|
Plant Physiol, March 2002, Vol. 128, pp. 911-923
The Expression of an Extensin-Like Protein Correlates with
Cellular Tip Growth in Tomato1
Marcel
Bucher,*
Silvia
Brunner,
Philip
Zimmermann,
Gerardo I.
Zardi,
Nikolaus
Amrhein,
Lothar
Willmitzer, and
Jörg W.
Riesmeier
Federal Institute of Technology (Eidgenössische
Technische Hochschule [ETH]) Zurich, Institute of Plant Sciences,
Experimental Station Eschikon 33, CH-8315 Lindau, Switzerland (M.B.,
S.B., P.Z., G.I.Z.); Federal Institute of Technology (ETH) Zurich,
Institute of Plant Sciences, Universitätsstrasse 2, CH-8092
Zurich, Switzerland (N.A.); Max-Planck-Institute of Molecular Plant
Physiology, D-14424 Potsdam, Germany (L.W.); and PlantTec
Biotechnology, Hermannswerder 14, D-14473 Potsdam, Germany (J.W.R.)
 |
INTRODUCTION |
Extensins are abundant
proteins presumed to determine physical characteristics of the plant
cell wall. We have cloned a cDNA encoding LeExt1 from a
tomato (Lycopersicon esculentum Mill.) root hair cDNA
library. The deduced sequence of the LeExt1 polypeptide defined a novel
type of extensin-like proteins in tomato. Patterns of mRNA distribution
indicated that expression of the LeExt1 gene was
initiated in the root hair differentiation zone of the tomato rhizodermis. Cloning of the corresponding promoter and fusion to the
-glucuronidase (GUS) reporter gene allowed detailed examination of
LeExt1 expression in transgenic tomato plants. Evidence is presented for a direct correlation between LeExt1 expression
and cellular tip growth. LeExt1/GUS expression was
detectable in trichoblasts (=root hair-bearing cells), but not in
atrichoblasts of the tomato rhizodermis. Both hair formation and
LeExt1 expression was inducible by the plant hormone
ethylene. Comparative analysis of the LeExt1/GUS expression
was performed in transgenic tomato, potato (Solanum tuberosum), tobacco (Nicotiana tabacum), and
Arabidopsis plants. In the apical/basal dimension, GUS staining was
absent from the root cap and undifferentiated cells at the root tip in
all species investigated. It was induced at the distal end of the
differentiation zone and remained high proximally to the root/hypocotyl
boundary. In the radial dimension, GUS expression was root hair
specific in the solanaceous species. Whereas LeExt1 mRNA was
exclusively detectable in the rhizodermis, root hair-specific
expression correlated with GUS expression in germinating pollen tubes.
This is correlative evidence for a role of LeExt1 in root hair tip growth.
Rhizodermal cells differentiate in the root meristem after asymmetric
division from initial cells (Dolan et al., 1993 ). During rhizodermis
development in Arabidopsis, these cells specialize further into two
distinct cell types, rhizodermal cells without root hairs
(atrichoblasts) and root hair-bearing cells (trichoblasts). Once
initiated, root hair growth is characterized by oriented tip growth,
comparable with that in a growing pollen tube. The zone of growth is
restricted to the tip of the growing cell (Sievers and Schnepf, 1981 ).
As a consequence of oriented cell elongation, the hair extends into the
yet-unexplored rhizosphere, where it acquires water and nutrients from
the soil solution to sustain plant growth.
Root hair development is amenable to genetic dissection and has proved
in the past to be a useful model system to study the molecular
mechanisms regulating cell differentiation in Arabidopsis (Schiefelbein
and Somerville, 1990 ). Several loci have been reported to be involved
in rhizodermal cell patterning (Galway et al., 1994 ; Wada et al., 1997 )
and root hair initiation (Schiefelbein and Somerville, 1990 ; Masucci
and Schiefelbein, 1994 ; Schneider et al., 1997 , 1998 ). A minimum of
five genes, rhd2, rhd3, rhd4, tip1, and cow1 are involved in hair elongation
(Grierson et al., 1997 ; Ryan et al., 1998 ). Mutations within these
genes lead to abnormalities in root hair shape and elongation. It is
interesting that Arabidopsis tip1 mutants exhibit disruption of both
root hair and pollen tube growth, suggesting that the TIP1 protein is
important for tip growth (Schiefelbein et al., 1993 ).
During rapid root hair expansion, the synthesis of the plasma membrane
and cell wall material must represent a major metabolic load. The site
of deposition of this material is confined to the expanding tip, thus
leading to the tubular morphology. Several factors are involved in the
regulation of root hair growth. Oriented tip growth correlates well
with a steep [Ca2+]cyt
gradient in the growing hair (Wymer et al., 1997 ). Upon cessation of
growth, the gradient dissipates. Vice versa, disruption of the
tip-focused gradient of
[Ca2+]cyt inhibits root
hair growth. Another component involved in the regulation of tip growth
is the microtubule cytoskeleton. Microtubule-depolymerizing agents
cause a waving growth habit of the growing hairs and the formation of
multiple growing points (Bibikova et al., 1999 ). Other components
contributing to the elongation or the morphology of tip-growing cells
are likely to be located in the cell wall (Gilroy and Jones,
2000 ).
