the level of
-amylase, a secreted
protein, compared with a cytosolic protein. Co-expression of BiP
restored amylase synthesis, suggesting that there was insufficient BiP
to take care of the large increase in the demand for folding required
by the overexpressed
-amylase. Because this particular amylase is
not a glycosylated protein, the ER stress resulting from tunicamycin
treatment could be signaling through the PERK pathway. However, an
exhaustive search of the Arabidopsis database did not reveal any PERK homologs.
Here, we report the presence of two Ire1 homologs in the ER of
Arabidopsis cells. The derived amino acid sequences have the three
domains characteristic of Ire1 proteins found in other organisms: a
lumenal sensing domain, a protein kinase domain, and a ribonuclease domain. The two proteins share 41% amino acid identity. Introduction into
ire1 yeast cells of chimeric genes encoding the
lumenal domains of either of the Arabidopsis Ire1 proteins and the
other two domains of yeast Ire1 results in yeast strains that respond to tunicamycin by enhancing the expression of an introduced UPR element
(UPRE)-lacZ reporter construct. Analysis of plants
transformed with AtIre1 promoter-
-glucuronidase (GUS) fusions shows
that the two genes have nearly non-overlapping patterns of expression.
 |
RESULTS |
Accumulation of Chaperone mRNAs Is Induced by
Tunicamycin
Tunicamycin (5 µg mL
1) treatment of
immersed leaf segments causes rapid changes in ER chaperone mRNAs (Fig.
1). mRNAs of five chaperones (BiP, PDI,
calnexin, calreticulin-1, and calreticulin-2) increased rapidly upon
tunicamycin treatment. BiP mRNA was also induced by two chemical
stresses: azetidine-2-carboxylate and dithiothreitol (results not
shown). These results confirm and extend earlier work with plant
tissues, demonstrating the existence of the UPR in plants.

View larger version (38K):
[in this window]
[in a new window]
|
Figure 1.
Cooperative induction of mRNA of the ER chaperones
in Arabidopsis by tunicamycin. Total RNA was extracted from Arabidopsis
seedlings after addition of tunicamycin (5 µg
mL 1) to the culture medium. Incubation periods
after treatment were 0 h (Control), 1 h (Tm 1 h), and
2.5 h (Tm 2.5 h). The RNA blot was probed with the cDNAs of
BiP, PDI, calnexin, calreticulin-1, and calreticulin-2.
|
|
Cloning of the Arabidopsis Ire1 Homologs
Ire1p of yeast is a large transmembrane protein (1,115 amino
acids) with a three-domain structure: A large sensor domain is followed
by a protein kinase domain and a nuclease domain.
The sensor domain and the kinase domain are separated by a
transmembrane helix. Using the amino acid sequence of yeast Ire1p, we
conducted a search for homologs of this protein in the Arabidopsis database. We found two genomic sequences that, when translated, showed
considerable sequence identity with Ire1 proteins of other organisms.
We designated these genes AtIre1-1 and AtIre1-2. AtIre1-1 appeared to
be a complete coding frame in a long genomic sequence (accession no.
AB016884), but AtIre1-2 was only a partial sequence, at the end of a
BAC clone (accession no. B28768) when we found it. We amplified a
full-length cDNA of AtIre1-1 by reverse transcriptase (RT)-PCR. For
AtIre1-2, we first amplified a portion of the cDNA according to the
known sequence and then this fragment was used as a probe to screen a
cDNA library of Arabidopsis. The cDNA we obtained was almost full
length and in the meantime a complete genomic sequence for AtIre1-2 was
released (accession no. AC007584). This allowed us to isolate a
full-length cDNA for AtIre1-2 by RT-PCR using primers derived from the
genomic sequence. The sequences of the AtIre1-1 and AtIre1-2 cDNAs that
we obtained did not match the predicted coding sequences found in the
database because the predictions of some of the intron splicing sites
were incorrect. In the case of AtIre1-1, the first intron was not
detected by computer analysis. For AtIre1-2, the C-terminal portion of
the protein, encoding the kinase and RNase domains, was predicted as a
protein. The correct nucleotide sequences of AtIre1-1 and AtIre1-2 have
been deposited in the database (accession nos. AB049936 and AB049937,
respectively). The derived amino acid sequences of the two proteins are
shown in Figure 2.

View larger version (90K):
[in this window]
[in a new window]
|
Figure 2.
Alignment of Ire1 homologs from various organisms.
Two Arabidopsis homologs (AtIre1-1 and AtIre1-2; this study), yeast
Ire1p (Ire1p, accession no. Z11701), human Ire1 (hIre1 , accession
no. AF059198), and mouse Ire1 (mIre1 , accession no. AF071777)
were aligned using ClustalW software. Amino acid residues conserved in
three out of five sequences are boxed. The ATP binding motif (VAVKR)
and the Ser/Thr protein kinase motif (DLKPQN) are underlined.
|
|
A comparison of the cDNA and genomic nucleotide sequences showed that
AtIre1-1 and AtIre1-2 have five and six introns, respectively. The
splice sites are conserved between the two genes except that the last
intron of AtIre1-2 is missing from AtIre1-1. A genomic Southern
analysis was carried out using gene-specific probes for each gene (Fig.
3A). A single band in each restriction
digest indicated that AtIre1-1 and AtIre1-2 exist as a single copy in the genome of Arabidopsis.

