|
Plant Physiol, December 2001, Vol. 127, pp. 1579-1589
A Physical Amplified Fragment-Length Polymorphism Map of
Arabidopsis
Janny L.
Peters,1 *
Hans
Constandt,
Pia
Neyt,
Gerda
Cnops,
Jan
Zethof,
Marc
Zabeau, and
Tom
Gerats1
Flanders Interuniversity Institute for Biotechnology, University of
Ghent, Department of Plant Genetics, K.L. Ledeganckstraat 35, 9000 Ghent, Belgium
 |
ABSTRACT |
We have positioned amplified fragment-length polymorphism (AFLP)
markers directly on the genome sequence of a complex organism, Arabidopsis, by combining gel-based AFLP analysis with in silico restriction fragment analysis using the published genome sequence. For
placement of the markers, we used information on restriction fragment size, four selective nucleotides, and the rough genetic position of the markers as deduced from the analysis of a limited number of Columbia (Col)/Landsberg (Ler) recombinant
inbred lines. This approach allows for exact physical positioning of
markers as opposed to the statistical localization resulting from
traditional genetic mapping procedures. In addition, it is fast because
no extensive segregation analysis is needed. In principle, the method can be applied to all organisms for which a complete or nearly complete
genome sequence is available. We have located 1,267 AFLP Col/Ler markers resulting from 256 SacI+2, MseI+2 primer combinations to a
physical position on the Arabidopsis genome. The positioning was
verified by sequence analysis of 70 markers and by segregation analysis
of two leaf-form mutants. Approximately 50% of the mapped Col/Ler AFLP markers can be used for segregation
analysis in Col/C24, Col/Wassilewskija, or Col/Cape Verde Islands
crosses. We present data on one such cross: the localization of a
viviparous-like mutant segregating in a Col/C24 cross.
 |
INTRODUCTION |
Forward genetics involves the
position-dependent cloning of genes underlying phenotypes of interest.
A prerequisite for successful positional, or map-based, cloning is the
availability of an accurate high-density genetic map. Genetic maps are
traditionally constructed by analyzing linkage relationships between
markers in (large) segregating populations. The estimated genetic
distances between the markers depend on the type and size of the
population used to construct the map. In Arabidopsis, recombinant
inbred lines (RILs), essentially representing homozygous genotypes,
constitute permanent mapping populations. More than 1,200 markers
(http://nasc.nott.ac.uk/new_ri_map.html), including 237 single
nucleotide polymorphism (SNP) markers recently localized by Cho et al.
(1999) , have been analyzed in the Columbia (Col)/Landsberg
(Ler) RILs (Lister and Dean, 1993 ). Alonso-Blanco and
colleagues (1998) developed an amplified fragment-length polymorphism (AFLP)-based linkage map containing 385 and 321 AFLP markers by using
the Col/Ler and Ler/Cape Verde Islands (Cvi) RIL
populations, respectively. Even though good mapping populations are
available for Arabidopsis, marker locations in the resulting genetic
maps can be given only relative values because map distance is
expressed in terms of recombination frequency. Unfortunately, units of
genetic recombination (centiMorgans; cM) cannot be translated into
physical distances, i.e. distances in base pairs. Moreover, for each
marker to be placed, at least 100 individuals must be scored, a
time-consuming and error prone process. With the availability of the
Arabidopsis genome sequence, ecotype Col-0 (The Arabidopsis Genome
Initiative, 2000 ), an increasing number of genetic markers can be
allocated to a physical map position by sequence analysis; about 800 Col markers have already been located physically (The
Arabidopsis Information Resource Web site:
http://www.Arabidopsis.org/).
Here we propose a new procedure for the construction of
high-resolution maps that overcomes many of the shortcomings of
traditional linkage analysis. This procedure combines in silico AFLP
analysis of the available Arabidopsis genomic sequence with gel-based
AFLP analysis on Arabidopsis ecotypes, and results in the physical placement of Col/Ler AFLP markers on the genome sequence. By
avoiding the use of an extensive mapping population, this method
considerably accelerates the normally time-consuming procedure for
building genetic maps. In addition, it benefits from the fact that it
allows for precise physical placement, which implies that the order of markers that would be clustered in traditional genetic maps can now be
deciphered. The availability of the Arabidopsis genome sequence allows
us to perform in silico restriction digests, which provides us with a
set of Col AFLP fragments; whereas experimental AFLP analysis
identifies Col AFLP fragments that are polymorphic with Ler
(or any other Arabidopsis ecotype). We can correlate experimental and
in silico AFLP analysis by using the restriction fragment sizes and
selective nucleotides used in AFLP analysis as discriminative parameters.
In addition to these two parameters, knowledge about the
approximate position of the AFLP markers on the genome significantly increases the number of markers that can be positioned unequivocally. We therefore analyzed a number of Col/Ler RILs (Lister and
Dean, 1993 ) together with the ecotypes. The restriction fragment size, selective nucleotides, and approximate position on the genome as
afforded by the limited RIL analysis provide the information used to
place the experimentally obtained Col AFLP polymorphisms directly onto
the published Arabidopsis sequence. This procedure can in principle be
applied to all organisms for which a complete or nearly complete genome
sequence is available. In this article we show that the analysis of all
256 possible SacI+2, MseI+2 AFLP primer
combinations on Col, Ler, and seven Col/Ler RILs
leads to the physical placement of 1,267 Col/Ler AFLP
markers on the Arabidopsis genome sequence, i.e. an average density of
one marker per 100 kb. This means that the application of a limited
number of AFLP reactions leads to the physical positioning of more
markers than currently available via the TAIR Web site. Additional sets of AFLP markers can be obtained by using other restriction enzymes, implying that very high-density physical AFLP maps can be produced in
this way.
