|
Plant Physiol, February 2002, Vol. 128, pp. 482-490
Resistance against Herbicide Isoxaben and Cellulose Deficiency
Caused by Distinct Mutations in Same Cellulose Synthase Isoform
CESA61
Thierry
Desprez,2
Samantha
Vernhettes,2
Mathilde
Fagard,2
Guislaine
Refrégier,
Thierry
Desnos,3
Estelle
Aletti,
Nicolas
Py,
Sandra
Pelletier, and
Herman
Höfte*
Laboratoire de Biologie Cellulaire, Institut National de la
Recherche Agronomique, 78026 Versailles cedex, France
 |
ABSTRACT |
Isoxaben is a pre-emergence herbicide that inhibits cellulose
biosynthesis in higher plants. Two loci identified by
isoxaben-resistant mutants (ixr1-1,
ixr1-2, and ixr2-1) in Arabidopsis have
been reported previously. IXR1 was recently shown to
encode the cellulose synthase catalytic subunit CESA3 (W.-R. Scheible,
R. Eshed, T. Richmond, D. Delmer, and C. Somerville [2001] Proc Natl
Acad Sci USA 98: 10079-10084). Here, we report on the
cloning of IXR2, and show that it encodes another cellulose
synthase isoform, CESA6. ixr2-1 carries a mutation
substituting an amino acid close to the C terminus of CESA6 that is
highly conserved among CESA family members. Transformation of wild-type
plants with the mutated gene and not with the wild-type gene conferred
increased resistance against the herbicide. The simplest interpretation
for the existence of these two isoxaben-resistant loci is that CESA3
and CESA6 have redundant functions. However, loss of function
procuste1 alleles of CESA6 were previously shown
to have a strong growth defect and reduced cellulose content in roots
and dark-grown hypocotyls. This indicates that in these mutants, the
presence of CESA3 does not compensate for the absence of CESA6 in roots
and dark-grown hypocotyls, which argues against redundant functions for
CESA3 and CESA6. Together, these observations are compatible with a model in which CESA6 and CESA3 are active as a protein complex.
 |
INTRODUCTION |
Cellulose synthesis remains a poorly
understood process (for review, see Delmer, 1999 ). This linear
1,4- -linked glucan is synthesized in terrestrial plants by a
hexameric protein complex referred to as the terminal complex or
rosette embedded in the plasma membrane (Kimura et al., 1999 ). The
composition of this complex is unknown. Each of the six particles in
the complex is thought to contain several catalytic subunits with an
unknown stoichiometry. The relationship between the rosette and the
crystalline microfibril structure remains controversial. It is commonly
held that one rosette produces one microfibril. This idea was based on
calculations based upon the spacing of 1,4- -glucan chains in algal
celluloses and it assumed the presence of 36 glucan chains in a single
microfibril (Herth, 1983 ). Each rosette particle would then contribute
six glucan chains to the microfibril. More recent studies using
solid-state nuclear magnetic resonance lead to the conclusion that microfibrils in the primary wall
consist of 2-nm crystalline units or elementary fibrils, each of
which would not contain more than 10 to 15 glucan chains (Ha et al.,
1998 ). The authors propose a scenario in which each of the six
particles in the rosette produce the glucan chains of an elementary
fibril, which in turn associate into a hexagonal 8- to 10-nm
microfibril observed in most primary cell walls.
Genes encoding the cellulose synthase catalytic subunits have been
identified in bacteria and plants (Pear et al., 1996 ). The Arabidopsis
genome encodes 10 isoforms of the cellulose synthase catalytic
subunit, CESA (http://cellwall.stanford.edu). The strong cellulose-deficient phenotypes observed for mutants in CESA1
(Arioli et al., 1998 ), CESA7 (Taylor et al., 1999 ),
CESA8 (Taylor et al., 2000 ), CESA4 (S. Turner,
personal communication), or CESA6 (Fagard et al., 2000 )
indicate specific nonredundant functions for each of these genes. It is
interesting that the mutant phenotypes also suggest that CESA isoforms
have specialized roles in primary or secondary wall synthesis. Mutants
for CESA4, 7, and 8 specifically show
a cellulose defect in the secondary wall of the xylem (Taylor et al.,
1999 , 2000 ; N. Taylor and S. Turner, personal communication), whereas
mutants for CESA1 and 6 have defects in the
primary wall (Arioli et al., 1998 ; Fagard et al., 2000 ). Furthermore,
evidence is accumulating indicating the requirement for more than one
isoform in the same cell (Fagard et al., 2000 ; Taylor et al., 2000 ),
and pull-down experiments suggested that at least CESA7 and CESA8 physically interact and may operate as a heterodimer or multimer (Taylor et al., 2000 ). Genetic studies finally also indicate a crucial role for a membrane-bound endo-1,4- -glucanase, KORRIGAN, in
the synthesis of cellulose (Nicol et al., 1998 ; Lane et al., 2001 ; Sato
et al., 2001 ).
In addition to mutants, chemical inhibitors can be powerful tools for
the molecular dissection of biological processes. Several herbicides
inhibiting cellulose synthesis have been described such as
dichloro-benzonitrile (DCB), isoxaben, and CGA325'615 (Sabba
and Vaughn, 1999 ; Peng et al., 2001 ). Isoxaben,
N-[3(1-ethyl-1-methylpropyl)-5-isoxazolyl] is a
pre-emergence, broad leaf herbicide used primarily on small grains, turf, and ornamentals (Huggenberger et al., 1982 ; Technical report on EL-107 [1987] Lilly Research Laboratories, Indianapolis). It is selectively phytotoxic to dicotyledonous plants, whereas most
monocotyledonous species are tolerant. This herbicide is extremely
active, with IC50 values in the nanomolar range
(Heim et al., 1989 ). Isoxaben specifically inhibits radioactive Glc incorporation into the acid insoluble cellulosic cell wall fraction (Heim et al., 1990a ). Two isoxaben-resistance loci (IXR1 and
IXR2) have been described in Arabidopsis (Heim et al., 1989 ,
1990b ).