View larger version (58K):
[in this window]
[in a new window]
|
Figure 3.
A, Genomic Southern analysis of AtIre1-1 and
AtIre1-2. Genomic DNA of Arabidopsis digested with two restriction
enzymes was fractionated by agarose gel, blotted, and probed with a
fragment of either AtIre1-1 or AtIre1-2 cDNA. B, mRNA abundance
analysis of AtIre1-1, AtIre1-2, and BiP. Poly(A+)
RNA was isolated from Arabidopsis seedlings with no treatment or
treated with tunicamycin (5 µg mL 1 for 4 h). Two micrograms of RNA sample from each treatment was used for
northern blotting. Probes used were same as in A for AtIre1-1 and
AtIre1-2. BiP probe was the same as in Figure 1.
|
|
Characteristics of the Amino Acid Sequences
AtIre1-1 and AtIre1-2 encode open reading frames of 881 and 841 amino acids, respectively. Although the polypeptides are smaller than
those of human (977 amino acids) and yeast (1,115 amino acids), the
derived Arabidopsis amino acid sequences revealed the structural features of yeast and mammalian Ire1 proteins. Namely, they have short
hydrophobic regions at the N-terminal end and near the middle of the
proteins, representing the likely signal peptides and transmembrane domains. Following the putative transmembrane domain, they contain kinase and RNase domains. These two C-terminal domains have
significant sequence identity with the homologous domains of other Ire1
proteins (30%-40%). The kinase domain has a critical Lys residue in
the conserved VAVKR domain and the signature sequence of Ser/Thr
kinases (DLKPEN) is represented as DLKPQN (underlined in Fig. 2). The N-terminal regions representing the likely sensor domains are much less
conserved among the different homologs (<10%). Comparing AtIre1-1
with AtIre1-2, the C-terminal domains also have a higher sequence
identity (65%) than the N-terminal regions (28%).
Expression of the AtIre Genes
To detect transcripts of AtIre1-1 and AtIre1-2, a northern-blot
analysis was done. Using total RNA, we were never able to detect any
signals. Therefore, we isolated poly(A+) RNA for
a northern blot, and in this way we detected weak signals for AtIre1-1
and AtIre1-2 (Fig. 3B). A search in the Arabidopsis expressed sequence
tag (EST) database did not produce any ESTs for AtIre1-1 or AtIre1-2,
but in August 2000, a single EST of AtIre1-2 was reported in developing
seeds and added to the database with our annotation. Together, these
results indicate that expression levels of the AtIre1 genes are very
low in Arabidopsis. Unlike BiP, which is highly induced by tunicamycin,
the levels of the AtIre transcripts were not changed by tunicamycin treatment.
AtIre1-2 Has Protein Kinase Activity
Ire1p of yeast and its mammalian homologs have
autophosphorylation activity in vitro. To determine if AtIre1 has
protein kinase activity, we expressed in Escherichia coli a
fusion polypeptide consisting of glutathione S-transferase
(GST) and the C-terminal half of AtIre1-2 containing the protein kinase
and ribonuclease domains. A second construct carried a K442A mutation
in which Lys-442 was mutated to Ala (see Fig.
4). This mutation inactivates the
enzymatic activity of other protein kinases. We purified the recombinant protein on a glutathione affinity column and obtained a
single band of 73 to 75 kD on a Coomassie Brilliant Blue-stained gel.
This band reacted with an anti-GST serum and its molecular size was
consistent with that of the fusion protein. Incubation with
32P-labeled ATP resulted in the labeling of the
same polypeptide as was identified by the GST antiserum. The GST fusion
polypeptide was not labeled with 32P in the K442A
mutant. We suggest on the basis of this experiment that AtIre1-2 is a
trans-phosphorylating protein kinase similar to other receptor
kinases.

View larger version (82K):
[in this window]
[in a new window]
|
Figure 4.
A and B, Autophosphorylation activity of the
C-terminal domain of AtIre1-2. A, Domain structure of Ire1 (top) and of
the GST fusions showing the location of the K to A mutation. B, The
fusion protein of GST with the C-terminal domain of AtIre1-2 was
expressed in E. coli and affinity purified on
glutathione-Sepharose. Purified protein incubated with
-32P ATP was subjected to SDS-PAGE. The gel
was Coomassie stained (CBB) and exposed to x-ray film (autoradiogram).
The same fraction was used for an immunoblot analysis with anti-GST
antibody (anti-GST). In A and B, lane 1 has the wild-type GST-AtIre1-2
fusion and lane 2 has the mutant GST-AtIre1-2 fusion. There is no
32P labeling of the fusion polypeptide of the
mutant (lane 2 in the autoradiogram).