The cell wall affects cell form and function. The protein component of
the cell wall contains both enzymes and structural proteins. So far,
the best characterized structural cell wall protein is extensin
(Showalter, 1993 ; Cassab, 1998 ), a member of the family of Hyp-rich
glycoproteins (HRGPs) that are among the most abundant proteins present
in the cell wall of higher plants. Gene expression of HRGPs is
developmentally regulated in a tissue-specific manner (Ye and Varner,
1991 ). For example, the tobacco HRGPnt3 gene is specifically
expressed in a subset of the pericycle and endodermal cells from which
a lateral root initiates (Keller and Lamb, 1989 ). A soybean
(Glycine max) extensin gene, SbHRGP3, is
expressed in hypocotyl and roots of seedlings (Ahn et al., 1996 ). This
was shown by using an SbHRGP3 promoter-GUS chimeric gene
that was expressed in the rhizodermal cells of the zone from which the
lateral root was to be initiated. mRNAs of extensin-like proteins
recently have been shown to be highly abundant in root hairs of tomato
and cowpea (Vigna unguiculata; Arsenijevic-Maksimovic et al., 1997 ; Bucher et al., 1997 ). HRGPs are subject to extensive posttranslational modification. Pro residues are hydroxylated by prolyl
hydroxylase. Carbohydrates subsequently are attached to the Hyp
residues and probably serve to stabilize the protein into a rigid
rod-like structure (Showalter, 1993 ). The mature extensin protein is
generally rich in Hyp and Ser and some combination of the amino acids
Tyr, Lys, Val, and His. Extensins of dicot plants usually contain the
repeating pentapeptide Ser-Hyp4, often within the
context of other larger repeating motifs. Isodityrosine linkages that
are presumably formed by peroxidases (Schnabelrauch et al., 1996 ) have
been suggested to cross-link extensins in the cell wall, thus leading
to insolubilization of the proteins and cell wall strengthening, e.g.
as a response to pathogen attack (Epstein and Lamport, 1984 ; Brisson et
al., 1994 ) or to confer mechanical resistance to load-bearing cells
(Keller and Lamb, 1989 ; Tiré et al., 1994 ).
In this study, we describe LeExt1 (accession no. AJ417830),
a novel gene encoding an extensin-like protein in tomato. Its expression correlates with tip growth, which suggests a role of the
LeExt1 protein in root hair expansion. Moreover, comparative studies of
four different transgenic plant species expressing an
LeExt1/GUS chimeric gene indicate the existence of common
mechanisms involved in the regulation of apical/basal polarity in root
gene expression.
 |
RESULTS |
LeExt1 Encodes a Putative Cell Wall Protein from
Tomato
The LeExt1 cDNA was identified in the course of a
differential screening of a tomato root hair-specific cDNA library,
which was set up to identify root hair-specific genes (Bucher
et al., 1997 ). The cDNA is 1,419 bp long, including a
putative initiator ATG at its 5' end and a
poly(A+) tail. The deduced amino acid sequence
revealed the repetitive nature of the polypeptide (Fig.
1A). Hydropathy analysis (Kyte and
Doolittle, 1982 ) indicated that the encoded protein is hydrophilic, carrying a hydrophobic N-terminal leader sequence (Fig. 1B). The hydrophobic segment at the N terminus has the
characteristics typical of a signal peptide for
translocation into the endoplasmic reticulum, and based on the
rules of von Heijne (1986) , the cleavage site is located
carboxyterminal of an Ala (marked with an arrow in Fig. 1A). The
predicted mature protein consists of 385 amino acids and has a
predicted molecular mass of 42.2 kD and a calculated pI of 9.2. Assuming that cleavage does occur after the designated Ala,
mature LeExt1 extending from amino acids 28 through 385 is rich in Lys
(19%), Ser (14%), Pro (14%), Tyr (12%), Glu (10%), and Val (8%).
Thus, these seven amino acids together comprise 77 mol % of the
protein. Similar to other HRGPs the polypeptide is composed of several
repeating motifs rich in Lys, Tyr, Pro, and Ser (Fig. 1A).

View larger version (33K):
[in this window]
[in a new window]
|
Figure 1.
Peptide structure of LeExt1 and genomic DNA
gel-blot analysis. A, Deduced LeExt1 amino acid sequence. Repetitive
amino acid units (indicated in bold) are arranged to emphasize various
amino acid repeat units and their periodicity. The signal peptide is
underlined and the putative cleavage site is marked with an arrow. B,
Hydropathy plot of LeExt1 polypeptide. Hydrophilicity and
hydrophobicity values are indicated at left. C, Genomic DNA was
digested with the designated restriction enzymes. The LeExt1
cDNA was used as a radioactive probe. The positions of DNA marker
fragments and their lengths in kb are indicated at left.
|
|
A sequence similarity search through the GenEMBL database revealed
highest similarities of LeExt1 to the published Dif10 and Dif54
extensin-like proteins from tomato root hairs (Bucher et al., 1997 ), to
an Arabidopsis periaxin-like protein (accession no. CAB89377)
exhibiting similarity to periaxin from rat (Rattus
norvegicus) (Gillespie et al., 1994 ), and to the marine mussel (Mytilus edulis) polyphenolic adhesive protein
(Filpula et al., 1990 ). Expect (E) values according to the BLAST search results were 8e 20,
20e 15, 3e 14, and
9e 13, respectively (an E value of 1 meaning
that in a database of the current size, one might expect to see one
match with a similar score simply by chance). All these proteins are
rich in at least some of the amino acids Tyr, Pro, Lys, Ser, Val, and
Glu. Comparison with both Dif10 and Dif54 extensin-like proteins
revealed that specifically spaced repetitive elements contribute to the
sequence similarity rather than identity across a large region of
LeExt1 that is similar with the compared proteins (Fig.
2). These elements are characterized by
the following di-, tri-, and pentapeptides: YK, PS, YYK, and
YY/F/KKS/K/AP, where bold faced
letters in the latter designate conserved amino acids in the one-letter
code.

View larger version (88K):
[in this window]
[in a new window]
|
Figure 2.