IXR1 was recently cloned and shown to encode a cellulose
synthase catalytic subunit isoform CESA3 (Scheible et al., 2001 ). Here,
we show that isoxaben resistance in ixr2-1 is caused by a
mutation in another cellulose synthase isoform, CESA6. This gene was
previously identified by knockout mutations (prc1) causing a
cellulose-deficient short hypocotyl phenotype (Fagard et al., 2000 ).
These and other data provide new insights into the complexity of the
cellulose synthesis machinery in plants.
 |
RESULTS |
Phenotype of Isoxaben-Treated Wild-Type and ixr2-1
Seedlings
Isoxaben is a potent inhibitor of cellulose synthesis in dicots,
including Arabidopsis seedlings (Heim et al., 1990b ; unpublished data).
Figures 1 and 2 show
that isoxaben strongly inhibits hypocotyl and root elongation of dark-grown seedlings. In addition, cells expand
radially, callose, lignin, and other phenolic compounds (Fig. 2)
accumulate, and seedlings eventually die at concentrations above the
IC50 value. In the light, seedlings germinate in
the presence of the herbicide, but hypocotyl growth and the development of the root and shoot meristem is blocked (IC50
around 5 nM, data not shown), and seedlings become necrotic
and die. The accumulation of callose and lignin is frequently
associated with the inhibition of cellulose synthesis as shown for
seedlings treated with DCB, another cellulose biosynthesis inhibitor
(Fig. 2) or cellulose-deficient mutants (Lukowitz et al., 2001 ; G. Refrégier, S. Pagant, and H. Höfte, unpublished data).
Transverse sections through the hypocotyl of dark-grown seedlings
showed the presence of gapped cell walls in isoxaben- or
DCB-treated seedlings (Fig. 2). Similar phenotypic characteristics have
been described previously for cellulose-deficient mutants (Arioli, et
al., 1998 ; Nicol et al., 1998 ; Fagard et al., 2000 ; Lane et al.,
2001 ).

View larger version (67K):
[in this window]
[in a new window]
|
Figure 1.
The effect of isoxaben on hypocotyl growth in wild
type and ixr2-1. Wild-type Col0 and ixr2-1
seedlings were grown for 4 d in the dark in the absence ( ) or
presence (+) of 5 nM isoxaben.
|
|

View larger version (96K):
[in this window]
[in a new window]
|
Figure 2.
Similar effects of isoxaben and DCB are displayed
on hypocotyl and root of wild-type seedlings. A-C, Transverse sections
halfway through hypocotyls show gapped walls in seedlings treated with
either herbicide. D--F, Hypocotyls stained with sirofluor
present an accumulation of callose for both herbicides. G-I, Roots
stained with phloroglucinol show an accumulation of lignin for both
herbicides, with a stronger staining for DCB. A, D, and G, Control:
4-d-old dark-grown seedlings. B, E, and H, In the presence of 5 nM or (B) 7 nM isoxaben. C, F, and I, In the
presence of 0.5 µM or (C) 1.5 µM DCB. Bars
in A through C = 100 µm; D through I = 250 µm.
|
|
Seedlings homozygous for ixr2-1 showed an increased
tolerance to the herbicide as shown by the lack of inhibition of
hypocotyl growth of dark-grown seedlings by 5 nM
isoxaben (Fig. 1). The same was observed for ixr1-2
homozygotes (Scheible et al., 2001 and data not shown).
ixr2-1 Carries a Missense Mutation in
CESA6
IXR2 was previously shown to map at 0.5 cM from the
visual marker yi on the bottom of chromosome 5 (Heim et al.,
1990a ). Using a cross between a C-24 accession containing a T-DNA
insertion north of yi (Van Lijsebettens et al., 1996 ; Fagard
et al., 2000 ) and ixr2-1, the IXR2 locus was fine
mapped (Fig. 3A). It is interesting that
IXR2 mapped to the same position as CESA6, a gene
encoding a cellulose synthase isoform previously identified by loss of function mutations (prc1) causing a growth defect and
cellulose deficiency specifically in roots and etiolated seedlings.
Given the fact that low concentrations of isoxaben phenocopy the
Prc1 phenotype (Fig. 5; Fagard et al., 2000 ),
the hypothesis that IXR2 is a prc1 allele was
tested by sequencing the CESA6 gene in ixr2-1. A
single point mutation was detected toward the 3' end of the coding
sequence, causing the amino acid change R1064W. This region of the predicted amino acid sequence is highly
conserved between all 10 Arabidopsis CESA genes (Fig.
3B), and the charged residue R1064 delimits
the C-terminal end of the 8th predicted transmembrane anchor of
CESA6.

View larger version (34K):
[in this window]
[in a new window]
|
Figure 3.
The ixr2-1 mutation causes a
R1064W change in a residue conserved for all CESA
isoforms in Arabidopsis. A, Fine mapping of IXR2. Twenty-two
recombinants were isolated between a T-DNA insertion in a C-24
background, and ixr2-1 in Col0 and recombination breakpoints
were mapped using the PCR markers ve032 and
5H1-L. PRC1 was mapped using the same
markers on 136 recombinants between prc1-1 in Col0 and the
same T-DNA insertion in C-24 (Fagard et al., 2000 ). The comparison of
the maps showed a very close proximity between IXR2 and
PRC1. B, Multiple alignment of the C-terminal amino acid
sequences of the 10 Arabidopsis CESAs. The numbers indicate the
positions of the first amino acid presented in the alignment. Hatched
bar indicates the last predicted transmembrane domain. Shaded residues
represent a high consensus value of 85%, specified in the program.
Boxed residues are identical for at least seven isoforms. The position
of the R1064W mutation in the IXR2-1
allele of CESA6 is indicated by the star below the alignment. C,
Hypothetical diagram of the membrane topology of CESA proteins. Area in
rectangle refers to the part of the sequence shown in B. Predicted
transmembrane domains are hatched. The arrow indicates the position of
the ixr2-1 mutation.
|
|
Wild-Type Plants Transgenic for IXR2-1 Show Reduced
Sensitivity to Isoxaben
To confirm that the R1064W change is
responsible for the isoxaben-resistant phenotype, transgenic
Arabidopsis plants were constructed carrying a 12.74-kb genomic clone
containing CESA6 with or without the
R1064W mutation. This fragment carries a
functional PRC1 gene as shown by its ability to complement
the prc1 phenotype (data not shown).