|
|
Subcellular Localization of AtIre1-Green Fluorescent Protein (GFP)
Fusions
To determine the subcellular location of AtIre1, we made
translational fusions with the GFP and expressed these constructs in
cultured tobacco cells (BY-2 cells). As controls, we used GFP by itself
and a construct in which GFP has a signal peptide and a carboxyterminal
ER retention motif (Lys-Asp-Glu-Leu or KDEL). The expression of all
constructs was driven by the cauliflower mosaic virus (CaMV) 35S
promoter. The cells were examined by fluorescence microscopy. In cells
expressing GFP alone (Fig. 5, A and B),
the entire cytoplasm but not the vacuoles is diffusely labeled and the
nucleus appears bright green, indicating that GFP enters the nucleus
readily. Figure 5, C and D, show the results with the GFP-KDEL
construct. Fluorescence is seen in the perinuclear zone, in cytoplasmic
strands, and in the newly formed cross walls (possibly associated with
plasmodesmata), but not in the nucleoplasm. In cells transformed with
the AtIre1-1-GFP construct (Fig. 5, E and F) the fluorescence is
confined to the perinuclear area. Figure 5G shows that the location of
AtIre1-2-GFP is similar to that of AtIre1-1-GFP. Figure 5H is an image
of a cell transformed with the mutant K442A AtIre1-2-GFP construct. The
parallel construct of AtIre1-1-GFP (K487A) showed the same localization
(data not shown). This mutation produces a nonfunctional protein, and
the transformed cells invariably show brighter fluorescence. Treatment of cells with brefeldin A (10 µg mL
1 for 90 min), which causes redistribution of Golgi proteins (Staehelin and
Driouich, 1997
), did not change the distribution of the AtIre1 proteins
(data not shown). A similar treatment with brefeldin A caused the
redistribution of a GFP fusion with the Golgi marker enzyme
-mannosidase I (data not shown). These results rule out the Golgi as
the location of the AtIre1 proteins.

View larger version (60K):
[in this window]
[in a new window]
|
Figure 5.
Localization of AtIre1-1-GFP and AtIre1-2-GFP
fusion proteins by fluorescence microscopy. Epifluorescence images of
tobacco BY-2 cells (A-H), and purified nuclei from tobacco BY-2 cells
(i-l). A, B, and i, BY-2 cells express normal GFP. Note green
fluorescence in the nucleoplasm. C, D, and j, BY-2 cells expressing
GFP-KDEL. Note absence of fluorescence in the nucleoplasm. E, F, and k,
BY-2 cells expressing AtIre1-1-GFP. G and l, Cells expressing
AtIre1-2-GFP. H, BY-2 cell expressing the AtIre1-2(K442A)-GFP.
Bars = 0.01 mm.
|
|
Figure 5, i through l, are of isolated nuclei from cells expressing GFP
alone (Fig. 5i), GFP-KDEL (Fig. 5j), the AtIre1-1-GFP construct (Fig.
5k), and the AtIre1-2-GFP construct (Fig. 5l). The nucleoplasm is
labeled in Figure 5i, indicating that GFP itself stays in the nucleus
during nuclear isolation (NI). Together, these data support the
interpretation that AtIre1-1 and AtIre1-2 are located in the nuclear
envelope and/or the ER that is in close proximity to the nucleus.
The N-Terminal Regions of AtIre1-1 and AtIre1-2 Function as
Sensors
Although the amino acid sequences of the N-terminal region of
AtIre1-1 and AtIre1-2 are very dissimilar from that of yeast Ire1p, we
investigated whether these regions can function as sensors of stress in
yeast cells. To test this possibility, we made chimeric genes of the
N-terminal domains of AtIre1-1 and AtIre1-2, and the C-terminal domains
of yeast Ire1p. The N-terminal domain of yeast Ire1p, except the signal
peptide, was replaced with the N-terminal domain of either AtIre1-1 or
AtIre1-2 (see Fig. 6A). These constructs
were introduced into a yeast
ire1 mutant, using a
single-copy (ARS and CEN) plasmid vector pRS313 (Sikorski et al.,
1989
). As a positive control, pRS313-carrying yeast IRE1 was
used. The various yeast transformants were grown on synthetic dextrose
plates without or with tunicamycin (0.2 µg mL
1). Growth
of the yeast
ire1 mutant containing the empty vector was
severely inhibited by tunicamycin. This inhibition of growth was
rescued by transformation with yeast IRE1. Growth inhibition was also rescued with the two chimeric constructs Atire1-ch and Atire2-ch (Fig. 6B). To confirm that the UPR was induced when the yeast
cells were subjected to ER stress, we measured the expression of
-galactosidase driven by a 22-bp UPRE of the yeast BiP gene (KAR2) promoter. In the yeast
ire1 mutant
transformed with empty vector only, the induction of
-galactosidase
was not observed upon treatment with either tunicamycin or
dithiothreitol. Yeast
ire1 cells complemented with yeast
IRE1 showed the expected response to these stresses. In
yeast
ire1 cells transformed with the chimeric constructs, the chemical stresses also induced the accumulation of the
enzyme (Fig. 5C). These results indicate that the N-terminal domains of
the Arabidopsis Ire1-1 and Ire1-2 proteins can act as ER stress sensors
in yeast.

View larger version (42K):
[in this window]
[in a new window]
|
Figure 6.