Well-characterized mutants are often created in backgrounds other
than Col or Ler. To facilitate the process of positional cloning, we have included three more ecotypes in our analysis. In our
map we display information on the Col/Ler AFLP markers that
are polymorphic with the ecotypes C24, Wassilewskija (Ws), and/or Cvi
as well. This results in maps of 644, 607, and 663 Col/Ler
AFLP markers that are also polymorphic between Col/C24, Col/Ws, and
Col/Cvi, respectively. We present data on the localization of a
viviparous-like mutation in a Col/C24 segregating population.
 |
RESULTS |
Strategy for Positioning Experimentally Obtained AFLP Markers on
the Arabidopsis Genome
The analysis of a non-complex genomic sequence, Arabidopsis
bacterial artificial chromosome (BAC) clone F26P21 (data not
shown), and work on Escherichia coli (Arnold et al., 1999 )
demonstrated that experimental AFLP fragments can be predicted in
silico. A more complex organism like Arabidopsis, requires the use of
selective nucleotides for a genome-wide experimental AFLP analysis. We
performed SacI+2, MseI+2 primer combinations for
our experimental AFLP analysis. Unlike the approach chosen for E. coli (Arnold et al., 1999 ), we did not aim to predict all AFLP
fragments visualized on gels. Instead we identified the unambiguous
Col/Ler AFLP polymorphisms from the gels and aimed to define
their corresponding in silico AFLP fragments, with the intention to
produce a physical AFLP map. For in silico AFLP analysis, the available
Arabidopsis genome sequence (Col-0) was downloaded and digested in
silico with the restriction enzymes SacI and
MseI. This resulted in 41,217 predicted SacI/MseI fragments. The criteria used to define
the in silico fragment(s) corresponding to each Col/Ler AFLP
marker obtained by experimental AFLP analysis are described in detail
in "Materials and Methods." In silico fragments that comply with
the criteria are considered candidates for the experimental
Col/Ler AFLP markers. In a preliminary analysis, positioning
a set of 955 experimentally obtained Col/Ler AFLP markers on
the genomic sequence based solely on the size of the markers and the
selective nucleotides enabled us to assign only 246 (26%) of the
Col/Ler AFLP markers to a unique candidate position on the
Arabidopsis genome. The great majority of the remaining AFLP markers
had more than one possible corresponding in silico fragment. Thus,
additional information was needed to increase the number of uniquely
assigned markers. We therefore investigated the impact of (1)
additional sequence information and (2) knowledge of the rough genetic
position of the AFLP markers on the genome.
Extra sequence information can be obtained by performing
four additional AFLP reactions on the Col parent with a fifth selective nucleotide (SacI+2, MseI+3). Upon this analysis
we could assign 554 of 955 Col/Ler AFLP markers to a unique
position. Although a significant improvement, we considered 58%
placement still insufficient, particularly because the AFLP analysis
becomes more complicated and labor intensive due to usage of the four
MseI+3 primers.
As an alternative strategy, we determined the rough genetic
position of the markers by including a limited number of
Col/Ler RILs (Lister and Dean, 1993 ) in the experimental
AFLP analysis. With the inclusion of these lines, AFLP markers could
theoretically be assigned to specified genetic segments. For segment
definition, 370 genetically placed markers with full scores for the
seven RILs used were selected from the recombinant inbred (RI)
map, as published on February 4, 2000 (http://nasc.nott.ac.uk/new_ri_map.html). This resulted in the
definition of 42 genetic segments covering the Arabidopsis genome, 36 of which have a unique genetic segment code
for the seven RILs used (Fig. 1; Table
I). Table I presents the number of
Nottingham RI map markers that define each genetic segment. Based on
the scores for the seven RILs included in the experimental AFLP
analysis, Col/Ler AFLP polymorphisms can now be classified
to one of the 36 genetic segment codes. The resulting limitation in
possible genomic location(s) of each AFLP marker led to the unambiguous
assignment of a high number of the markers: addition of seven RILs to
the AFLP analysis led to the placement of 712 (75%) of the 955 AFLP
markers.

View larger version (77K):
[in this window]
[in a new window]
|
Figure 1.
Genetic segments of the Arabidopsis genome
as defined by the analysis of seven Col/Ler RILs (nos. 5, 17, 62, 79, 240, 302, and 390, respectively). The recombination
breakpoints were estimated based on the constitution of 370 selected
RIL markers from the Nottingham RI map
(http://nasc.nott.ac.uk/new_ri_map.html). Forty-two segments could be
defined, 36 of which have a unique code that represents the parental
origin of seven RILs. Dark gray represents Col, whereas light gray
represents Ler.
|
|
View this table:
[in this window]
[in a new window]
|
Table I.
The number of Nottingham RI map markers, total
number of Col/Ler AFLP markers, and number and percentage of Col/Ler
AFLP markers that can be positioned on the Arabidopsis genome
unambiguously and ambiguously (in brackets) per genetic segment
The definition of the genetic segments is explained in Figure 1.
For the RI map markers only those that show complete scores for the
seven Col/Ler RILs used to define the genetic segments were
included in this table. The Col/Ler AFLP markers resulted
from performing 256 SacI+2, MseI+2
primer combinations. In the genetic segment code, the parental origin
of each RIL is represented by a, Col, and b, Ler; numbers of
the RILs used are 5, 17, 62, 79, 240, 302, and 390, respectively.
|
|
For placement of the experimentally obtained Col/Ler
AFLP markers on the Arabidopsis genome sequence we thus use the
information on fragment size, four selective nucleotides, and the rough
genetic position of the markers deduced from the analysis of seven RILs.
Positioning the SacI+2, MseI+2 AFLP
Polymorphisms on the Arabidopsis Genome
Performing AFLP analysis with the 256 possible
SacI+2, MseI+2 primer combinations resulted in
the definition of 1,623 Col/Ler AFLP markers (Table I). As
described above, the scores for the seven RILs included in the
experimental AFLP analysis enable us to classify each
Col/Ler AFLP marker to one of the 36 defined genetic segment
codes (Fig. 1). This consequently limits the possible position(s) of
each AFLP marker on the Arabidopsis genome. Out of a total number of
1,623 Col/Ler polymorphisms, a vast majority of 1,601 (98.6%) could be assigned to 34 of the 36 defined genetic segment codes.
The remaining 22 AFLP markers (1.4%) identified four
genetic segment codes not exhibited by RI markers (Table I). Therefore, these four groups of AFLP markers could not be assigned a genetic map
position. Their location might be identified, however, by positioning
them on the total genomic sequence. One group containing seven AFLP
markers can be allocated to the top of chromosome 2, whereas a second
group of seven markers belongs to chromosome 5 (Table I). For the
remaining two groups of four markers each, no unambiguous position
could be identified.
No AFLP markers were assigned to segments 11 and 13 (Table
I). Both segments are very small and comprise two and one marker(s), respectively. It is not unlikely that the segments appear due to
mis-scoring. Alternatively, they do not harbor any AFLP markers. For
example, segment 11 contains two RI markers at 71.24 and 71.39 cM of
chromosome 2 (Table I), which score b (= Ler) for RIL79. The
RI map, as published February 4, 2000 (http://nasc.nott.ac.uk/new_ri_map.html) shows that the markers just
above (at 71.12 cM) and just below (at 71.84 cM) score a (= Col) for
RIL79 and therefore could be assigned a segment 7 (= aaaaaaba) score,
which is the segment lying just below segment 11 (Fig. 1; Table I).