T2 progenies of four of four transformants
carrying the wild-type CESA6 fragment did not show an
increased resistance against 5 nM isoxaben (e.g.
The length of dark-grown Columbia [Col0] hypocotyls was 11.8 ± 1.6 mm and 2.1 ± 0.3 mm, respectively, in the absence and
presence of 5 nM isoxaben. For a
T2 family of Col0 transformed with the wild-type
CESA6 fragment, hypocotyls measured 12.9 ± 0.9 mm and
2.3 ± 0.3 mm, respectively, in the absence and
presence of 5 nM isoxaben. The three other
T2 families behaved in the same way). In
contrast, T2 progenies of five of five
independent transformants carrying the R1064W
mutation segregated for an increased isoxaben-resistance phenotype
(data not shown). A homozygous T3 line (line
201.3) containing CESA6-R1064W
was selected and analyzed more in detail. Measuring the
inhibition of hypocotyl growth of dark-grown seedlings is a sensitive
way to quantify isoxaben activity. Wild-type seedlings showed a steep dose-response curve with an IC50 of around 1.5 nM (Fig. 4). This result was confirmed by the inhibition of the incorporation of 14C-Glc into the acid-insoluble cellulosic
fraction (IC50 around 1 nM,
data not shown). The line homozygous for ixr2-1 showed an increased resistance against isoxaben with
IC50values 15 times higher than those for the
wild-type control (Fig. 4). In the absence of isoxaben, hypocotyls of
the line carrying CESA6-R1064W (line 201.3) were, for unknown reasons, slightly shorter than those of
wild-type plants. The isoxaben dose-response curve for 201.3 (Fig. 4)
revealed a resistance intermediate between that of the wild-type and
ixr2 homozygotes (IC50 of 6 nM). Together, these results demonstrate that the
R1064W point mutation in CESA6 is sufficient to confer increased isoxaben resistance.

View larger version (32K):
[in this window]
[in a new window]
|
Figure 4.
Transgenic Col0 homozygous for an insertion
carrying CESA6-R1064W shows increased
resistance to isoxaben. Isoxaben dose-response curve for hypocotyl
length of 4-d-old dark-grown seedlings. Curves for wild-type Col0,
ixr2-1 homozygotes, and Col0 plants homozygote for
CESA6-R1064W [Col(IXR2)] are
shown.
|
|
Other Functionally Redundant Isoforms of CESA6 Also May Be Isoxaben
Targets
All six prc1 alleles sequenced so far contain premature
stop codons and are complete loss-of-function alleles of
CESA6 (Fagard et al., 2000 ). The results reported here show
that CESA6 is a target for isoxaben. As a result, the
Prc1 phenotype is expected to be comparable
with that of the wild-type treated with isoxaben. This is only in part
true. Dark-grown hypocotyls of prc1-1 were as long as those
of the wild type grown on 4 nM isoxaben (Fig.
5). However, higher concentrations of
isoxaben further inhibited hypocotyl growth. Isoxaben also had a strong effect on light-grown seedlings (data not shown), whereas aerial parts
of prc1-1 grown in the light did not show a detectable
phenotype (Fagard et al., 2000 ). Paradoxically, despite the
nonessential role for CESA6 in these conditions, ixr2-1
seedlings were also resistant against isoxaben when grown in the light.
These observations indicate that isoxaben recognizes other targets
besides CESA6, which are partially or totally redundant with CESA6.
This was confirmed by the observation that despite the absence of a
growth defect in the light, hypocotyl growth of prc1 was
hypersensitive to isoxaben. Hypocotyls of 7-d-old wild-type and
prc1-1 seedlings grown in the absence of isoxaben showed
comparable lengths (0.67 ± 0.03 cm and 0.63 ± 0.04 cm,
respectively, n > 20). In contrast, the hypocotyls of
prc1-1 seedlings grown for 7 d on 3 nM isoxaben were significantly shorter than those
of the wild-type controls (0.32 ± 0.02 cm versus 0.62 ± 0.03 cm, respectively, n > 20).

View larger version (60K):
[in this window]
[in a new window]
|
Figure 5.
Evidence for additional isoxaben targets. A,
Dark-grown hypocotyl length of 4-d-old seedlings of Col0,
ixr2-1 homozygotes, and prc1-1 homozygotes in the
absence or presence of 5 or 10 nM isoxaben. B,
Seedling phenotype of Col0 grown without (left) and with (middle) 5 nM or (right) 10 nM
isoxaben. C, Same conditions as in B, but for prc1-1
seedlings. Note the stronger phenotype for wild-type seedlings grown in
the presence of 10 nM isoxaben than that of
prc1-1 homozygotes.
|
|
 |
DISCUSSION |
IXR2 encodes CESA6
The following evidence shows that resistance against isoxaben in
the ixr2-1 mutant is caused by a mutation in CESA6. First, fine mapping showed a colocalization of IXR2-1 with
PRC1, which encodes CESA6. Second, CESA6 in
ixr2-1 carried an amino acid change, R1064W. Third, transformation of a genomic
fragment carrying the CESA6 gene with this mutation, but not
with the wild-type control, conferred increased isoxaben-resistance to
wild-type plants.
The observed reduced resistance level of homozygotes for the mutant
transgene compared with ixr2-1 homozygotes is not
surprising. The semidominant nature of the mutation has been reported
previously, with ixr2-1 heterozygotes showing a 10-fold
higher IC50 value than homozygotes (Heim et al.,
1990a ). The same observation was reported for ixr1 mutants.