A through C, Complementation of yeast
ire1 deletion mutant with chimeric constructs of yeast Ire1p
and Arabidopsis Ire1 homologs. A, Schematic view of the chimeric
constructs used for yeast complementation. Chimeric constructs
consisted of the sensor domains of AtIre1-1 or AtIre1-2, and other
parts (signal peptide and C-terminal half) of yeast Ire1p. B, Growth of
ire1 strains of yeast complemented with chimeric
constructs in the absence or presence of tunicamycin.
ire1 containing vector only (vector), chimeric constructs
for AtIre1-1 (Atire1-ch) and AtIre1-2 (Atire2-ch), and yeast
IRE1 were grown on synthetic dextrose plates without
tunicamycin ( Tunicamycin) and with tunicamycin (+Tunicamycin, final
concentration at 0.2 µg mL 1). Approximately
1 × 105 cells were spotted on the left
column of each plate. Series of one-tenth dilution of cells were
spotted on the right side. Yeast cells were grown for 3 d at
30°C. C, Activity of -galactosidase of yeast cells containing each
construct. Cells were incubated at 30°C with 2 µg
mL 1 tunicamycin for 4 h, or 1 mM dithiothreitol for 2 h, and their
-galactosidase activity was measured.
|
|
AtIre1-1 and AtIre1-2 Have Nonoverlapping Expression
Patterns
We made AtIre1 promoter::GUS fusions for both genes and
examined their expression in Arabidopsis. GUS activity was found to be
very low, in agreement with the finding that there were very few
accessions of Ire-1 genes in the EST databases. The 1,996-bp promoter
of AtIre1-1 drives GUS expression in the apical meristem (Fig.
7, A and B), at leaf margins where
vascular bundles end (Fig. 7C) in the anthers before pollen is formed
(Fig. 7D), and in the ovules at a very early stage of development (Fig.
7, E and F). There is no expression in more mature embryos. AtIre1-1 is
also strongly expressed in the cotyledons immediately after germination
(inset in the upper right hand corner of Fig. 7A) but not later on
(Fig. 7A). Thus, the expression of AtIre1-1 in the plant is
extremely restricted to certain tissues at specific developmental
times. The 1,994-bp promoter of AtIre1-2 drives expression of GUS in
the vascular bundles of young plants (Fig. 7G), leaves (Fig. 7, G and
H), in roots (inset in Fig. 7G), seedlings (Fig. 7J), and in the
receptacles of flowers and vascular bundles of the petals (Fig. 7K).
This gene appears to be more widely expressed than AtIre1-1, but it is
clearly not generally expressed throughout the plant.

View larger version (121K):
[in this window]
[in a new window]
|
Figure 7.
A through K, Histochemical staining of GUS of
Arabidopsis plants transformed with AtIre1-promoter::GUS
fusions. A through F, AtIre1-1 and G-K: AtIre1-2. A and B, Seedlings
with fully expanded cotyledons (note staining of the meristems); A
inset, 48-h-old seedling with stained cotyledons; C, leaf margin; D,
flower with immature anthers; E, flower after pollination, only the
gynecium is stained and anthers are not longer stained; F. ovules; G,
seedling; G inset, root tip; H and I, rosette leaf; J, seedling; K,
flowers.
|
|
 |
DISCUSSION |
In this report, we show that the genes of five different ER
chaperones are induced during the UPR in Arabidopsis and we present the
molecular characteristics of two ER-located transmembrane protein
kinases, AtIre1-1 and AtIre1-2, whose homologs are involved in UPR
signaling in other organisms; the two AtIre1 homologs have nearly
nonoverlapping expression patterns. One of the two proteins is shown to
function as a protein kinase (the other one was not tested) and the
sensor domains of the proteins function in sensing unfolded proteins in
yeast. It remains to be demonstrated that the two proteins are involved
in the UPR of plant cells.
The UPR in Plant Cells
In the most recent major review on the functions of the ER in
plant cells (Vitale and Denecke, 1999
), no mention is made of the UPR,
although ER quality control is discussed in detail. This omission is
simply a reflection of the fact that there have been no systematic
studies of the UPR in plants, although it was shown some years ago that
tunicamycin increases the level of BiP mRNA and protein. In Figure 1,
we show that 5 different ER-located chaperones are induced by
tunicamycin. Plants, we conclude, behave similarly to other eukaryotes
with respect to this important cellular process (Kaufman, 1999
; Mori,
2000
). This is not surprising, because the UPR is thought to control
many essential aspects of ER function, not only those that relate to
protein import, processing, and export (Travers et al., 2000
).
Furthermore, unfolded proteins are constantly being delivered to the ER
of all cells, and these proteins must be either folded and assembled,
or exported for degradation. Tunicamycin prevents protein folding by
inhibiting the synthesis of high-Man glycans in the ER. In a similar
manner, dithiothreitol can prevent protein folding by inhibiting
disulfide bond formation, and this chemical has been shown
to increase the levels of mRNA for two chaperones, BiP and PDI (Denecke
et al., 1995
). Nelson et al. (1997)
did not find up-regulation of
calreticulin mRNA after heat shock, but it is not clear to what extent
the treatment interfered with protein folding. A related type of ER stress in maize endosperm, caused by the presence of an excessive amount of zein polypeptides with uncleaved signal peptides, has been
shown to be accompanied by the up-regulation of calnexin, BiP, and PDI
(Fontes et al., 1991
; Li and Larkins, 1996
; Wrobel, 1996
). It is more
than likely that the zein polypeptides are in an unfolded state in the
ER of these cells.