Alignment of the deduced amino acid sequence of
LeExt1 with that of Dif10 and Dif54. Identical amino acids are shaded
in black, similar amino acids are shaded in gray. The conserved
pentapeptides YxKxP and SPPPP are underlined.
|
|
To get an indication of the number of related genes in the tomato
genome, genomic DNA was digested with four different restriction enzymes of which EcoRI, EcoRV, and
HindIII do not cut within the cDNA sequence, and the
restricted DNA was subjected to genomic DNA gel-blot analysis (Fig.
1C). The radioactively labeled LeExt1 cDNA hybridized to up
to five DNA fragments under stringent conditions, thus suggesting the
existence of a small multigene family of the corresponding gene in
tomato. This was substantiated by the cloning of two -clones with
high similarity to the LeExt1 cDNA sequence (see below).
These results qualify LeExt1 as a novel extensin-like protein that is
most likely localized in the cell wall.
LeExt1 Transcripts Accumulate in Rhizodermal Cells
The radioactively labeled LeExt1 cDNA was used for the
analysis of corresponding transcript levels. It hybridized to a single band of 1.4 kb on the RNA gel blot (Fig.
3, A and B). Transcript levels were
severalfold higher in root hairs as compared with primary roots with
their hairs stripped off (designated stripped roots; Fig. 3A). No
signals were detected in the hypocotyl, the cotyledons, and leaves. As
a control, Rpl2 transcripts (encoding ribosomal protein L2)
were detectable in all organs. Rpl2 is a relatively
well-characterized housekeeping gene that should reflect constitutive
expression (Fleming et al., 1993 ). Its expression fluctuated somewhat
between samples, probably representing different translational
activities in the respective tissues. Thus, the results indicated high
abundance of LeExt1 mRNA in root hairs of the tomato
seedling.

View larger version (44K):
[in this window]
[in a new window]
|
Figure 3.
LeExt1 transcript abundance in
seedlings and flowering plants. A, RNA gel-blot analysis was performed
with 5 µg of total RNA from seedling root hairs, stripped roots,
hypocotyls, cotyledons, and mature leaves and hybridized with randomly
labeled cDNA probes, as indicated at left. A cDNA encoding 25S rDNA
from tomato served as a control for equal loading of total RNA on the
gel and equal transfer to the membrane. Transcript sizes are indicated
at right. B, RNA gel-blot analysis was performed with 5 µg of total
RNA from stripped seedling roots and root hairs, and with 10 µg of
total RNA from the organs indicated and hybridized with randomly
labeled cDNA probes, as indicated at left. Transcript sizes are
indicated at right.
|
|
To investigate whether LeExt1 is expressed in shoot organs
of tomato at later stages in development, total RNA from various organs
of soil-grown plants from the greenhouse was run on a gel (Fig. 3B). No
transcripts of the gene were detected in these organs, whereas
Rpl2 mRNA was detectable in all lanes on the blot. No signal
was detectable with RNA from roots of soil-grown plants (lane 3). This
can be explained by the microscopic observation that removal by careful
washing of soil particles bound to the roots before RNA extraction also
removed the root hairs. Thus, RNA gel-blot analysis clearly indicated
root-specific expression of LeExt1 in tomato roots with
preferential expression in root hairs.
In situ hybridization studies further allowed cell-specific
localization of LeExt1 mRNA in tomato primary roots (Fig.
4). LeExt1 transcripts were
exclusively detected in rhizodermal cells in the differentiation zone
(Fig. 4, A and B). No signals were observed in root cap, meristematic,
and elongating cells at the root tip. Sense RNA as a hybridizing probe
did not give rise to a signal (Fig. 4C), and Rpl2
transcripts were abundant in all cells (Fig. 4D). In general, staining
occurred in vacuolated rhizodermal cells adjacent to the elongation
zone of young seedling roots. Thus, high LeExt1 transcript
abundance correlates with differentiation of rhizodermal cells.

View larger version (57K):
[in this window]
[in a new window]
|
Figure 4.
Localization of LeExt1 transcripts in
tomato seedling roots. A through D, Bright-field microscopy of root
sections. Shown in A and B are sections hybridized with the
LeExt1 antisense probe. The purple dye reflects
LeExt1 mRNA. C, Section hybridized with the
LeExt1 sense probe as a negative control. D, Section
hybridized with an antisense Rpl2 probe as a positive
control. Bar = 0.25 mm in A through C; bar = 0.125 mm in
D.
|
|
Cloning of the LeExt1 Promoter
To allow a more thorough study of LeExt1 gene
expression, we isolated a -clone of 3,417 bp from a tomato genomic
library. The sequence determined had an identical overlap at its 3' end with 204 bp of the 5' end of the LeExt1 cDNA (Fig.
5) and thus was assumed to contain the
LeExt1 promoter. Two additional clones were partially
sequenced and exhibited >80% sequence similarity to the
LeExt1 cDNA (data not shown). Sequence comparison of the putative LeExt1 promoter-containing fragment
with the respective cDNA revealed a stop codon upstream of the putative
initiator ATG. Approximately 80 bp upstream of the putative start ATG,
the sequence TATATAAA resembling a TATA box is present. A search for transcription factor-binding sites using the TFSEARCH algorhithm with a
threshold score of greater than 85 revealed that the 3,181 bp upstream
of the LeExt1 ORF contained the conserved motifs of Athb-1-,
MYB.Ph3-, P-, and SBF-1-binding boxes (Fig. 5).

View larger version (49K):
[in this window]
[in a new window]
|
Figure 5.
Upstream sequence of the LeExt1 gene.
Bold letters underlined with dashed arrows indicate putative binding
sites of transcription factors P, MYB.Ph3, SBF-1, and Athb-1 as
determined using TFSEARCH. Bold arrows on top of a base indicate the
start of the different promoter fragments as indicated to the right.