Because no AFLP markers could be assigned to this segment, mis-scoring
in the RI map is a likely explanation for the appearance of segment 11. Alternatively, segment 11 might indeed not harbor AFLP markers.
Positioning the SacI+2, MseI+2 AFLP
Polymorphisms on the Arabidopsis Sequence
All experimentally identified Col/Ler AFLP
markers (Table I) were subsequently positioned on the available Col-0
sequence (The Arabidopsis Genome Initiative, 2000 ). Software was
developed in-house to perform in silico AFLP analysis. With the help of Microsoft Access (Microsoft, Redmond, WA), in silico AFLP fragments fitting the characteristics of each AFLP marker were putatively identified on the BACs cited in the sequence tables from TAIR (http://www.Arabidopsis.org/). The criteria used to identify the in
silico fragments corresponding to each Col/Ler AFLP marker are described in detail in "Materials and Methods." The
successfully positioned AFLP markers have been deposited at the TAIR
Web site and can be viewed at
http://www.Arabidopsis.org/search/marker_search.html. In addition to
the SacI/MseI AFLP markers, we placed 140 of the EcoRI/MseI Col/Ler AFLP markers
(Kuiper, 1998 ; Alonso-Blanco et al., 1998 ) on the physical map; they
are also available from the TAIR Web site. A compact disk containing
the gel images of all 256 SacI+2, MseI+2 will be
made available upon request. Table I demonstrates that 1,267 (78%) of
the 1,623 AFLP markers can be assigned a unique position on the
Arabidopsis genome. Only 1,644 kb of the telomeric regions are not
covered by these markers. Thus 98.6% of the sequenced Arabidopsis
genome (115,400 kb) is covered with AFLP markers. A considerable number
of additional markers (107) is assigned to more than one position
either within one genetic segment or even within a single BAC clone.
Although these markers are not included in the tally of the uniquely
positioned markers, the correct position of most of them can be solved
over time. For 80 markers we find two, and for three markers three possible locations within the same genetic segment, whereas 24 markers
have two or more possible positions within a single BAC clone. The in
silico sequences that correspond to the markers with more than one
possible localization within a genetic segment are mostly (i.e. in
about 90% of the cases) totally different from one another (data not
shown). By sequencing these AFLP markers or by analyzing additional
RILs, most of the markers that now have two or three possible positions
within one genetic segment can be assigned to a unique position. For
the markers with two or more possible locations within a single BAC
clone, the possible positions are by definition genetically very close,
whereas the size and signature of the corresponding in silico fragments
are very similar or identical (data not shown). In 15 of 24 cases these
repeats appear twice, whereas six markers are repeated up to nine times
within a single BAC. For the remaining three markers the in silico
sequences are completely different; thus their correct positions could
also be solved by sequencing the AFLP markers.
In addition to Col and Ler, three other ecotypes were
included in our analysis. Of the 1,267 Col/Ler AFLP markers
that were positioned on the Arabidopsis genome, 1,121 had complete
scores, i.e. no missing data, for all additional three ecotypes. Thus, when a mutant of interest is created in a background other than Ler (or Col), still a large percentage of these AFLP markers
can be used in mapping projects (Table
II). For example, 644 (57.4%), 607 (54.1%), and 663 (59.1%) of the 1,121 Col/Ler AFLP markers were polymorphic with C24, Ws, and Cvi, respectively. This implies that
a physical map of over 600 Col/Ler AFLP markers is available for mapping projects involving mutants in either of these three backgrounds crossed into a Col background. As an example of such a
cross we present data on the analysis of 44 viviparous-like mutant
individuals (Table III). The F2-mutant
individuals were selected from a cross between the mutant in C24 and
the wild type in Col background. A first analysis indicated that the
mutation was located on chromosome 1. Four selected primer combinations were subsequently performed and resulted in the analysis of 15 Col/Ler AFLP markers, nine of which could be used to
localize the viviparous-like mutant. Despite the fact that not all
Col/Ler AFLP markers can be used to localize the mutant
locus, the viviparous-like mutation was successfully positioned on
chromosome 1 between the AFLP markers SM233_177.7 and SM18_84.5
(Table III), comprising an interval of 30 BACs or about 2,600 kb.
View this table:
[in this window]
[in a new window]
|
Table II.
Percentage of polymorphism between pairs of five
Arabidopsis ecotypes
One hundred percent polymorphism between Col and Ler
signifies the 1,121 (out of a total of 1,267) Col/Ler AFLP
markers positioned on the Arabidopsis genome (see Table VI). Other
ecotypes included are C24, Ws, and Cvi.
|
|
View this table:
[in this window]
[in a new window]
|
Table III.
Linkage of Col/Ler AFLP markers on chromosome 1 with the viviparous-like locus
The 44 F2-mutant individuals used for the linkage analysis
resulted from a cross of a viviparous-like mutant (C24) and wild type
(Col). Not all Col/Ler AFLP markers are polymorphic for
Col/C24.
|
|
Verification of the Physical AFLP Map
To ascertain that our physical AFLP map is correct, two
independent approaches were followed. First, we isolated and sequenced 70 randomly chosen AFLP markers from our physical map. The
experimentally obtained sequences were compared with the sequences
predicted by in silico analysis. In all cases, the experimentally
obtained sequence matched the predicted sequence (data not shown).
Second, mutant alleles located on the two chromosomes for which
the complete sequence was available at the time of the experiment, chromosomes 2 and 4 (Lin et al., 1999 ; Mayer et al., 1999 ), were used
to analyze the degree of linkage for putatively placed AFLP markers.
The two leaf-form mutants used, angusta4 (ang4) and
rotunda2-1 (ron2-1; Berná et al., 1999 ),
map to chromosome 2 and 4, respectively, which is in good agreement
with the position as determined by Robles and Micol (2001) . Thirty and
29 AFLP markers spread along chromosomes 2 and 4, were scored for two
sets of 21 mutant individuals each (Tables
IV and V).