In addition, ixr1 homozygotes transformed with the wild-type
gene showed a lower resistance to isoxaben than nontransformed
ixr1 controls (Scheible et al., 2001 ). This observation is
consistent with the idea that multiple copies of CESA6 and/or CESA3
constitute the rosette complex. The different catalytic subunits within
a rosette would coordinately synthesize the different glucan chains
that constitute the microfibril. It is not clear how the activity of
the subunits is coordinated, but it can be expected that the presence
of even a few isoxaben-sensitive subunits within a, for the rest
resistant, complex may lead to the poisoning of the entire complex in
the presence of the herbicide.
Redundancy within the CESA Gene Family
It is important to know the function of all 10 CESA isoforms in
Arabidopsis (Fig. 6). Most isoforms
appear to have an evolutionary conserved, specialized function, as
shown by the presence of orthologs in unrelated plant species such as
cotton (Fig. 6). Mutants rsw1 (Arioli et al., 1998 ) and
prc1 (Fagard et al., 2000 ) have a strong seedling phenotype,
indicating that the encoded isoforms (CESA1 and CESA6, respectively)
are required for cellulose synthesis in the primary wall. Mutants for
CESA7 (irx3), CESA8 (irx1), and CESA4
(irx5; Taylor et al., 1999 , 2000 ; N. Taylor and S. Turner, personal communication) are characterized by their collapsed xylem phenotype, and the isoforms appear to be specialized for cellulose synthesis during secondary wall formation. The very similar dark-grown seedling phenotype for rsw1 and prc1 (Fagard et
al., 2000 ) suggests that at least in the hypocotyl, the two encoded
isoforms are required in the same cell types and have nonredundant
functions. The same was observed for irx1, 3, and
5 in xylem cells (Taylor et al., 1999 , 2000 ; Taylor, 2001 ).
Expression in the same cell types was further suggested for
CESA1 and CESA3 using promoter- -glucuronidase fusion constructs (Scheible et al., 2001 ). The requirement for several
isoforms in the same cell type may indicate the coexistence of several
specialized cellulose synthase complexes or the presence of one or more
isoforms in the same complex. The latter idea was supported by
pull-down experiments showing that CESA7 and CESA8 physically interact
in vitro.

View larger version (29K):
[in this window]
[in a new window]
|
Figure 6.
Members of the CESA family are functionally
specialized as shown by loss-of-function and isoxaben-resistant
alleles. A phylogenetic tree based on a hypervariable region among CESA
protein sequences is shown (Fagard et al., 2000 ). Sequences from
Arabidopsis (in bold) were aligned with those from cotton
(Gossypium hirsutum), and a parsimonious consensus tree was
constructed. Numbers are bootstrapped values (n = 100).
Corresponding mutant alleles are indicated in italics and mutant
phenotypes are discussed in the text. Clustering of one or more
specific Arabidopsis sequences with cotton homologs suggests a
functional specialization of the corresponding isoforms. CESA6 clusters
with three other Arabidopsis isoforms, suggesting that they have arisen
by more recent gene duplications.
|
|
The cloning of ixr1 and ixr2 provides additional
functional information for the encoded isoforms. The existence of two
resistance loci on first sight would suggest redundant roles for the
corresponding proteins. However, the strong phenotype observed for
dark-grown hypocotyls of prc1 suggests that CESA3 is absent
in this organ or that CESA3 is present but unable to compensate for the
absence of CESA6 in the mutant. Although CESA3 protein has not yet been detected directly, two lines of evidence strongly suggest that CESA3 is
present in dark-grown hypocotyls. First, CESA3 transcripts are constitutively expressed (Scheible et al., 2001 ), including in
dark-grown and light-grown seedlings (A. Van Tuinen, T. Desprez, and H. Höfte, unpublished data), and second, ixr1 hypocotyl
growth in the dark was also resistant against isoxaben. Given the fact that ixr1 mutations do not alter the expression pattern of
CESA3 transcripts (Scheible et al., 2001 ), it is reasonable
to conclude that in dark-grown hypocotyls, the function of CESA3 is not
redundant with that of CESA6. The absence of redundancy is further
suggested by the strong phenotype observed for dark-grown seedlings
carrying recessive loss of function mutations in CESA3 (M. Bevan, personal communication), This leads to the interesting
possibility that at least in dark-grown hypocotyls, CESA3 and CESA6 are
active as a complex. This is similar to the complex reported for CESA7 and CESA8 in cells synthesizing secondary walls. In this scenario, isoxaben may bind directly, or via another protein, at the interface between the two monomers or may recognize a conformation requiring the
presence of both wild-type isoforms.
A closer examination of the Prc1 phenotype,
however, shows that in the absence of CESA6, other targets for isoxaben
exist in dark-grown hypocotyls. Complete knockout mutants for CESA6 showed a milder phenotype than wild-type plants treated with 10 nM isoxaben, a concentration that did not significantly
affect growth in ixr2-1. This residual isoxaben-sensitive
CESA activity may correspond to CESA3, which in that case would only
partially replace CESA6 in the prc1 mutant, but it may also
correspond to other CESA isoforms. More strikingly, aerial parts of
prc1 mutants grown in the light did not show a growth
phenotype, but were nevertheless hypersensitive to isoxaben action.
Therefore, other CESA isoforms must have redundant roles with CESA6 in
these conditions. In theory, this may be CESA3, but this would imply
that the specificity of CESA3 is altered in light because CESA3 was
unable to completely replace CESA6 in dark-grown prc1
seedlings. In an alternate manner, isoforms CESA2, 5, and 9, which are
highly similar to CESA6, may be redundant with CESA6 and constitute
other isoxaben targets. As shown by expressed sequence tag data,
CESA2 and CESA5 mRNAs are also expressed in dark-
and light-grown seedlings, but at lower levels than CESA6
(http://cellwall.stanford.edu). CESA9 has a very low
expression level as shown by the single expressed sequence tag that was
found in a library from rosette leaves. The exact function of these
three isoforms remains to be determined and will require the isolation
of the corresponding mutants.
The genetic data indicate that CESA1 is also essential for cellulose
synthesis, including in dark-grown hypocotyls (Fagard et al., 2000 ).