The TATA box is underlined and indicated in bold. An asterisk indicates
a stop codon upstream of the open reading frame (ORF) in the genomic
sequence. Amino acids encoded by the ORF are given in the one letter
code. Bold letters designate the N terminus of the LeExt1
protein.
|
|
Tobacco and tomato plants transformed with the full promoter sequence
fused to the GUS gene did not produce visible GUS staining (data not
shown). This led us to speculate that silencing protein factors binding
to any of the promoter regions might lead to GUS supression. Next,
exact translational fusions at the initiator ATG were constructed
between the GUS reporter gene and serial deletions of the
LeExt1 promoter sequence (Fig.
6A). Transgenic tobacco plants were
raised and the level of GUS activity in roots of at least 15 independent lines that had been transformed with each of the constructs
shown in Figure 6 was microscopically estimated. This analysis revealed
strong GUS staining in 75% of the lines transformed with the
gen1.1/GUS gene (Fig. 6B). Roots carrying the longer gen1.7 and
gen2.2 fragments, respectively, hardly stained blue and roots
carrying the two shorter fragments gen0.9 and gen0.6 exhibited
weaker staining. In F1 tobacco seedlings, strong
GUS expression was detectable in young regions of the root including
the root hairs and to lower degrees in the hypocotyl, petioles, and the
margin of leaf blades. GUS was normally absent from the root tip.
Plants showing GUS staining in root hairs also gave rise to GUS
activity in dry pollen and germinating pollen tubes (data not shown).
No changes in developmental regulation of the GUS expression driven by
the different promoters were observed, i.e. the spatial pattern of
expression was the same.

View larger version (33K):
[in this window]
[in a new window]
|
Figure 6.
Qualitative GUS assay in gen/GUS tobacco
plants. A, Schematic drawing of the constructs used. The drawing is to
scale. Negative numbers indicate the length of the promoter fragments.
NcoI designates the fusion site at the ATG of the GUS gene.
NOS is the nopaline synthase transcriptional terminator. Bold lines
indicate vector sequence. B, Visual evaluation of GUS staining in roots
of T0 lines, containing the promoter constructs as indicated in A. The
number of independently transformed lines exhibiting strong GUS
staining is listed. The total number of lines analyzed is given in
parentheses.
|
|
Tissue Specificity of LeExt1 Expression
The generation of deletions of the -clone proved to be
essential to assay histochemical GUS expression in more details and the
gen1.1 fragment was selected as the strongest promoter for further
studies. The gen1.1/GUS chimeric gene was then introduced into
tomato, potato, and Arabidopsis. Similar to the situation in tobacco,
GUS staining was absent from the emerging radicle in germinating tomato
seedlings (Fig. 7A). Whereas expression of the GUS gene was readily detectable in the region where root hairs
were being formed (Fig. 7B), there was no expression in the root tip
and the hypocotyl (Fig. 7C). The pattern of gene expression of the
chimeric gene thus corresponded to the pattern of mRNA distribution
(Fig. 4). Similar to tobacco, GUS expression was observed in dry pollen
and the germinating pollen tube of tomato (Fig. 7, D and E) and potato,
but not in Arabidopsis pollen (data not shown). In contrast to
gen1.1 promoter activity in pollen, RNA gel-blot analysis using 30 µg of total RNA from tomato anthers and the LeExt1 cDNA as
a probe did not result in detectable signals. Reverse
transcription (RT)-PCR failed to detect significant LeExt1 transcript concentrations in anthers and leaves,
whereas a strong signal was obtained with RNA extracted from either
wild-type roots or leaves from transgenic tomato plants constitutively
expressing LeExt1 (Fig. 8).
Used as a positive control, Rpl2 transcripts were abundant
in all organs investigated. Non-reverse transcribed template RNA did
not give rise to detectable signals on the blot. This demonstrated
negligible relative abundance of LeExt1 mRNA in pollen and
leaf as compared with the root, indicating that the endogenous
LeExt1 gene is not or only very weakly expressed in pollen.
Root specificity of the promoter in vegetative organs was conserved
between tomato, potato, and Arabidopsis (Fig.
9, A-C). In all three species, GUS
staining was absent from developing cells at the primary root tip and
was initiated at the distal end of the differentiation zone where hairs
were being formed (Fig. 9, D-F). The same staining pattern was
observed in lateral roots. The indigo dye never accumulated in cells
above the root/hypocotyl junction. Cross sections of GUS-stained roots
revealed rhizodermis-specific expression in the two solanaceous
species, whereas in Arabidopsis, GUS activity was detectable in
rhizodermal cells, in the cortex including the endodermis, and in the
stele (Fig. 9, G-I). Rhizodermis specificity was also observed in
hairy roots of Medicago truncatula after inoculation with
Agrobacterium rhizogenes that were transformed with a binary
vector carrying the gen1.1/GUS chimeric gene (R. Geurts, personal
communication; data not shown). Therefore, we conclude that the
regulatory mechanisms that control the apical/basal polarity of
gen1.1 promoter activity are similar in different plant species. The
regulation of rhizodermis-specific expression is conserved within the
solanaceous species (and M. truncatula), whereas absence of
rhizodermis-specific expression correlates with absence of expression
in tip-growing pollen in Arabidopsis.

View larger version (122K):
[in this window]
[in a new window]
|
Figure 7.
Histochemical localization of GUS activity in
germinating tomato seeds and pollen. Tomato plants were transformed
with the gen1.1/GUS construct. A through C, F1
seeds at various stages of germination assayed for GUS activity. D and
E, Pollen harvested from dehisced anthers and germinated in vitro. Bar
in A through C = 1 mm; bar in D = 0.1 mm; bar in E = 0.01 mm.
|
|

View larger version (36K):
[in this window]
[in a new window]
|
Figure 8.