The Arabidopsis Ire1 Proteins
Homologs of yeast IRE1 have been identified in several
other eukaryotic species including Drosophila melanogaster,
Cenorhabditis elegans, human, and mouse. Alignment of the derived
amino acid sequences shows that the most conserved features of the
proteins are the kinase and ribonuclease domains. The two Arabidopsis
Ire1 proteins are somewhat smaller than the yeast protein but contain the same three domains, with greater sequence identity in the two
enzymatic domains compared with the putative sensor domain. Each
protein species is encoded by a unique gene. In mice and humans, two
IRE-1 proteins, each encoded by a different gene, have so far been
identified. The gene encoding AtIre1-1 is located on chromosome 5 (Bac
K16H17), whereas the gene encoding AtIre1-2 is on chromosome 2 (Bac
mjb20). The translation product from this gene is incorrectly annotated
in the database as the putative protein comprises only the
carboxyterminal half of AtIre1-2 and does not include the transmembrane
and sensor domains.
AtIre1-GFP Fusion Proteins Are Located in the Perinuclear
ER
The results presented in Figure 5 are consistent with a
localization of the AtIre1-GFP fusion proteins in the perinuclear ER.
The fluorescence obtained with the AtIre1-GFP constructs was much less
than that obtained with GFP alone or GFP-KDEL. This lower fluorescence
may be the result of the property of the Ire1 to regulate its own
expression at the level of mRNA (Tirasophon et al., 1998
). Localization
of Ire1 in the ER of yeast cells was first postulated by Cox et al.
(1993)
and by Mori et al. (1993)
on the basis of the molecular
properties of the Ire1 proteins: a signal peptide, a transmembrane
domain, and high-Man glycans. Light microscopy analysis of COS1 cells
transfected with epitope-tagged mouse Ire1 shows colocalization with
the ER marker ribophorin 2 (Wang et al., 1998
). The clearer confocal
images in the study of Tirasophon et al. (1998)
show a perinuclear
localization for human Ire1 transfected into COS1 cells, very much like
the images shown in Figure 5. Brefeldin A at 5 mg
mL
1 did not alter the distribution of fusion
proteins in the cells, although it caused, as expected, a
redistribution of the soybean Golgi marker
-mannosidase I (data not
shown). We conclude that AtIre1 is present in the nuclear envelope and
in the ER immediately adjacent to the nucleus. Deletion of the
ribonuclease domains (data not shown) and a single amino acid mutation
in the kinase domain that prevented kinase activity did not alter the
observed subcellular distribution of the fusion protein. So far, all
studies have been done with overexpressed Ire1 proteins and we cannot rule out the possibility that endogenous Ire1 is confined to the nuclear envelope itself. Upon induction of the UPR in mammalian cells,
human Ire1 is proteolytically cleaved, and fragments containing the
kinase and nuclease domains accumulate in the nucleus (Niwa et al.,
1999
). It may be relevant in this respect that both AtIre1 proteins
have putative nuclear localization signals at the N-terminal end of
this combined enzymatic domain (KKKKSKK in AtIre1-1 and KKKKNRK in
AtIre1-2).
AtIre1-2 Is an Autophosphorylating Protein Kinase
Ire1 proteins are transmembrane receptor protein kinases that
oligomerize when BiP is detached from the receptor domain (Bertolotti et al., 2000
; Okamura et al., 2000
). Oligomerization then leads to
trans-autophosphorylation of the cytoplasmic effector domains (Shamu
and Walter, 1996
; Bertolotti et al., 2000
). BiP thus serves as an
inhibitory ligand for these receptor kinases, which mechanistically are
similar to other transmembrane protein kinase receptors. AtIre1-1 and
ArIre1-2 have a DLKPQN motif that closely resembles the consensus motif
for Ser/Thr kinases (DLKPEN; Lindberg et al., 1992
). Incubation of the
purified GST fusion protein with 32P-ATP resulted
in the phosphorylation of the fusion protein. Lys-442 is contained in a
motif (VAVKR) conserved in all protein kinases that contacts the
-
and
-phosphates of ATP and is essential for catalysis. Mutation of
this Lys residue (K442A) resulted in the inactivation of the protein
kinase. This result confirms that the phosphorylation of the
AtIre1-2-GST fusion protein was caused by the intrinsic kinase activity
of the protein and not due to a contaminating kinase. Using a yeast
two-hybrid system, Welihinda and Kaufman (1996)
demonstrated that yeast
Ire1p forms oligomers and that oligomer formation is a prerequisite for
activation of the kinase. Whereas we do not show that oligomer
formation is required for kinase activity, GST is known to form dimers
in nature, and the phosphorylation results described here with the
chimeric protein parallel those observed with yeast Ire1p. It is
therefore likely that AtIre1 proteins also form dimers in vivo.
Sensing Unfolded Proteins
The AtIre1 amino acid sequences we describe here have the typical
tripartite structure of other eukaryotic Ire1 proteins. The N-terminal
lumenal domain is thought to be the sensor domain of the protein. To
demonstrate this function, several studies have relied on the
expression of a chimeric gene in an
ire1 strain of yeast
that harbors a single copy of the lacZ gene under the control of the UPR element of the yeast BiP gene (KAR2).