These mutants were selected from an F2 population
resulting from a cross between the Ler mutant and Col wild
type. AFLP markers adjacent to the mutant loci will be in linkage
disequilibrium and completely linked markers will score Ler
in all 21 mutant individuals. The ANG4 locus shows total linkage at a
chromosomal position between 18.3 and 19.3 Mb, whereas the RON2-1 locus
shows total linkage between 12.6 and 15.2 Mb (Tables IV and V). The
recombination frequency increases regularly on both sides of the
defined interval for both loci, culminating in 50% recombinants, i.e.
no linkage disequilibrium. Because AFLP analysis is not a codominant
technique, the expected ratio for non-linkage is 3:1
Col:Ler, which means roughly 16:5 in a population of 21 individuals. Independent segregation of markers and mutant loci is
reached at a distance of roughly 12 Mb from the ANG4 and RON2-1 loci.
Taken together, the sequence analysis and the mapping data show the
robustness of the proposed physical map.
View this table:
[in this window]
[in a new window]
|
Table IV.
Linkage of 30 Col/Ler AFLP markers of chromosome 2 with the angusta4 locus
Twenty-one F2-mutant individuals resulting from a cross of the
mutant (Ler) and wild type (Col) were tested for the AFLP
markers described below.
|
|
View this table:
[in this window]
[in a new window]
|
Table V.
Linkage of 29 Col/Ler AFLP markers of chromosome 4 with the rotunda2-1 locus
Twenty-one F2-mutant individuals resulting from a cross of the mutant
(Ler) and wild type (Col) were tested for the AFLP markers
described below.
|
|
The Distribution of AFLP Markers over the Arabidopsis
Genome
Performing all 256 SacI+2, MseI+2
primer combinations allowed for the physical localization of 1,267 Col/Ler AFLP markers on the Arabidopsis genome. As
Arabidopsis is estimated to have a 125 Mb genome (The Arabidopsis
Genome Initiative, 2000 ), this represents approximately one marker per
100 kb on average. Figure 2 shows the
distribution of the AFLP markers over the five Arabidopsis chromosomes.
The table included in Figure 2 indicates that the average distance
between markers differs per chromosome; it is highest in chromosome 1 and lowest in chromosome 4, the largest and smallest chromosome,
respectively.

View larger version (17K):
[in this window]
[in a new window]
|
Figure 2.
Distribution of Col/Ler AFLP markers
over the five chromosomes of Arabidopsis. For each chromosome, the
total number of Col/Ler AFLP markers (A), the average (B),
the median (C), and the largest distance (in kb) (D) between two
adjacent markers is given as well as the percentage of markers that
have distances <100 kb (E), >100 kb (F), >200 kb (G), >300 kb (H),
>400 kb (I), and >500 kb (J) between them. Each bold horizontal line
represents a marker, whereas the eight double horizontal lines
disrupting the chromosomes represent gaps in the sequence.
|
|
For application of the map in map-based cloning projects it is
important that there are relatively few marker gaps in the map. The
median and largest distance between two markers give an indication of
the existing marker gaps (Fig. 2). More specifically, a majority of
69.4% of the markers exhibit a pair-wise distance of less than 100 kb,
whereas 30.6% of the AFLP markers represent markers separated by more
than 100 kb. Only 2.6% of the markers exhibit pair-wise distances of
more than 500 kb.
There are two limitations to our approach. First, roughly 10 Mb
of the 125-Mb Arabidopsis genome consists of unsequenced centromeric and rDNA repeat regions (The Arabidopsis Genome Initiative, 2000 ). Without sequence information we are not able to physically locate any
markers in these regions. In Figure 2 these regions are indicated by
the double horizontal lines that interrupt the chromosomes. Second, the
file that was used to determine the position of the markers on the
continuous sequence AGI. nonredundant (see "Materials and
Methods") is, in fact, redundant because it still contains BAC
overlaps. Therefore the distances between some of the markers placed on
the continuous sequence undoubtedly appear greater than they are in reality.
 |
DISCUSSION |
The completion of the genome sequence of Arabidopsis and its
public accessibility have a profound impact on basic research in plant
biology. Many new tools are being developed to exploit the availability
of the genome sequence and eventually every gene, and its function is
expected to be characterized in this model plant. As part of this
effort, we utilized the Arabidopsis genome sequence to construct a
high-resolution physical AFLP map that can facilitate the cloning of
genes underlying interesting mutations. Our approach combines in silico
AFLP analysis of the available Arabidopsis genomic sequence with
experimental AFLP analysis on Arabidopsis ecotypes. This method appears
to be not only very reliable but rapid as well, because the use of an
extensive mapping population is avoided. Moreover, markers are given an
exact physical position (in base pairs) as opposed to a genetic
position (in centiMorgans). The fact that experimentally obtained AFLP
fragments can be predicted in silico with very high confidence provides strong evidence for the robustness of the AFLP method itself. Earlier
work by Arnold and colleagues (1999) demonstrated that experimental
AFLP fragments can be predicted in silico in E. coli. Our
results verify that the same can be done for a more complex organism.
In principle, our method can be applied to all completely or nearly
completely sequenced organisms, including other complex organisms, as
for example Caenorhabditis elegans (The C. elegans Sequencing Consortium, 1998 ), fruitfly (Drosophila
melanogaster; Adams et al., 2000 ), and, in the near future,
rice (Oryza sativa).
We identified a total of 1,623 Col/Ler AFLP markers in
the analysis of 256 SacI+2, MseI+2 primer
combinations. To identify the matching counterpart in the sequence by
in silico AFLP analysis, we analyzed the experimentally obtained
information for (1) restriction fragment size, (2) selective
nucleotides, and (3) rough genetic position of the markers as deduced
from the concomitant analysis of seven Col/Ler RILs. We thus
could assign 1,267 Col/Ler AFLP markers a unique position on
the available Arabidopsis sequence (Table I). These 1,267 markers fail
to cover only 1,644 kb at telomeric regions of the five chromosomes. In
other words, 98.6% of the sequenced Arabidopsis genome is covered by
the identified markers. Although the localized AFLP markers are not
evenly distributed over the Arabidopsis genome, a majority of about
70% of the markers exhibit a pair-wise distance of less than 100 kb
(Fig. 2). Only a small percentage (2.6%) of the markers exhibit
pair-wise distances of more than 500 kb. Because there are relatively
few large marker gaps, our AFLP map is useful for application in
map-based cloning projects.