Comparison of LeExt1 and
Rpl2 transcript levels in tomato tissues by RT-PCR. RT-PCR
was performed with total RNA from roots, leaves, and anthers and
hybridized with randomly labeled cDNA probes, as indicated at left. RNA
from leaves of transgenic plants constitutively expressing
LeExt1 served as a control for primer specificity (control).
RNA samples that were not subjected to reverse transcription ( rt)
served as a control to determine residual amounts of genomic DNA in the
samples (absent in rt treatments). Black columns indicate relative
abundance of transcripts as determined by phosphorimager analysis. The
signal for root RNA was arbitrarily set to 100%.
|
|

View larger version (122K):
[in this window]
[in a new window]
|
Figure 9.
Histochemical localization of GUS activity in
transgenic tomato, potato, and Arabidopsis. A, D, and G, Expression of
the gen1.1/GUS chimeric gene in seedlings of tomato; B, E, and H,
potato; C, F, and I, Arabidopsis. D through F, Stereomicroscopy images
of GUS-stained root tips. G through I, Bright-field microscopy images
of resin-imbedded cross sections of stained roots using Nomarski
optics. Bar in A and B = 2 mm; bar in C = 1 mm; bar in D and
E = 0.5 mm; bar in F = 0.2 mm; bar in G through I = 0.05 mm.
|
|
Trichoblast-Specific Expression of LeExt1 in the
Rhizodermis
The plant hormones ethylene and auxin have been reported to affect
the production of root hair and hairless cells in the Arabidopsis root
(Masucci and Schiefelbein, 1996 ). We examined the influence of auxin
and ethylene on tomato root development and gen1.1/GUS expression.
Root exposure to auxin and auxin transport inhibitors gave rise to
shorter roots, but no clear difference in root hair length or intensity
of GUS staining was observed when compared with controls (data not
shown). Exposure to L- -(2-aminoethoxyvinyl)Gly (AVG), an
inhibitor of ethylene synthesis, reduced root elongation (data not
shown) and inhibited root hair development in tomato primary roots,
thus giving rise to the formation of atrichoblasts as was determined by
microscopical analysis (Fig. 10B). GUS
staining in these roots was absent from atrichoblasts and was only
observed in trichoblasts with hairs being formed before or shortly
after the transfer to AVG-containing medium, whereas untreated roots expressed the GUS gene in all rhizodermal cells (Fig. 10A). Upon exposure to the ethylene-releasing agent ethephon in the medium, root
hairs were ectopically induced near the root tip of controls and in the
hair-free zone of AVG-treated roots. These ectopic hairs
uniformly expressed GUS (Fig. 10C). LeExt1 promoter-driven GUS expression remained unchanged after infection of transgenic potato
roots with either Phytophtora spp. or arbuscular-mycorrhizal fungi (V. Karandashov, personal communication; data not shown). Tomato
var. Moneymaker lines expressing the LeExt1 cDNA
under the control of the 35S CaMV constitutive promoter were raised. Plants constitutively expressing the transgene as shown by RNA gel-blot
analysis (data not shown, see also Fig. 8) were further investigated
for visible phenotypes. All phenotypic parameters analyzed, including
root and root cell expansion, shoot growth, leaf epidermal cell
expansion, and pollen tube growth, remained unchanged in comparison
with wild type (data not shown). Moreover, constitutive expression of
LeExt1 in the roots did not mediate an increased resistance to root
nematodes (D. Trudgill, personal communication; data not shown). Thus,
overall we can conclude that LeExt1 expression correlated
with root hair formation and hair expansion and is most likely not
involved in pathogen defense.

View larger version (56K):
[in this window]
[in a new window]
|
Figure 10.
Modulation of ethylene biosynthesis and root hair
development. A, gen1.1/GUS tomato seeds were germinated on control
medium. At a primary root length of 3 to 5 mm, control seedlings were
transferred to fresh medium for 2 d before GUS activity was
assayed. B, Seedling root grown in presence of 20 µM AVG
and stained for GUS activity after pretreatment as described in A. C, Ectopic root hairs 2 d after transfer to medium containing AVG
and 1 mM ethephon. Bar in A = 1 mm; bar in B = 0.5 mm; bar in C = 0.2 mm.
|
|
 |
DISCUSSION |
In this study, the tomato LeExt1 cDNA was cloned via
differential screening of a root hair-specific cDNA library. The
corresponding upstream genomic sequence was subsequently obtained from
a genomic tomato library screen. RNA localization and promoter-GUS
fusion studies in tomato primary roots revealed that LeExt1
expression is associated with root hair formation and elongation and is
controlled by ethylene. The tissue specificity of the promoter in roots
was conserved in three solanaceous species, whereas in Arabidopsis, GUS
expression was detectable in all differentiated root cells. Ectopic
expression of LeExt1 in cells other than root hairs is not sufficient
to phenotypically change cell shape or elongation.
In our efforts to clone the LeExt1 promoter, we have
encountered the problem that the longer genomic fragments did not give rise to strong GUS expression in the roots, which might be because of
silencer elements within these sequences (Figs. 5 and 6).
Transformation of tobacco with truncated versions of the -clone
fused to GUS has allowed us to perform GUS assays with roots
from primary transformants (Fig. 6) and subsequent selection of the
gen1.1 fragment as the qualitatively strongest promoter for
transformation of tomato, potato, and Arabidopsis.