From this, it can be inferred that CESA1 is still active in the
presence of isoxaben in an ixr2 or ixr1
background, which would suggest that CESA1 is not an isoxaben target.
However, it is not formally excluded that isoxaben recognizes a
conformation that requires the association of not only CESA3 and CESA6,
but also of CESA1, and that mutations in any of these proteins may destabilize the complex. These two possibilities can be now
distinguished by expressing CESA1 versions carrying their equivalent of
the ixr2-1, ixr1-1, or ixr1-2
mutations in transgenic plants and assessing the resistance against isoxaben.
The R1064W mutation in ixr2-1 removes
a positive charge at the end of the last predicted membrane spanning
domain. This may cause a dramatic conformational change associated with
a change in the membrane topology of the protein, which may prevent the binding of isoxaben or isoxaben-associated protein(s).
ixr1-1 and ixr1-2 also carry mutations close to
the C terminus of CESA3 (Scheible et al., 2001 ), suggesting again that
this region is targeted by the herbicide. It is unlikely, however, that
the amino acids mutated in the ixr1 and ixr2
alleles fold together in a single isoxaben-binding site. According to
the predicted topology, R1064W in IXR2-1, and
G998D in IXR1-1 would be on the opposite side of
the membrane compared with T942I in IXR1-2. The
prediction of the topology is not correct or one has to assume that the
mutations all induce a conformational change of the protein complex,
leading to the loss of isoxaben binding. In the absence of a
comprehensive three-dimensional structure for the cellulose synthase
complex, it is not clear how isoxaben interferes with the synthesis of cellulose. In ixr2 and ixr1 alleles, the mutated
amino acid is far downstream from the active site residues, which makes
it unlikely that the compound directly interferes with the catalytic
site. In an alternate manner, the extrusion of the glucan chain
supposedly requires a membrane channel that may be formed by the
transmembrane domains. Isoxaben could block such a channel. Isoxaben
binding could interfere with the interaction between CESA subunits and in this way destabilize the hexameric rosette or each particle that
constitutes the rosette. A destabilizing effect on the rosettes was
also suggested for the herbicide CGA325'615 (Peng et al., 2001 ).
In conclusion, the identification of the isoxaben target CESA6 provides
further insights in the complexity of the cellulose synthesis machinery
and the role of the 10 cellulose synthase isoforms. Indirect evidence
for complex formation between CESA3 and CESA6 is provided and partial
redundancy between CESA6 and other CESA isoforms, possibly CESA2,
CESA5, or both. With the targets characterized, isoxaben becomes an
excellent tool for the study of cellulose synthesis in Arabidopsis, and
also in other plant species.
 |
MATERIALS AND METHODS |
Plant Material and Growth Conditions
prc1-1(Desnos et al., 1996 ),
ixr1-2 (DH48), ixr2-1
(DH1; kindly provided by the Arabidopsis Biological
Resource Center), and wild-type Arabidopsis plants were of the Col0
ecotype. A KanR5 line used for ixr2-1 map-based cloning
that bears a T-DNA insertion close to marker LFY3 (Van Lijsebettens et
al., 1996 ) at the bottom of chromosome 5 (Lister and Dean, 1993 ) was of
C24 ecotype. Seedlings were grown in dark conditions as described in
Fagard et al. (2000) .
Measurement of Hypocotyl Length
Growth of seedlings was arrested by addition of an aqueous
solution of 0.4% (w/v) formaldehyde. Seedlings were spread on agar plates and an image was captured using a digital camera. The lengths of
hypocotyls were measured using image analysis software (Optimas 5.2;
IMASYS, Surennes, France) as described in Gendreau et al. (1997) .
Cross Sections and Calcofluor Staining
For light microscopy, seedlings were fixed in 4% (w/v)
paraformaldehyde and 0.2% (w/v) glutaraldehyde in phosphate-buffered saline buffer and were embedded in historesin (Technovit 7100; Kulzer,
Wehrheim, Germany) following the manufacturer's instructions. Sections
3 µm thick were cut using a microtome (Jung RM2055; Leica, Wetzlar,
Germany). The cross sections were stained with a 0.005% (w/v) aqueous
solution of Calcofluor (Fluorescent Brightener 28; Sigma, St. Louis)
for 2 min and they were visualized under UV light using a microscope
(microphot FXA; Nikon, Tokyo).
Callose and Lignin Staining and Microscopic Observations
Plants were grown in vitro for 4 d in dark conditions on a
medium containing 1% (w/v) Suc and 5 nM isoxaben or 0.5 µM DCB. Seedlings were directly spread on slides and were
gently squashed under the coverslip before adding the staining
components between the slide and the coverslip. Callose staining was
done with Aniline Blue Fluorochrome or sirofluor (Biosupplies
Australia, Parkville, Victoria, Australia) at a concentration of 0.1 mg
mL 1. Slides were kept in the dark for 30 to 120 min
before observation under UV light.
Pholoroglucinol in hydrochloric solution (Prolabo, Fontenay, France)
was used for lignin staining and was observed under white light with
Nomarski optics.
Mapping of the ixr2 Mutation
The ixr2 mutant (Col0 ecotype; Heim et al.,
1990a ) was crossed to a T-DNA line (C24 ecotype) bearing an insertion
close to RI marker LFY3. The F1 hybrid was allowed to
self-pollinate and the progeny was collected. To identify seedlings
homozygous for the ixr2 mutation, the F2
progeny was plated directly on 6 nM isoxaben-containing
growth medium and cultured in the dark for 4 d. In these
conditions, it is possible to distinguish homozygous ixr2/ixr2, heterozygous
ixr2/IXR2, and homozygous wild-type
(IXR2/IXR2) seedlings (data not shown). Homozygous mutant seedlings
(ixr2/ixr2) were then transferred to
fresh medium containing 50 mg L 1 kanamycin. After 10 d, 22 kanamycin-resistant seedlings were transferred to greenhouse and
were considered recombinant between the ixr2-1 mutation
and the T-DNA insertion. Genomic DNA was extracted from leaves and
flower buds as described previously (Bouchez and Camilleri, 1998 ).