In Arabidopsis, clustering of EcoRI/MseI
AFLP markers around the centromeres was reported by Alonso-Blanco et
al. (1998) . Such clusterings also appear in other plant AFLP linkage
maps as in potato (van Eck et al., 1995 ), barley (Powell et al., 1997 ), soybean (Keim et al., 1997 ), and maize (Vuylsteke et al., 1999 ). Because the above clustering has been observed in genetic maps, it is
not possible to distinguish whether it results from a reduced recombination rate around the centromeres, a higher frequency of AFLP
markers in these regions, or a combination of the two. Our work
provides information on the precise physical location of the AFLP
markers. Calculations reveal that genome-wide there are about 10 AFLP
markers per megabase pair (Mb). However, the centromeric regions
as defined by Copenhaver et al. (1999) contain twice as many AFLP
markers per Mb. Dividing the genome in 1-Mb intervals shows that
in the pericentromic region, the number of AFLP markers per Mb
are well above average as well. These data are nicely visualized in
Figure 2. The double horizontal lines in this figure represent gaps in
the sequence and signify the centromeric region in chromosomes 1, 2, and 4. The upper and lower gaps signify the centromeric region in
chromosomes 3 and 5, respectively. Chromosomes 2, 3, and 4 clearly show
an increased density of markers around the centromeres. To a lesser
extent, the same can be said for chromosomes 1 and 5. Although our data
concern SacI/MseI AFLP markers as opposed to the
EcoRI/MseI AFLP markers of Alonso-Blanco et al.
(1998) , we may conclude that clustering of AFLP markers in the
centromeric region is at least partly due to an increased frequency of
AFLP markers in this region. Because the occurrence of in silico AFLP
fragments is not increased in the (peri) centromeric region (data not
shown), this suggests that the frequency of mutations is increased in
this region, which may be explained by the fact that the rate of
nucleotide substitutions is higher in non-coding than in coding sequences.
In addition to the 1,267 AFLP markers in unique positions,
another 107 markers could be assigned more than one position on the
genome (Table I). We do not yet have enough information to place these
markers unequivocally on the Arabidopsis genome. Including markers with
more than one possible position results in placement of 85% of the
experimentally identified markers, approaching the estimated percentage
of the genome sequenced (90%). An obvious prediction is that the
majority of the non-placed markers will be located in the non-sequenced
part of the genome. In addition, it is noteworthy that 48% of the
non-placed markers are either large (>500 bp) or small (<100 bp), as
compared with 11% for placed markers. Due to the usage of a 10-bp
ladder between 100 and 500 bp, markers with sizes beyond this range are
less accurately sized, and therefore the chance that they deviate too
far from their in silico counterpart to be assigned the correct
position on the physical map is higher.
Of the 107 AFLP markers that could be assigned more than one
position on the genome, 83 could be assigned more than one possible position within a genetic segment, whereas 24 markers have two or more
possible positions within a single BAC clone. In about 90% of the
cases, the in silico sequences that correspond to the group of 83 markers are totally different from each other. Therefore, their correct
position could, in principle, be elucidated by sequencing the markers
or by analyzing additional RILs such that the genetic segments change
in size and constitution. The in silico-obtained sequences of 21 of the
24 AFLP markers with more than one position within a single BAC clone
are very similar, although usually not identical. Despite being present
more than once, these Col fragments are still markers, i.e. they are
polymorphic with Ler. Presence of the repeats in both Col
and Ler would mean that the Ler repeats must be
mutated both (or all) to become polymorphic with Col. Therefore, the
easiest explanation for the polymorphic repeats is that the formation
of the polymorphisms preceded the duplication and that the duplication
is unique to Col.
Two independent approaches verify the accuracy of our physical
AFLP map: (1) sequence analysis of 70 AFLP markers and (2) mapping data
for two Ler mutants (Tables IV and V) and one C24 mutant
(Table III). Besides offering proof for the validity of our physical
AFLP map, these data also indicate that our map is likely to be a
useful tool in map-based cloning projects. Until recently, map-based or
positional cloning in Arabidopsis was a time-consuming procedure. The
number of easy-to-use, inexpensive molecular markers was insufficient
to perform the required fine-mapping. However, with the public
accessibility of the complete Arabidopsis sequence, the tools necessary
for the production of a sufficient number of molecular markers are
available. Cereon Genomics (Cambridge, MA) recently released a database
with SNPs and insertions/deletion DNA polymorphisms between Col and
Ler. Among others, two recent publications discuss the
usefulness of the information generated by the Arabidopsis Genome
Initiative and Cereon for positional cloning (Drenkard et al., 2000 ;
Lukowitz et al., 2000 ). Our approach has been to take advantage of the
available sequence to produce a physical AFLP map with a coverage of
around 98% of the sequenced genome. Almost 70% of the markers locate
at pair-wise distances of 100 kb or less and only 2.6% of the markers
exhibit pair-wise distances of 500 kb or more. Because the Arabidopsis
genome is estimated to be 125 Mb with a genetic length of approximately 600 cM, 1 cM on average equals 210 kb. Although actual recombination rates vary considerably throughout the genome, we conclude that the
produced physical map can be used to efficiently perform the initial
steps in map-based cloning. An additional advantage of our physical
AFLP map is that, besides the preferred parents Col and Ler,
it can handle crosses involving C24, Ws, and Cvi, albeit with a lower
resolution (see Tables II and III).
In practice, the physical map has provided AFLP markers that
delineate an interval, harboring the locus of interest, of 2,600 kb at
maximum and 1,000 kb at minimum (Tables III, IV, and V). In these
experiments we performed AFLP analysis on very few mutant individuals,
21 for the ang4 and ron2-1 mutants and
44 for the viviparous-like mutant (Tables III, IV, and V), isolated
from segregating F2 populations. With this low
number of individuals, we have a number of AFLP markers left to further
delineate the region of interest for each of the three cases mentioned.
Preliminary data indicate that F2-mutant individuals selected from a
relatively small F2 population of about 500 individuals will make optimal use of the produced AFLP map and
delineate the locus of interest to a 400- to 700-kb region. After
exhausting the available AFLP markers in the region of interest, it is
recommended to switch to a source of easy-to-use, inexpensive
polymorphisms for the selection of more recombinants in the region of
interest. The most obvious choice for this purpose is the Cereon SNP collection.
In summary, the physical AFLP map can help to locate a
mutant of interest in a very brief time span, by performing a
limited number of AFLP reactions on mutants resulting from a relatively small F2 population.
 |
MATERIALS AND METHODS |
Plant Material
Five Arabidopsis ecotypes, {Col-4 (Nottingham
Arabidopsis Stock Center [NASC] stock no. N933), Ler-0
(NASC stock no. NW20), C24 (NASC stock no. N906), Ws-2, (NASC stock no.