All rhizodermal cells in tomato may form a hair. These cells are long
and because many are hairless, the hairs appear to be sparsely
distributed over the whole surface. Hairs are more densely developed
for a short distance close to the tip. In this region, the cells are
much shorter than those developed later and almost every cell forms a
long hair (Cormack, 1945 ). Both in situ hybridization (Fig. 4) and
promoter-GUS analysis with tomato seedling roots (Fig. 7) indicated
that LeExt1 expression is absent from the root tip, strongly
induced in the root hair zone, and remained high proximally to the
root-hypocotyl junction. This tip-to-base polarity of gen1.1/GUS
expression in the root is maintained between the different plant
species (Fig. 9), which indicates the existence of common regulatory
mechanisms determining apical/basal polarity of gene expression in
vascular plants. The tight correlation between LeExt1
expression and root hair development (Figs. 7, 9, and 10) indicates
that expression of LeExt1 is regulated by developmental pathways involved in root hair formation. A key player in this regulatory network is the plant hormone ethylene, which strongly promotes root hair development in tomato (Fig. 10) and other plants. Therefore, it is likely that regulatory proteins that are involved in
epidermal cell patterning direct root hair-specific gene expression of
structural cell wall proteins such as LeExt1 at later stages of tomato
epidermis development during hair expansion. Consistent with our
results from Figure 10, the hormone ethylene would then act downstream
of such regulators to promote LeExt1 expression and root hair outgrowth
in tomato. A similar regulatory pathway recently has been suggested for
the expression of the Arabidopsis Pro-rich protein AtPRP3 (Bernhardt
and Tierney, 2000 ).
In a search for transcription factor-binding sites in the
LeExt1 promoter, putative binding sites for four regulatory
proteins were displayed (Fig. 5). Three of them, P, MYB.Ph3, and SBF-1, are involved in flavonoid biosynthesis (Lawton et al., 1991 ; Grotewold et al., 1994 ; Solano et al., 1995 ). Some regulatory genes are known to
affect several independent phenotypes in Arabidopsis. For example, the
TTG protein not only regulates the accumulation of purple anthocyanins
in leaves and stems but also trichome and root hair development (Walker
et al., 1999 ). The fourth protein putatively binding to the
LeExt1 promoter is Athb1, which, like the transcription
factor GL2, is a member of the large homeodomain-Leu zipper protein
family of Arabidopsis (Sessa et al., 1993 ). GL2 and several MYB
transcription factors are required for regulation of root hair
development (DiCristina et al., 1996 ; Lee and Schiefelbein, 1999 ).
Thus, it is tempting to speculate that regulatory proteins may
coordinately regulate root hair development and LeExt1
expression in tomato.
All plant species displaying root hair-specific GUS activity also
exhibited GUS staining in pollen and germinating pollen tubes (Fig. 7).
A similar staining pattern was observed with the shorter fragments
gen0.9 and gen0.6, although at lower intensities (data not
shown). These results show that the gen1.1 promoter activity is
correlated with cellular tip growth rather than specifically with root
hair expansion. In contrast to the GUS expression data, we were unable
to detect LeExt1 mRNA in pollen (Fig. 8), probably because
of rapid degradation of LeExt1 mRNA or suppression of the
endogenous gene in pollen. The LeExt1 promoter analysis
suggests that transcriptional regulators exist in plants that direct
the expression of specific genes in tip-growing cells. The absence of a
similar regulation of GUS expression in Arabidopsis (Fig. 9) may be
because of the fact that the corresponding regulatory proteins in
Arabidopsis do not interact with the tomato gen1.1 promoter
fragment. In the future, the LeExt1 promoter will serve as
an essential tool in attempts to modify root hair gene expression in
solanaceous species.
LeExt1 encodes a novel extensin-like protein that belongs to
a small multigene family (Fig. 1). The protein shares high similarity with the two recently identified two-domain extensin-like proteins Dif10 and Dif54 from tomato because of the presence of repetitive elements contributing to the sequence similarity (Fig. 2). The Ser-Pro4 motif is usually abundant in extensins
and seems to be significant for the structure (Cassab, 1998 ). In
contrast to Dif10 and Dif54, which contain eight and five
Ser-Pro3-6 domains in their C-terminal part,
respectively (Bucher et al., 1997 ), LeExt1 contains a single
Ser-Pro5 domain at the C terminus (Figs. 1A and
2). A putative N-terminal signal peptide for translocation into the
endoplasmic reticulum indicates that LeExt1 is secreted into the
apoplast and thus may play a role in determining physicochemical characteristics of the root hair cell wall. Cell wall strength, rigidity, and extensibility are critical factors determining tip growth
of a root hair. Memelink et al. (1993) reported on the overexpression
and antisense repression of a tobacco extensin that did not result in
an altered phenotype in transgenic plants, although the encoded protein
constituted the majority of HRGPs in roots, stems, and leaves. Thus,
despite the large number of cloned extensins, the function(s) of single
extensin genes are still elusive. Constitutive overexpression of
LeExt1 in transgenic tomato failed to give conclusive
results on the function of the protein. Thus, the biological role of
LeExt1 remains to be determined. Down-regulation strategies for
LeExt1 gene expression may shed more light on LeExt1
function in the future.