Accumulation of
-galactosidase after treatment with tunicamycin is
then a convenient way to measure the UPR. Liu et al. (2000)
showed that the N-terminal domains of human, mouse, and C. elegans Ire1
linked to the transmembrane and C-terminal portions of yeast IRE1 could drive
-galactosidase expression in a
ire1 yeast strain
treated with tunicamycin. Our results (Fig. 5) similarly show that the sensor domains of AtIre1-1 and AtIre1-2 in chimeric constructs with the
C-terminal portion of yeast IRE1, induce
-galactosidase when the complemented
ire1 strain is treated with
tunicamycin. A similar approach was used by Bertolotti et al. (2000)
to
show the functional equivalence of the lumenal domains of the mammalian Ire1p and PERK transmembrane protein kinases.
But how does Ire1 sense the presence of unfolded proteins in the ER?
Indirect observations suggest that unfolded proteins are not sensed
directly, but indirectly through the level of free BiP. For example,
cells that overexpress Kar2p/BiP respond less well to ER stress (Dorner
et al., 1992
; Kohno et al., 1993
). In mammalian cells, BiP was found to
be associated with both IRE1 and PERK (Bertolotti et al., 2000
), the
two proteins involved in sensing ER stress. Recent experiments show
that in yeast, in the absence of stress, BiP/Kar2p binds to the lumenal
domain of Ire1p and keeps this protein in an inactive unphosphorylated
state. Stress results in the release of BiP/Kar2p from Ire1p and
activation of Ire1p and the UPR pathway (Okamura et al., 2000
). In
tobacco, overexpression of BiP also alleviates ER stress
(Leborgne-Castel et al., 1999
); therefore, a similar regulation
mechanism might be conserved in plants.
What Is the Function of the Two AtIre1 Genes?
Like humans, Arabidopsis has two putative AtIre1 genes,
although yeast has only one. The yeast UPR is a linear pathway, but the
mammalian UPR is more complex with diversity of downstream signals
(Urano et al., 2000a
). When overexpressed, either mammalian gene (human
Ire1
or mouse Ire1
) can activate the BiP promoter, as does
overexpression of the yeast gene in yeast, suggesting that this portion
of the role of Ire1 is conserved between yeast and mammals (Tirasophon
et al., 1998
; Wang et al., 1998
). We were unable to overexpress the
AtIre1 genes in Arabidopsis. That is, when plants transformed with a
CaMV35S::AtIre1-1 or AtIre1-2 were tested they were found to
have normal levels of AtIre1 transcripts. BiP genes were not
overexpressed in those plants. We postulate that the gene product
down-regulates the expression of the introduced genes. The two genes
are differentially expressed in Arabidopsis. In mammals also, Ire1
(Tirasophon et al., 1998
) is ubiquitously expressed, whereas Ire1
is
expressed only in gastrointestinal epithelial cells (Urano et al.,
2000b
).
In this study, we dealt primarily with that aspect of the UPR that
concerns the induction of chaperones. However, the UPR has two
components: up-regulation of chaperone genes and attenuation of
translation. In mammalian cells, the attenuation of protein synthesis
in response to ER stress in mediated by the protein PERK, another ER
stress sensor protein (Harding et al., 2000
). An exhaustive search of
the Arabidopsis database did not reveal any PERK homologs. Iwawaki et
al. (2001)
recently found that in human cells IRE1
signals the
attenuation of protein synthesis during ER stress. Whether in plants
the Ire1 proteins signal an attenuation of protein synthesis remains to
be examined. It is also possible that in the course of evolution these
ER-located protein kinases assumed an entirely different function,
unrelated to the UPR.
 |
MATERIALS AND METHODS |
Plant Material
Sterile seeds of Arabidopsis (ecotype Columbia) were germinated
in one-half-strength Murashige and Skoog medium containing 1% (w/v)
Suc and further cultured in the light/dark cycle of 16 h of light
and 8 h of darkness with gentle shaking. Two-week-old plantlets
were treated with tunicamycin, which was added to the culture medium at
final concentration of 5 µg mL
1. Non-sterile seeds
growing in soil for 4 weeks were used for stable transformations.
The tobacco (Nicotiana tabacum) cell line
BY-2 was used in stable transformation assays for heterologous
expression of chimeric AtIre1-GFP fusion proteins. The BY-2 cells were
maintained and subcultured by 1:30 dilution in growth medium (Murashige
and Skoog salts medium at pH 5.7 supplemented with 3% [w/v] Suc,
0.1 g L
1 myoinositol, 1 mg L
1
thiamine, 0.18 g L
1 KH2PO4,
2 µM 2,4-dichlorophenoxyacetic acid, and suitable
antibiotic) at 24°C in darkness and shaken at 113 rpm.
RNA Preparation and Northern Analysis
For northern analysis, total RNA was isolated (Koizumi et al.,
1999
), fractionated by agarose gel electrophoresis, and transferred to
a nylon membrane. The membrane was probed with
32P-labeled cDNAs of BiP (Koizumi, 1996
), PDI, calnexin
(Huang et al., 1993
), and calreticulin-1 and -2 (Nelson et al., 1997
).
cDNAs of calnexin and PDI were amplified by RT-PCR with
primers CN-1 (ATGAGACAACGGCAACTATTTTCC) and CN-2
(AAGACAAAAATTTCTCAAACTTGG), and primer PDI-1 (CTCGTGAAGCTGAGGGTATTG)
and PDI-2 (AAGATTGGAGCAAGCTTTGG), respectively. Calreticulin cDNAs was
a generous gift of Dr. Donald E. Nelson (University of Arizona,
Tucson). Hybridization was carried out as described previously (Koizumi
et al., 1999
). For detection of Ire1 homologs, poly(A+) RNA
was prepared using PolyATtract mRNA isolation system (Promega Corporation, Madison, WI) according to the manufacturer's
instructions, and subjected to northern analysis.