N1601), and Cvi (Alonso-Blanco et al., 1998 )} and seven
Col/Ler RILs (nos. 5, 17, 62, 79, 240, 302, and 390;
Lister and Dean, 1993 ; http://nasc.nott.ac.uk/new_ri_map.html) were
used for this study.
To verify our map we measured the degree of linkage of two
leaf-form mutants with AFLP markers spread along the completely sequenced chromosomes 2 and 4. The angusta4 (ang4)
and rotunda2-1 (ron2-1) mutants
(Berná et al., 1999 ), represent mutations on chromosomes 2 and 4, respectively (Robles and Micol, 2001 ). For both mutants, the
F2 seeds resulting from a cross of the mutant (Ler) and wild type (Col) were obtained from Dr.
José L. Micol (Universidad Miguel Hernández,
Alicante, Spain).
The viviparous-like data result from a cross of the mutant in C24
and the wild type in Col background. DNA samples from the F2-mutant
individuals, used in the mapping experiment were kindly provided to us
by Dr. Sergei Kushnir (University of Ghent, Ghent, Belgium).
Experimental AFLP Analysis
DNA was prepared from leaves using the DNeasy Plant Mini Kit
(Qiagen, Hilden, Germany). AFLP analysis was performed according to Vos
et al. (1995) using the restriction enzymes SacI and
MseI, the SacI
adapter: CTCGTAGACTGCGTACAAGCT CATCTGACGCATGT and
the MseI
adapter: GACGATGAGTCCTGAG TACTCAGGACTCAT AFLP
reactions were carried out using primers specific for the
SacI (GACTGCGTACAAGCTC) and MseI
(GATGAGTCCTGAGTAA) adapters, each containing two selective nucleotides.
All possible 256 SacI+2 and MseI+2 primer
combinations were applied (Table VI).
Amplification reactions were performed in a PerkinElmer 9600 thermocycler (PerkinElmer, Norwalk, CT). SacI+2 primers
were radioactively phosphorylated using [ -33P]ATP
(specific activity >92 TBq mmol 1; Amersham,
Buckinghamshire, UK) and the DNA fragments were separated in a
Sequi-Gen GT sequencing cell (Bio-Rad, Hercules, CA). As a size marker,
the SequaMark 10 base-ladder (Research Genetics, Huntsville, AL) was
used. For each primer combination, the following samples were used and
loaded in this order: Col, Ler, C24, Ws, Cvi, RIL5,
RIL17, RIL62, RIL79, RIL240, RIL302, and RIL390. After electrophoresis,
gels were dried on a Heto dry GD-1 slab gel dryer (Heto Lab Equipment,
Allerod, Denmark) and visualized using a PhosphorImager 445 SI
(Molecular Dynamics, Sunnyvale, CA). Markers were scored by AFLP
Quantar software (Keygene Products B.V., Wageningen, The Netherlands).
AFLP markers were named with the code of the corresponding primer
combination (Table VI) followed by the molecular size of the fragment
as estimated by Quantar software.
In Silico AFLP Analysis
For in silico AFLP analysis, all BACs mentioned in the
TAIR sequence table
(http://www.Arabidopsis.org/cgi-bin/maps/Seqtable.pl) were retrieved
from the EMBL database. With the help of in-house developed software,
the sequences were digested in silico with the restriction enzymes
SacI and MseI. All 41,217 resulting
SacI/MseI fragments were stored in a
Microsoft Access database. For each individual AFLP fragment, the
database contains information about the size (in base pairs) and
sequence. Furthermore, the chromosome number and the accession number
of the BAC clone on which the fragment is located and its location
within the BAC are included in the database.
A user-friendly version of the in-house developed software to
restrict the Arabidopsis sequence is under development. The version we
have used to obtain the data presented here can be made available upon
request. For cDNA-AFLP a comparable program, GenEST, has been described
by Qin et al. (2001) .
Positioning of Col/Ler AFLP Markers on the Arabidopsis
Genome Sequence
A file with all experimentally obtained
Col/Ler AFLP polymorphisms was created. The
Col/Ler AFLP markers were named with the code of the
corresponding primer combination (Table VI) followed by the molecular
size of the fragment as estimated by AFLP Quantar software (Keygene
Products B.V., Wageningen, The Netherlands). The code for the primer
combination includes information about both the restriction enzymes and
the selective nucleotides. To account for the length of the primers
used in the AFLP reaction, 22 bp was subtracted from the experimentally
obtained fragment sizes. Furthermore, the file contains the scores for
the seven Col/Ler RILs used in this study. With the help
of Microsoft Access, these experimental AFLP data were used to identify
the corresponding AFLP fragments from the in silico AFLP database. In
silico predicted AFLP fragment(s) that correspond to each
Col/Ler AFLP marker were selected by taking into account
a standard gel mobility deviation of 1%. To identify the smaller AFLP
fragments, it is essential to take in account an additional ±2-bp
deviation around the estimated size of each AFLP marker. In other
words, in silico predicted AFLP fragments that fall within the range
[(experimental AFLP fragment length in base pairs 22) + (experimental AFLP fragment length in base pairs 22) × 0.01 + 2] and [(experimental AFLP fragment length in base pairs 22) (experimental AFLP fragment length in base pairs 22) × 0.01 2] are considered candidate(s) for the
identified Col/Ler AFLP markers. Col/Ler
AFLP markers that are tentatively positioned at a wrong genetic
position can be detected by their score for the seven RILs.
Determining the Sequence of AFLP Fragments
To compare the experimentally obtained sequences with those
predicted from the in silico database, 70 randomly chosen markers were
cut from AFLP gels. The gel pieces, including Whatman paper (Whatman,
Clifton, NJ), were put into 100 µL of water and were eluted for
1 h with vortexing every 10 min. Gel and paper pieces were spun
down (5 min, maximal speed), and the watery phase was removed and used
as template DNA to re-amplify the AFLP marker. For the re-amplification
reaction, 2 µL of eluted DNA, 1 µL of SacI primer
(50 ng/mL), 1 µL of MseI primer (50 ng/mL), 2 µL of dNTPs (5 mM), 5 µL of 10× PCR buffer (100 mM
Tris-HCl, 15 mM MgCl2, and 500 mM
KCl, pH 8.3), and 0.2 µL of Taq DNA polymerase (5 units/mL; Roche, Basel) were brought to a final volume of 50 µL with
water. Amplification reactions were performed in a PerkinElmer 9600 thermocycler: 20 s at 94°C, 30 s at 65°C to 56°C
( t = 0.7°C), and 60 s at 72°C for 13 cycles and
15 s at 94°C, 30 s at 56°C, and 35 s at 72°C for
30 cycles. Five microliters of the PCR reaction was analyzed on an
agarose gel to check for the correct fragment size; samples were
directly sequenced using the same primers as in the re-amplification reaction described above.