 |
Materials And Methods |
Plant Growth Conditions
Various organs were collected from flowering tomato
(Lycopersicon esculentum var. Moneymaker) plants grown in
soil in the greenhouse and were used for RNA extraction. Tomato
seedlings used for root hair isolation were grown as described (Bucher
et al., 1997 ). Seeds were rinsed in 70% (v/v) ethanol, washed in 1.4% (v/v) bleach with Triton X-100, and finally thoroughly
washed with sterile water. Tomato seedling roots were used for in situ hybridization or GUS staining, and were grown on filter paper that had
been soaked in one-half-strength Hoagland solution under sterile
conditions in petri dishes. Potato plantlets and tomato seedlings were
grown in vertically oriented petri dishes on Murashige and Skoog
medium (Murashige and Skoog, 1962 ) with 2% (w/v) Suc and 1%
(w/v) agarose. Arabidopsis seedlings were grown on Murashige and Skoog
medium, pH 5.8, 1% (w/v) Suc, and 1.2% (w/v) agarose. After
incubation of the seeds in the dark at 4°C for 2 to 4 d, the
seedlings were grown in a vertical orientation in a plant tissue
culture incubator (Forma Scientific, Inc., Brouwer AG, Luzern,
Switzerland). For the in vitro pollen tube assay, pollen was collected
from LeExt1 promoter/GUS transgenic lines and allowed to
germinate in germination medium {292 mM Suc,
1 g L 1 [w/v] casein hydrolysate [Difco,
Chemie Brunschwig AG, Basel], 213.25 mM MES
[2-(N-morpholino)-ethanesulfonic acid]-KOH, pH 5.9, 1 mM CaCl2, 1 mM KCl, 0.8 mM
MgSO4, 30 µM
CuSO4, and 1.6 mM
H3BO4}.
To investigate the influence of AVG and ethylene on LeExt1
expression, tomato seedlings containing the gen1.1/GUS construct were first grown on 2× Murashige and Skoog medium (2% [w/v]
Suc). At a primary root length of 3 to 5 mm, seedlings were transferred to medium containing 20 µM AVG (Sigma, Buchs,
Switzerland) for an additional 2 d before GUS activity was
assayed. Alternatively, the seeds were germinated on plates containing
2× Murashige and Skoog medium supplemented with 50 µM AVG for 2 d before they were transferred to medium containing AVG and 1 mM
2-chloroethyl-phosphonic acid (ethephon, Sigma). GUS activity was
assayed between 1 and 2 d later after an additional growth of
about 1 cm.
For the analysis of LeExt1 overexpression in tomato, the
expansion of root, root hair, and leaf epidermal cell was
microscopically investigated using seedling roots and epidermal strips
from the abaxial side of tomato cotyledons and leaves from
greenhouse-grown transgenic plants that were shown to constitutively
express LeExt1 via RNA gel-blot analysis (data not shown).
Pollen tube growth was evaluated microscopically with pollen from
homozygous transgenic plants germinated for 4 h in germination
medium (see above).
Plasmids, Gene Constructs, and Plant Transformation
A differential screen of a root hair-specific cDNA library led
to the isolation of LeExt1 cDNA in the plasmid pBluescript SK (Stratagene, Amsterdam; Bucher et al.,
1997 ). This cDNA then was used to screen a tomato genomic DNA library
(CLONTECH Laboratories, Heidelberg) according to standard protocols
(Sambrook et al., 1989 ). -DNA was prepared according to Locket
(1990) . A genomic DNA fragment of about 3.4 kb in length was isolated
and cloned into pBluescript SK . Sequencing was
performed using T7 DNA polymerase and revealed a 204-bp overlap of the
genomic fragment with the 5' end of the LeExt1 cDNA sequence
and extension into the 5'-upstream non-coding region of the
LeExt1 gene. PCR-directed amplification using
Pyrococcus furiosus DNA polymerase (Stratagene)
yielded a 3.3-kb genomic fragment that was finally cloned into
pBluescript SK . Serial deletions with
exonuclease III and S1 nuclease according to the manufacturer's
protocol (Fermentas, Vilnius. Lithuania) finally yielded five fragments
of approximately 2.2, 1.7, 1.1, 0.9, and 0.6 kb, respectively. These
fragments were subsequently named genx, where x represents the
approximate length of the fragments as listed above. Each of these five
fragments was then cloned with an exact fusion at the putative
initiator ATG of the LeExt1 gene to the GUS marker gene
(Jefferson et al., 1987 ), flanked by the nos 3' terminator
(Depicker et al., 1982 ) into the binary vector Bin19 (Bevan, 1984 ). To
construct the chimeric LeExt1 gene for overexpression in
tomato under the contol of the 35S cauliflower mosaic virus
constitutive promoter, the SmaI-BamHI
LeExt1 cDNA insert was inserted in its forward orientation
into the EcoRV-BamHI sites of a plant expression
cassette containing the 35S cauliflower mosaic virus promoter
and the T-DNA octopine synthase gene terminator in the binary vector
Bin19 (Franck et al., 1980 ; Bevan, 1984 ; Gielen et al., 1984 ).
These constructs were then introduced in Agrobacterium
tumefaciens strain C58C1 containing the pGV2260 plasmid (Deblaere
et al., 1985 ) via electroporation. Transformation of tobacco var.
Samsun, the miniature tomato cv Micro-Tom (Meissner et al., 1997 ) and
tomato cv Moneymaker, and potato var. Désirée was performed
using A. tumefaciens-directed gene transfer essentially as
described by Rosahl et al. (1987) for tobacco, by Fillatti et al.
(1987) for tomato, and by Rocha-Sosa et al. (1989) for potato.
Arabidopsis ecotype C24 was transformed using the in planta transformation method (Bechtold and Pelletier, 1993 ; Katavic et al.,
1994 ).
Computational Analysis
Sequence analysis was performed by using the
Genetics Computer Group software package (Madison, WI; Devreux et al.,
1984 ). The hydropathy analysis was performed according to Kyte and
Doolittle (1982) with a window of nine amino acids. TFSEARCH (vers.
1.3) was used to search for putative transcription factor-binding sites (Heinemeyer et al., 1998 ). The program is available at
http://pdap1.trc.rwcp.or.jp/research/db/TFSEARCH.html. Multiple
sequence alignment was done using ClustalW, accessible at
http://circinus.ebi.ac.uk:6543/cgi-bin/clustalw.cgi. Pretty printing and shading of multiple alignment files was done using Boxshade 3.21 at http://www.ch.embnet.org/software/BOX_form.html.