These recombinant seedlings were further analyzed using the markers
ve032 and 5H1-L generated during the map-based cloning of
the CESA6 gene (Fagard et al., 2000 ).
DNA Construction and Plant Transformation
Standard molecular cloning techniques were performed as
described by Sambrook et al. (1989) . A 6.4-kb
EcoRI-HindIII DNA fragment of the P1
clone MVP7 (accession no. AB025637) was cloned into the site
EcoRI-HindIII of the binary vector pDE
1001 containing a kanamycin resistance marker (Denecke et al., 1992 ) to
obtain the pDE-EHMVP7 clone. A 6.3-kb HindIII DNA
fragment of the P1 clone MVP7 was introduced into the
HindIII site of pDE-EHMVP7 to obtain the pDE-CESA6 clone.
A PCR reaction was performed using the oligonucleotides
TGGTTATGGAGGTGGGTTGA, forward, and ATTTTCAATTTAGAAGACCGCAT, reverse, that surrounds the ixr2-1 mutation. The resulting 2.6-kb
DNA fragment was cleaved with SalI-XbaI
enzymes, and the digested fragment was cloned into the
SalI-XbaI sites of pDE-CESA6, giving rise to the pDE-CESA6-R1064W clone. The binary T-DNA constructs
were mobilized into Agrobacterium tumefaciens C58 Pmp90.
The pDE-CESA6 and pDE-CESA6-R1064W constructs were
introduced into Col0 seedlings using the infiltration protocol
described by Bechtold and Pelletier (1998) . The T1
transformants were selected on a kanamycin-containing medium (50 mg
L 1). The T2 transformants were obtained after
selfing T1 kanamycin-resistant seedlings. Four Col0(CESA6)
T2 transformants were analyzed on a kanamycin-containing
medium, and the line 206 carrying an unique transgene was selected for
the analyses.
Five Col0(CESA6-R1064W) = Col(IXR2) T2
transformants were tested for their isoxaben resistance. The
T2 transformants were plated on 10 9
M isoxaben-containing medium in dark conditions so that the
wild-type seedlings were classified as sensitive. We observed a
segregating population representing homozygous and heterozygous
ixr2 states. The F3 progeny of the most
resistant line (line 201.3) was obtained and it was 100%
kanamycin-resistant, confirming the homozygous state of the unique transgene.
DNA Sequencing
Genomic DNA was extracted from adult seedlings grown in normal
greenhouse conditions using standard protocol. PCR fragments covering
the entire coding sequence were generated and sequenced by Genome
Express (Meylan, France).
The ixr2 mutation was detected in the PCR fragment
amplified with the specific primers TGGTTATGGAGGTGGGTTGA,
forward, and ACGTGGCACAATATGGCTGA, reverse.
Alignments and Phylogenetic Tree
The alignment presented in the Figure 3 was obtained with
the Multalign program (http://www.toulouse.inra.fr/multalin.html). For
multiple alignment, selected sequences (from the last
transmembrane segment through the end of each AtCESA) were
combined in SeqVu. A high consensus value of 85% was chosen in the
program. For the dendrogram (Fig. 6), sequences from the HVR2 domains
corresponding to amino acids 690 and 743 in CESA6 were aligned with the
program ClustalW
(http://www.infobiogen.fr/services/analyseq/cgi-bin/clustalw_in.pl). An additional sequence, which is more divergent, was inserted as an
outlier (AI727450). This alignment was analyzed by PROTPARS to
construct a consensus tree from 100 bootstrapped data sets.
 |
ACKNOWLEDGMENTS |
We thank Jocelyne Kronenberger for excellent technical
assistance and the Ohio Arabidopsis Biological Resource Center for providing ixr1-2 and ixr2-1 seeds. We
also thank Michael Bevan and Simon Turner for allowing us to cite their
unpublished data.
 |
FOOTNOTES |
Received September 7, 2001; returned for revision November 2, 2001; accepted November 5, 2001.
1
This work was financed in part by the
Ministère de la Recherche et de Technology (grants to M.F., G.R.,
and T.D.).
2
These authors contributed equally to this work.
3
Present address: Département d'Ecophysiologie
Végétale et de Microbiologie/Laboratoire du
Métabolisme Carboné, Commissariat à l'Energie
Atomique de Cadarache, 13108 St. Paul-lez-Durance cedex, France.
*
Corresponding author; e-mail hofte{at}versailles.inra.fr; fax
33-1-30-83-30-99.
Article, publication date, and citation information can be found at
www.plantphysiol.org/cgi/doi/10.1104/pp.010822.
 |
LITERATURE CITED |
-
Arioli T, Peng L, Betzner AS, Burn J, Wittke W, Herth W, Camilleri C, Höfte H, Plazinski J, Birch R, et al
(1998)
Molecular analysis of cellulose biosynthesis in Arabidopsis.
Science
279: 717-720[Abstract/Free Full Text]
-
Bechtold N, Pelletier G
(1998)
In planta Agrobacterium-mediated transformation of adult Arabidopsis thaliana plants by vacuum infiltration.
Methods Mol Biol
82: 259-266[Medline]
-
Bouchez D, Camilleri C
(1998)
High molecular weight DNA extraction from Arabidopsis.
Methods Mol Biol
82: 61-70[Medline]
-
Delmer D
(1999)
Cellulose biosynthesis: exciting times for a difficult field of study.
Annu Rev Plant Physiol Plant Mol Biol
50: 245-276[CrossRef][ISI]
-
Denecke J, De Rycke R, Botterman J
(1992)
Plant and mammalian sorting signals for protein retention in the endoplasmic reticulum contain a conserved epitope.
EMBO J
11: 2345-2355[ISI][Medline]
-
Desnos T, Orbovic V, Bellini C, Kronenberger J, Caboche M, Traas J, Höfte H
(1996)
Procuste1 mutants identify two distinct genetic pathways controlling hypocotyl cell elongation, respectively in dark- and light-grown Arabidopsis seedlings.