Distribution of AFLP Markers over the Arabidopsis
Genome
To determine the distribution of AFLP markers over the
Arabidopsis genome, the file named AGI.nonredundant (November, 26, 2000) from the TAIR Web page
(ftp://tairpub:tairpub@ftp.Arabidopsis.org/home/tair/AGI/) was used.
In this way, all markers are placed on the continuous DNA sequence. It
should be noted that the file AGI.nonredundant is, in fact, redundant
because it contains BAC overlaps. Therefore, the assigned distances
between some of the markers that were placed on the continuous sequence
are undoubtedly greater than they are in reality.
 |
ACKNOWLEDGMENTS |
We thank Dr. José L. Micol for providing
F2 seeds for the leaf-form mutants, angusta4 and
rotunda2-1; Dr. Sergei Kushnir for the viviparous-like mutant material;
Gert van Hoecke and the sequence group for determining the sequences of
most of the 70 AFLP markers tested; Dr. Mieke Van Lijsebettens for
coordinating the leaf developmental program; and Prof. Judy Strommer
and Dr. Marnik Vuylsteke for critically reading the manuscript.
 |
FOOTNOTES |
Received June 7, 2001; returned for revision August 2, 2001; accepted September 10, 2001.
1
Present address: Dept. of Experimental Botany,
University of Nijmegen, Toernooiveld 1, 6525 ED Nijmegen, The Netherlands.
*
Corresponding author; e-mail japet{at}sci.kun.nl; fax
32-24-3652787.
Article, publication date, and citation information can be found at
www.plantphysiol.org/cgi/doi/10.1104/pp.010504.
 |
LITERATURE CITED |
-
Adams MD, Celniker SE, Holt RA, Evans CA, Gocayne JD, Amanatides PG, Scherer SE, Li PW, Hoskins RA, Galle RF
(2000)
The genome sequence of Drosophila melanogaster.
Science
287: 2185-2195[Abstract/Free Full Text]
-
Alonso-Blanco C, Peeters AJ, Koornneef M, Lister C, Dean C, van den Bosch N, Pot J, Kuiper MT
(1998)
Development of an AFLP based linkage map of Ler, Col and Cvi Arabidopsis thaliana ecotypes and construction of a Ler/Cvi recombinant inbred line population.
Plant J
14: 259-271[CrossRef][Web of Science][Medline]
-
The Arabidopsis Genome Initiative
(2000)
Analysis of the genome sequence of the flowering plant Arabidopsis thaliana.
Nature
408: 796-815[CrossRef][Medline]
-
Arnold C, Metherell L, Clewley JP, Stanley J
(1999)
Predictive modelling of fluorescent AFLP: a new approach to the molecular epidemiology of E. coli.
Res Microbiol
150: 33-44[Medline]
-
Berná G, Robles P, Micol JL
(1999)
A mutational analysis of leaf morphogenesis in Arabidopsis thaliana.
Genetics
152: 729-742[Abstract/Free Full Text]
-
The C. elegans Sequencing Consortium
(1998)
Genome sequence of the nematode C. elegans: a platform for investigating biology.
Science
282: 2012-2018[Abstract/Free Full Text]
-
Cho RJ, Mindrinos M, Richards DR, Sapolsky RJ, Anderson M, Drenkard E, Dewdney J, Reuber TL, Stammers M, Federspiel N
(1999)
Genome-wide mapping with biallelic markers in Arabidopsis thaliana.
Nat Genet
23: 203-207[CrossRef][Web of Science][Medline]
-
Copenhaver GP, Nickel K, Kuromori T, Benito MI, Kaul S, Lin X, Bevan M, Murphy G, Harris B, Parnell LD
(1999)
Genetic definition and sequence analysis of Arabidopsis centromeres.
Science
286: 2468-2474[Abstract/Free Full Text]
-
Drenkard E, Richter BG, Rozen S, Stutius LM, Angell NA, Mindrinos M, Cho RJ, Oefner PJ, Davis RW, Ausubel FM
(2000)
A simple procedure for the analysis of single nucleotide polymorphisms facilitates map-based cloning in Arabidopsis.
Plant Physiol
124: 1483-1492[Abstract/Free Full Text]
-
Keim P, Schupp JM, Travis SE, Clayton K, Zhu T, Shi L, Ferreira A, Webb DM
(1997)
A high-density soybean genetic map based on AFLP markers.
Crop Sci
37: 537-543
-
Kuiper M
(1998)
Building a high-density genetic map using the AFLP technology.
In
J Martinez-Zapater, J Salinas, eds, Methods in Molecular Biology: Arabidopsis Protocols, Vol. 82. Humana Press, Totowa, NJ, pp 157-171
-
Lin X, Kaul S, Rounsley S, Shea TP, Benito MI, Town CD, Fujii CY, Mason T, Bowman CL, Barnstead M
(1999)
Sequence and analysis of chromosome 2 of the plant Arabidopsis thaliana.
Nature
402: 761-768[CrossRef][Medline]
-
Lister C, Dean C
(1993)
Recombinant inbred lines for mapping RFLP and phenotypic markers in Arabidopsis thaliana.
Plant J
4: 745-750[CrossRef][Web of Science]
-
Lukowitz W, Gillmor CS, Scheible WR
(2000)
Positional cloning in Arabidopsis: why It feels good to have a genome initiative working for you.
Plant Physiol
123: 795-806[Abstract/Free Full Text]
-
Mayer K, Schuller C, Wambutt R, Murphy G, Volckaert G, Pohl T, Dusterhoft A, Stiekema W, Entian KD, Terryn N
(1999)
Sequence and analysis of chromosome 4 of the plant Arabidopsis thaliana.
Nature
402: 769-777[CrossRef][Medline]
-
Powell W, Thomas WTB, Baird E, Lawrence P, Booth A, Harrower B, McNicol JW, Waugh R
(1997)
Analysis of quantitative traits in barley by use of amplified fragment length polymorphisms.
Heredity
79: 48-59[CrossRef]
-
Qin L, Prins P, Jones JT, Popeijus H, Smant G, Bakker J, Helder J
(2001)
GenEST, a powerful bidirectional link between cDNA sequence data and gene expression profiles generated by cDNA-AFLP.