Isolation of Promoters and cDNAs Encoding Ire1 Homologs
To isolate the full coding region of AtIre1-1 cDNA, RT-PCR was
carried out with primer 1-a (AAAGCGATGAGAGGATCTGC) and primer 1-b
(GAAGAAAAGAATCCTAGAATACAGTGG). A specific PCR product, approximately 3 kb in length, was cloned into the plasmid vector pCR 2.1-TOPO (Invitrogen, Carlsbad, CA). For AtIre1-2, RT-PCR was carried out using
primer 2-a (CGTTTGTTAAACCCACACCC) and 2-b (TGAACTTGAATTTCCGGAGG) to
amplify an approximately 0.4-kb fragment. This fragment was used as a
probe to screen a cDNA library constructed in HybirZAP-2.1 (Stratagene,
La Jolla, CA), and nearly full-length cDNA was isolated. Finally,
primer 2-c (ATGCCGCCGAGATGTCCTTTCC) and 2-b were used to amplify a
full-length cDNA encoding AtIre1-2. This PCR product was also cloned
into pCR 2.1-TOPO vector. Nucleotide sequences of both cDNAs were
determined by DNA sequencing using synthetic primers.
AtIre1 promoters were amplified by PCR using forward primers at
positions
1,996 bp for AtIre1-1 and
1,994 bp for AtIre1-2 and
reverse primers at the initiation codon of both genes. PCR products
were cloned into the plasmid pCR2.1-TOPO (Invitrogen). DNA sequences
were confirmed. To make transcriptional fusions with GUS gene, the 35S
promoter of pBl121 was substituted by either AtiIre1-1 promoter (vector
called pbinAtIre1-1p::GUS) or AtIre1-2 promoter (vector
called pbinAtIre1-2p::GUS).
To make the fusions with GFP, AtIre1-1, AtIre1-1(K487A), AtIre1-2, and
AtIre1-2(K442A) cDNAs were translationally fused to the 5' end of GFP
by recombinant PCR. The GFP gene was a gift of Dr. Yasuo Niwa
(University of Shizuoka, Japan; Chiu et al., 1996
). Amplified
transgenes and control of the GFP gene alone were introduced into the
pCR2.1-TOPO. All constructs were confirmed by DNA sequencing.
For stable expression in BY2 cells, the
SpeI/XhoI restriction fragment from the
pCR2.1 constructs carrying the GFP gene by itself, the
AtIre1-1::GFP and the AtIre1-1(K487A)::GFP
transgenes, and the AvrII/XhoI
restriction fragments from the AtIre1-2::GFP and the
AtIre1-2(K442A)::GFP transgenes were inserted in the plant expression vector pIG121-Hm (a gift from Kenzo Nakamura, Nagoya University, Japan) by substitution of the
XbaI/XhoI fragment. This expression
vector contains the CaMV 35S promoter and the nos
3'-polyadenylation tail in an expression cassette that permits two
selection options: hygromycin and kanamycin. The GFP-KDEL gene
containing plasmid, pER-GFP, was provided by Dr. Dolors Ludevid (Consejo Superior de Investigaciones Cientificas, Barcelona), and the
BY-2 cells expressing the soybean (Glycine max)
-1-2 mannosidase I-GFP Golgi marker was provided by Dr. Andrew Staehelin (University of Colorado, Boulder).
Genomic Southern Analysis
A part of AtIre1-1 encoding C-terminal portion amplified with
primer 1-c (CGAGAGCACAAGATGTTATGC) and primer 1-b was used as a probe
to detect AtIre1-1. For AtIre1-2, the PCR fragment obtained with primer
2-a and 2-b was used as well. Genomic DNA of Arabidopsis was prepared
as described previously (Koizumi et al., 1999
), digested with
appropriate restriction enzymes, and subjected to Southern hybridization using the probes mentioned above.
Transformation Procedures
To generate transgenic BY-2 cells expressing the
GFP fusions, all the GFP constructs were transferred to
Agrobacterium tumefaciens AGL-O following the method
described by Lazo et al. (1991)
. Absorbance (0.9) of an overnight
A. tumefaciens culture was used to transform 5 mL of a
4-d-old BY-2 cell culture previously diluted once in fresh growth
medium. After 2 d of incubation at 26°C in darkness, BY-2 cells
were washed five times with growth medium containing 100 mg
L
1 kanamycin and 500 mg L
1 carbenicillin.
Cells were plated in presence of kanamycin and carbenicillin at the
same concentrations and incubated in darkness at 26°C. Calli
resistant to kanamycin formed after 3 weeks of selection and were then
moved to fresh plates monthly. Callus cells were resuspended in fresh
growth medium before examination with an epifluorescence microscope.
Transgenic Arabidopsis plants expressing GUS protein under the
regulation of either of the AtIre1 promoters were produced by
infiltration (Clough and Bent, 1998
) in 200 mL of A.
tumefaciens AGL-O containing the binary vector
pbinAtIre1-1p::GUS or pbinAtIre1-2p::GUS. Seeds
from infiltrated plants were collected and the seedlings selected on kanamycin.