Development
122: 683-693[Abstract]
-
Fagard M, Desnos T, Desprez T, Goubet F, Refregier G, Mouille G, McCann M, Rayon C, Vernhettes S, Höfte H
(2000)
PROCUSTE1 encodes a cellulose synthase required for normal cell elongation specifically in roots and dark-grown hypocotyls of Arabidopsis.
Plant Cell
12: 2409-2423[Abstract/Free Full Text]
-
Gendreau E, Traas J, Desnos T, Grandjean O, Caboche M, Höfte H
(1997)
Cellular basis of hypocotyl growth in Arabidopsis thaliana.
Plant Physiol
114: 295-305[Abstract]
-
Ha M-A, Apperley DC, Evans BW, Huxham IM, Jardine WG, Viëtor RJ, Reis D, Vian B, Jarvis MC
(1998)
Fine structure in cellulose microfibrils: NMR evidence from onion and quince.
Plant J
16: 183-190[CrossRef]
-
Heim DR, Roberts JL, Pike PD, Larrinua IM
(1989)
Mutation of a locus of Arabidopsis thaliana confers resistance to the herbicide isoxaben.
Plant Physiol
90: 146-150[Abstract/Free Full Text]
-
Heim DR, Roberts JL, Pike PD, Larrinua IM
(1990a)
A second locus, Ixr B1 in Arabidopsis thaliana, that confers resistance to herbicide isoxaben.
Plant Physiol
92: 858-861[Abstract/Free Full Text]
-
Heim DR, Skomp JR, Tschabold EE, Larrinua I
(1990b)
Isoxaben inhibits the synthesis of acid-insoluble cell wall materials in Arabidopsis thaliana.
Plant Physiol
93: 695-700[Abstract/Free Full Text]
-
Heim DR, Skomp JR, Waldron C, Larrinua IM
(1991)
Differential response to isoxaben of cellulose biosynthesis by wild-type and resistance strains of Arabidopsis thaliana.
Pestic Biochem Physiol
39: 93-99[CrossRef]
-
Herth W
(1983)
Arrays of plasma-membrane "rosettes" involved in cellulose microfibril formation of Spirogyra.
Planta
159: 347-356[CrossRef]
-
Huggenberger F, Jennings EA, Ryan PJ, Burow KW
(1982)
Isoxaben, a new selective herbicide for use in cereals.
Weeds
1: 47
-
Kimura S, Laosinchai W, Itoh T, Cui X, Linder R, Brown R
(1999)
Immunogold labeling of rosette terminal cellulose-synthase complexes in the vascular plant Vigna angularis.
Plant Cell
11: 2075-2085[Abstract/Free Full Text]
-
Lane DR, Wiedemeier A, Peng L, Höfte H, Vernhettes S, Desprez T, Hocart CH, Birch RJ, Baskin TI, Burn JE, et al
(2001)
Temperature-sensitive alleles of rsw2 link the korrigan endo-1,4-
-glucanase to cellulose synthesis and cytokinesis in Arabidopsis.
Plant Physiol
126: 278-288[Abstract/Free Full Text] -
Lister C, Dean C
(1993)
Recombinant inbred lines for mapping RFLP and phenotypic markers in Arabidopsis thaliana.
Plant J
4: 745-750[CrossRef][ISI]
-
Lukowitz W, Nickle TC, Meinke DW, Last RL, Conklin PL, Somerville CR
(2001)
Arabidopsis cyt1 mutants are deficient in a mannose-1-phosphate guanylyltransferase and point to a requirement of N-linked glycosylation for cellulose biosynthesis.
Proc Natl Acad Sci USA
98: 2262-2267[Abstract/Free Full Text]
-
Nicol F, His I, Jauneau A, Vernhettes S, Canut H, Höfte H
(1998)
A plasma membrane-bound putative endo-1,4-
-D-glucanase is required for normal wall assembly and cell elongation in Arabidopsis.
EMBO J
17: 5563-5576[CrossRef][ISI][Medline] -
Pear JR, Kawagoe Y, Schreckengost WE, Delmer DP, Stalker DM
(1996)
Higher plants contain homologs of the bacterial celA genes encoding the catalytic subunit of cellulose synthase.
Proc Natl Acad Sci USA
93: 12637-12642[Abstract/Free Full Text]
-
Peng L, Xiang F, Roberts E, Kawagoe Y, Greve LC, Kreuz K, Delmer DP
(2001)
The experimental herbicide CGA 325'615 inhibits synthesis of crystalline cellulose and causes accumulation of non-crystalline
-1,4-glucan associated with CesA protein.
Plant Physiol
126: 981-992[Abstract/Free Full Text] -
Sabba RP, Vaughn KC
(1999)
Herbicides that inhibit cellulose biosynthesis.
Weed Sci
47: 757-763
-
Sambrook J, Fritsch EF, Maniatis T
(1989)
Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
-
Sato S, Kato T, Kakegawa K, Ishii T, Liu YG, Awano T, Takabe K, Nishiyama Y, Kuga S, Nakamura Y, et al
(2001)
Role of the putative membrane-bound endo-1,4-
-glucanase KORRIGAN in cell elongation and cellulose synthesis in Arabidopsis thaliana.
Plant Cell Physiol
42: 251-263[Abstract/Free Full Text] -
Scheible WR, Eshed R, Richmond T, Delmer D, Somerville C
(2001)
Modifications of cellulose synthase confer resistance to isoxaben and thiazolidinone herbicides in Arabidopsis Ixr1 mutants.
Proc Natl Acad Sci USA
98: 10079-10084[Abstract/Free Full Text]
-
Taylor N
(2001)
Molecular genetic analysis of cellulose synthesis in Arabidopsis: Conference proceedings of plant protein club workshop: added value products from plants 2: cell wall components. Presented at University of York, March 21-23, 2001, pp 29
-
Taylor NG, Laurie S, Turner SR
(2000)
Multiple cellulose synthase catalytic subunits are required for cellulose synthesis in Arabidopsis.