Nucleic Acids Res
29: 1616-1622[Abstract/Free Full Text]
-
Robles P, Micol JL
(2001)
Genome-wide linkage analysis of Arabidopsis genes required for leaf development.
Mol Genet Gen
266: 12-19[CrossRef][Web of Science][Medline]
-
van Eck HJ, van der Voort JR, Draaistra JR, van Zandvoort P, van Enckevort E, Seger B, Peleman J, Jacobsen E, Helder J, Bakker J
(1995)
The inheritance of chromosomal localization of AFLP markers in non-inbred potato offspring.
Mol Breed
1: 397-410
-
Vos P, Hogers R, Bleeker M, Reijans M, van de Lee T, Hornes M, Frijters A, Pot J, Peleman J, Kuiper M
(1995)
AFLP: a new technique for DNA fingerprinting.
Nucleic Acids Res
23: 4407-4414[Abstract/Free Full Text]
-
Vuylsteke M, Mank R, Antonise R, Bastiaans E, Senior ML, Stuber CW, Melchinger AE, Lübberstedt T, Xia XC, Stam P
(1999)
Two high-density AFLP linkage maps of Zea mays L.: analysis of distribution of AFLP markers.
Theor Appl Genet
99: 921-935[CrossRef]
© 2001 American Society of Plant Physiologists
This article has been cited by other articles:

|
 |

|
 |
 
D. M. Figueroa and H. W. Bass
A historical and modern perspective on plant cytogenetics
Briefings in Functional Genomics,
January 27, 2010;
(2010):
elp058v1 - elp058.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
U. Rauwolf, H. Golczyk, J. Meurer, R. G. Herrmann, and S. Greiner
Molecular Marker Systems for Oenothera Genetics
Genetics,
November 1, 2008;
180(3):
1289 - 1306.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. A. Hoeberichts, E. Vaeck, G. Kiddle, E. Coppens, B. van de Cotte, A. Adamantidis, S. Ormenese, C. H. Foyer, M. Zabeau, D. Inze, et al.
A Temperature-sensitive Mutation in the Arabidopsis thaliana Phosphomannomutase Gene Disrupts Protein Glycosylation and Triggers Cell Death
J. Biol. Chem.,
February 29, 2008;
283(9):
5708 - 5718.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. J. B. Keurentjes, J. Fu, I. R. Terpstra, J. M. Garcia, G. van den Ackerveken, L. B. Snoek, A. J. M. Peeters, D. Vreugdenhil, M. Koornneef, and R. C. Jansen
Regulatory network construction in Arabidopsis by using genome-wide gene expression quantitative trait loci
PNAS,
January 30, 2007;
104(5):
1708 - 1713.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. E. El-Lithy, L. Bentsink, C. J. Hanhart, G. J. Ruys, D. Rovito, J. L. M. Broekhof, H. J. A. van der Poel, M. J. T. van Eijk, D. Vreugdenhil, and M. Koornneef
New Arabidopsis Recombinant Inbred Line Populations Genotyped Using SNPWave and Their Use for Mapping Flowering-Time Quantitative Trait Loci
Genetics,
March 1, 2006;
172(3):
1867 - 1876.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Teng, J. Keurentjes, L. Bentsink, M. Koornneef, and S. Smeekens
Sucrose-Specific Induction of Anthocyanin Biosynthesis in Arabidopsis Requires the MYB75/PAP1 Gene
Plant Physiology,
December 1, 2005;
139(4):
1840 - 1852.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. W. STILL, D.-H. KIM, and N. AOYAMA
Genetic Variation in Echinacea angustifolia Along a Climatic Gradient
Ann. Bot.,
September 1, 2005;
96(3):
467 - 477.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. I. Khrustaleva, P. E. de Melo, A. W. van Heusden, and C. Kik
The Integration of Recombination and Physical Maps in a Large-Genome Monocot Using Haploid Genome Analysis in a Trihybrid Allium Population
Genetics,
March 1, 2005;
169(3):
1673 - 1685.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Poncet, P. Hamon, M.-B. Sauvage de Saint Marc, T. Bernard, S. Hamon, and M. Noirot
Base Composition of Coffea AFLP Sequences and Their Conservation Within the Genus
J. Hered.,
January 1, 2005;
96(1):
59 - 65.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. J. M. Koopman and G. Gort
Significance Tests and Weighted Values for AFLP Similarities, Based on Arabidopsis in Silico AFLP Fragment Length Distributions
Genetics,
August 1, 2004;
167(4):
1915 - 1928.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Ma, P. H. Moore, Z. Liu, M. S. Kim, Q. Yu, M. M. M. Fitch, T. Sekioka, A. H. Paterson, and R. Ming
High-Density Linkage Mapping Revealed Suppression of Recombination at the Sex Determination Locus in Papaya
Genetics,
January 1, 2004;
166(1):
419 - 436.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. I. Sergeeva, J. Vonk, J. J.B. Keurentjes, L. H.W. van der Plas, M. Koornneef, and D. Vreugdenhil
Histochemical Analysis Reveals Organ-Specific Quantitative Trait Loci for Enzyme Activities in Arabidopsis
Plant Physiology,
January 1, 2004;
134(1):
237 - 245.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Himanen, C. Reuzeau, T. Beeckman, S. Melzer, O. Grandjean, L. Corben, and D. Inze
The Arabidopsis Locus RCB Mediates Upstream Regulation of Mitotic Gene Expression
Plant Physiology,
December 1, 2003;
133(4):
1862 - 1872.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
J. O. Borevitz and M. Nordborg
The Impact of Genomics on the Study of Natural Variation in Arabidopsis
Plant Physiology,
June 1, 2003;
132(2):
718 - 725.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Vandenbussche, J. Smalle, J. Le, N. J. M. Saibo, A. De Paepe, L. Chaerle, O. Tietz, R. Smets, L. J.J. Laarhoven, F. J.M. Harren, et al.
The Arabidopsis Mutant alh1 Illustrates a Cross Talk between Ethylene and Auxin
Plant Physiology,
March 1, 2003;
131(3):
1228 - 1238.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Jander, S. R. Norris, S. D. Rounsley, D. F. Bush, I. M. Levin, and R. L. Last
Arabidopsis Map-Based Cloning in the Post-Genome Era
Plant Physiology,
June 1, 2002;
129(2):
440 - 450.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|