Isolation of Nuclei
BY-2 protoplasts were prepared from 2-week-old calli. BY-2 cells
were incubated with growth medium plus 5.41% (w/v) betaine, 1% (w/v)
cellulase, 0.5% (w/v) macerozyme, and 0.1% (w/v) bovine serum albumin
Fraction V for 5 h at 26°C in darkness. Protoplasts were
sedimented at 50 g during 4 min and washed twice with
growth medium with betaine. The pellet was resuspended in NI buffer
supplemented with the following protease inhibitors: 0.4 mM
phenylmethylsulfonyl fluoride, 5 µg mL
1 aprotinin, 5 µg mL
1 pepstatin A, and 5 µg mL
1
leupeptin. The NI buffer contains 10 mM MES
[2-(N-morpholino)-ethanesulfonic acid], 0.2 M Suc, 10 mM NaCl, 10 mM KCl, 2.5 mM EDTA, 2.5 mM dithiothreitol, 0.1 mM Spermine, and 0.5 mM Spermidine. Protoplasts
were disrupted by six passages through a 21-gauge needle on ice. The
released nuclei were concentrated on a Percoll step gradient prepared
in NI buffer and containing layers of 50% (w/v) Percoll, 7% (v/v) Percoll, and sample. The gradient was centrifuged for 10 min at 100g at 4°C. Purified nuclei at the 50% to 7% (v/v)
Percoll interface were washed three times by a one-tenth dilution with
NI buffer plus 20% (v/v) glycerol. Nuclei were resuspended in fresh NI
buffer/glycerol before examination in the epifluorescence microscope.
In Vitro Kinase Assay
A part of AtIre1-2, amplified with primer 2-d
(GAATTCAAAAAGTTTTCGTCGAGGGG) and primer 2-e
(CTCGAGTTAGATGATGTCCCATTTGAAG), was subcloned in pGEX-2T
(Amersham-Pharmacia Biotech, Uppsala) with EcoRI and
XhoI, yielding a plasmid harboring a fusion protein of
GST and the C terminal portion of AtIre1-2 (GST-AtIre2). At the same
time, a mutant construct in which Lys-442 was converted to Ala
(GST-AtIre2-M) was also made. These plasmids were introduced in
Escherichia coli (BL21) and the fusion proteins were
induced by addition of IPTG. The fusion proteins were purified with
glutathione-Sepharose beads as described previously (Ikeda et al.,
1999
). Approximately 50 ng of purified proteins were incubated with 0.1 µCi of [32P]ATP in kinase buffer containing 20 mM sodium phosphate (pH 8.0) and 10 mM
MgCl2 in a final volume of 20 µL at 37°C for 10 min. The reaction product was fractionated by SDS-PAGE and subjected to autoradiography.
Complementation of Yeast (Saccharomyces cerevisiae)
ire1 Mutants
The
ire1 yeast strain KMY1515 (MAT
ura3-52 leu2-3, 112 his3-
200 trp1-
901
ire1::TRP1
lys2-801::LYS2-UPRE- CYC1-lacZ;
Okamura et al., 2000
) was transformed with the following plasmids.
pRS313, a yeast centromeric plasmid vector (Sikorski and Hieter, 1989
), and pR313-IRE1 (Okamura et al., 2000
), which contains the yeast IRE1 gene, were used as a negative and a positive
control, respectively. To make chimeric constructs, an
EcoRI site was introduced after the nucleotide sequence
encoding the signal peptide (after Arg-31) and a BamHI
site was introduced before the sequence for the transmembrane domain
(before Glu-521) of pR313-IRE1. The nucleotide sequences encoding the
sensor domain of AtIre1-1 or AtIre1-2 were amplified with primer 1-d
(GAATTCGGATCTGAAATCTCCAAGTCC) and 1-e (GGATCCGCTAGCAAAGCCTGCCTGTTTCG) or primer 2-f (GAATTCGGCGGCGCTGCCGACGTAG) and 2-g
(GGATCCTCCAAACAAATATGTATATTTCTGC) and replaced with that of yeast Ire1
using EcoRI and BamHI sites obtaining
Atire1-ch or Atire2-ch. KMY1515 cells transformed with either of these
plasmids were incubated in synthetic dextrose medium (Kaiser et al.,
1994
) supplemented with uracil (100 mg L
1) and His (50 mg
L
1) at 30°C with or without tunicamycin. Cells were
also used for
-galactosidase activity assays according to Kaiser et
al. (1994)
.
Histochemical Staining
Whole transgenic seedlings or organs were treated for 20 min in
cold 90% (v/v) acetone, then washed once with GUS buffer (25 mM sodium phosphate buffer, pH 7, 0.5 mM
KFe(CN)2, 0.5 mM KFe(CN)3, and 10 mM EDTA), and incubated overnight with 2 mM
5-bromo-4-chloro-3-indolyl
-D-glucuronide in GUS buffer
at 37°C in the dark. The GUS staining solution was removed, and the
tissues were dehydrated by increasing the ethanol concentrations
gradually from 70% (v/v) to absolute ethanol. Samples where visualized
in the light microscope.
Received July 18, 2001; returned for revision July 27, 2001; accepted August 16, 2001.
Article, publication date, and citation information can be found at
www.plantphysiol.org/cgi/doi/10.1104/pp.010636.