Plant Cell
12: 2529-2540[Abstract/Free Full Text]
-
Taylor NG, Scheible WR, Cutler S, Somerville CR, Turner SR
(1999)
The irregular xylem3 locus of Arabidopsis encodes a cellulose synthase required for secondary cell wall synthesis.
Plant Cell
11: 769-780[Abstract/Free Full Text]
-
Van Lijsebettens M, Wang X, Cnops G, Boerjan W, Desnos T, Höfte H, Van Montagu M
(1996)
Transgenic Arabidopsis tester lines with dominant marker genes.
Mol Gen Genet
251: 365-372[Medline]
© 2002 American Society of Plant Physiologists
This article has been cited by other articles:

|
 |

|
 |
 
A. Brux, T.-Y. Liu, M. Krebs, Y.-D. Stierhof, J. U. Lohmann, O. Miersch, C. Wasternack, and K. Schumacher
Reduced V-ATPase Activity in the trans-Golgi Network Causes Oxylipin-Dependent Hypocotyl Growth Inhibition in Arabidopsis
PLANT CELL,
April 1, 2008;
20(4):
1088 - 1100.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Lu, L. Li, X. Yi, C. P. Joshi, and V. L. Chiang
Differential expression of three eucalyptus secondary cell wall-related cellulose synthase genes in response to tension stress
J. Exp. Bot.,
February 16, 2008;
(2008)
erm350v1.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. DeBolt, R. Gutierrez, D. W. Ehrhardt, and C. Somerville
Nonmotile Cellulose Synthase Subunits Repeatedly Accumulate within Localized Regions at the Plasma Membrane in Arabidopsis Hypocotyl Cells following 2,6-Dichlorobenzonitrile Treatment
Plant Physiology,
October 1, 2007;
145(2):
334 - 338.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Desprez, M. Juraniec, E. F. Crowell, H. Jouy, Z. Pochylova, F. Parcy, H. Hofte, M. Gonneau, and S. Vernhettes
Organization of cellulose synthase complexes involved in primary cell wall synthesis in Arabidopsis thaliana
PNAS,
September 25, 2007;
104(39):
15572 - 15577.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Persson, A. Paredez, A. Carroll, H. Palsdottir, M. Doblin, P. Poindexter, N. Khitrov, M. Auer, and C. R. Somerville
Genetic evidence for three unique components in primary cell-wall cellulose synthase complexes in Arabidopsis
PNAS,
September 25, 2007;
104(39):
15566 - 15571.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Li, C. Smith, F. Corke, L. Zheng, Z. Merali, P. Ryden, P. Derbyshire, K. Waldron, and M. W. Bevan
Signaling from an Altered Cell Wall to the Nucleus Mediates Sugar-Responsive Growth and Development in Arabidopsis thaliana
PLANT CELL,
August 1, 2007;
19(8):
2500 - 2515.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Hernandez-Blanco, D. X. Feng, J. Hu, A. Sanchez-Vallet, L. Deslandes, F. Llorente, M. Berrocal-Lobo, H. Keller, X. Barlet, C. Sanchez-Rodriguez, et al.
Impairment of Cellulose Synthases Required for Arabidopsis Secondary Cell Wall Formation Enhances Disease Resistance
PLANT CELL,
March 1, 2007;
19(3):
890 - 903.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Chu, H. Chen, Y. Zhang, Z. Zhang, N. Zheng, B. Yin, H. Yan, L. Zhu, X. Zhao, M. Yuan, et al.
Knockout of the AtCESA2 Gene Affects Microtubule Orientation and Causes Abnormal Cell Expansion in Arabidopsis
Plant Physiology,
January 1, 2007;
143(1):
213 - 224.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Van Damme, S. Coutuer, R. De Rycke, F.-Y. Bouget, D. Inze, and D. Geelen
Somatic Cytokinesis and Pollen Maturation in Arabidopsis Depend on TPLATE, Which Has Domains Similar to Coat Proteins
PLANT CELL,
December 1, 2006;
18(12):
3502 - 3518.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Wang, P. A. Howles, A. H. Cork, R. J. Birch, and R. E. Williamson
Chimeric Proteins Suggest That the Catalytic and/or C-Terminal Domains Give CesA1 and CesA3 Access to Their Specific Sites in the Cellulose Synthase of Primary Walls
Plant Physiology,
October 1, 2006;
142(2):
685 - 695.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. R. Paredez, C. R. Somerville, and D. W. Ehrhardt
Visualization of Cellulose Synthase Demonstrates Functional Association with Microtubules
Science,
June 9, 2006;
312(5779):
1491 - 1495.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Robert, A. Bichet, O. Grandjean, D. Kierzkowski, B. Satiat-Jeunemaitre, S. Pelletier, M.-T. Hauser, H. Hofte, and S. Vernhettes
An Arabidopsis Endo-1,4-{beta}-D-Glucanase Involved in Cellulose Synthesis Undergoes Regulated Intracellular Cycling
PLANT CELL,
December 1, 2005;
17(12):
3378 - 3389.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Refregier, S. Pelletier, D. Jaillard, and H. Hofte
Interaction between Wall Deposition and Cell Elongation in Dark-Grown Hypocotyl Cells in Arabidopsis
Plant Physiology,
June 1, 2004;
135(2):
959 - 968.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. A. Burton, N. J. Shirley, B. J. King, A. J. Harvey, and G. B. Fincher
The CesA Gene Family of Barley. Quantitative Analysis of Transcripts Reveals Two Groups of Co-Expressed Genes
Plant Physiology,
January 1, 2004;
134(1):
224 - 236.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Tanaka, K. Murata, M. Yamazaki, K. Onosato, A. Miyao, and H. Hirochika
Three Distinct Rice Cellulose Synthase Catalytic Subunit Genes Required for Cellulose Synthesis in the Secondary Wall
Plant Physiology,
September 1, 2003;
133(1):
73 - 83.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. A. Eckardt
Cellulose Synthesis Takes the CesA Train
PLANT CELL,
August 1, 2003;
15(8):
1685 - 1687.
[Full Text]
[PDF]
|
 |
|
|