Gel-Blot Analysis
Genomic DNA and RNA gel-blot analysis were performed as
described (Bucher et al., 1997 ).
RT-PCR
RT-PCR was done according to Borner et al. (2000) . Reverse
transcription using Superscript II RT (Gibco, Bascel) was performed with 1 µg of total RNA, which was extracted as described previously (Bucher et al., 1997 ). A 335-bp LeExt1 fragment was then
amplified by PCR from the cDNA library using the oligonucleotides
AATCCAATTCTTCTCAATGGGAAGC and GCTTCTTGTAGTAGTCATTCTTTGG. As a control,
a 432-bp Rpl2 fragment was amplified using the
oligonucleotides GAGAGGTGCACCACTTGCGC and GGCCAGCAGTTCCTCTTCAC. All PCR
reactions were performed with 40 cycles. As a negative control, PCR
reactions were performed with non-reverse transcribed total
RNA to exclude fragment amplification because of the presence of
genomic DNA in the samples. Fragments were separated on an agarose gel,
blotted to a membrane, and hybridized with either radiolabeled
LeExt1 or Rpl2 cDNA, respectively.
In Situ Hybridization
In situ hybridization of RNA was performed with
paraffin-embedded roots of tomato var. Moneymaker as described earlier
(Daram et al., 1998 ).
GUS Assay and Histochemical Analysis
Plant material was incubated in 0.1% (w/v) X-Gluc
(Biosynth, Staad, Switzerland) and 0.1% (v/v) Triton X-100
(Fluka Chemie AG, Buchs, Switzerland) in 0.05 M sodium
phosphate buffer, pH 7.2, at 37°C. Methanol was included in the
pollen assay at 20% (v/v), because it was shown to almost completely
suppress an endogenous GUS activity and thus to abolish background
staining in pollen (Kosugi et al., 1990 ). The stained material was
directly assayed for GUS activity or was fixed in ethanol:acetic acid
(3:1, v/v) overnight at 4°C. Complete removal of chlorophyll
from the tissue was performed in 100% ethanol. Samples were
then embedded in Technovit 7100 (Kulzer, Wehrheim, Germany) and
5-µm-thick sections were mounted on glass slides. The indigo
precipitate was visualized using a stereomicroscope (Olympus SZX12,
Olympus Optical Schweiz AG, Volketswil, Switzerland) or by light
microscopy (Olympus AZ70) in combination with Nomarski optics (GUS
activity appears indigo blue).
 |
ACKNOWLEDGMENTS |
We thank Dr. Claus Frohberg (PlantTec Biotechnology, Potsdam,
Germany) for primary analysis of gen1.1/GUS potato plants and valuable discussions; Romy Ackermann and Dr. Babette Regierer (Max-Planck-Institute of Molecular Plant Physiology, Potsdam) for
Arabidopsis transformation and initial analysis; Drs. Vladimir Karandashov (Institute of Plant Physiology, Russian Academy of Sciences, Moscow) and David Trudgill (Scottish Crop Research Institute, Dundee, Scotland) for Phytophtora spp., mycorrhiza, and
nematode infection studies; Drs. Rene Geurts and Ton Bisseling
(Wageningen University, The Netherlands) for promoter/GUS analysis in
M. truncatula; Birgit Schroeer (Max-Planck-Institute of
Molecular Plant Physiology) for her technical support in the root hair
promoter project at the Institut für Genbiologische
Forschung (Berlin); and Sabine Klarer and Katalyn Konya for
taking care of the greenhouse plants at ETH (Zurich).
 |
FOOTNOTES |
Received November 5, 2001; accepted November 20, 2001.
1
This work was partially supported by the Swiss
National Science Foundation, Biotechnology Priority Program (grant no.
5002-39814 to M.B.) and by ETH Zurich (to M.B.).
*
Corresponding author; e-mail
marcel.bucher{at}ipw.biol.ethz.ch; fax 41-52-3549219.
Article, publication date, and citation information can be found at
www.plantphysiol.org/cgi/doi/10.1104/pp.010998.
 |
LITERATURE CITED |
-
Ahn J, Choi Y, Kwon Y, Kim S, Choi Y, Lee J
(1996)
A novel extensin gene encoding a hydroxyproline-rich glycoprotein requires sucrose for its wound-inducible expression in transgenic plants.
Plant Cell
8: 1477-1490[Abstract]
-
Arsenijevic-Maksimovic I, Broughton W, Krause A
(1997)
Rhizobia modulate root-hair-specific expression of extensin genes.
Mol Plant-Microbe Interact
10: 95-101[Medline]
-
Bechtold N, Pelletier G
(1993)
In planta Agrobacterium-mediated gene transfer by infiltration of adult Arabidopsis thaliana plants.
CR Acad Sci Ser III Sci Vie
316: 1194-1199
-
Bernhardt C, Tierney ML
(2000)
Expression of AtPRP3, a proline-rich structural cell wall protein from Arabidopsis, is regulated by cell-type-specific developmental pathways involved in root hair formation.
Plant Physiol
122: 705-714[Abstract/Free Full Text]
-
Bevan M
(1984)
Binary Agrobacterium vectors for plant transformation.
Nucleic Acids Res
12: 8711[Abstract/Free Full Text]
-
Bibikova TN, Blancaflor EB, Gilroy S
(1999)
Microtubules regulate tip growth and orientation in root hairs of Arabidopsis thaliana.
Plant J
17: 657-665[CrossRef][ISI][Medline]
-
Borner R, Kampmann G, Chandler J, Gleissner R, Wisman E, Apel K, Melzer S
(2000)
A MADS domain gene involved in the transition to flowering in Arabidopsis.
Plant J
24: 591-599[CrossRef][ISI][Medline]
-
Brisson L, Tenhaken R, Lamb C
(1994)
Function of oxidative cross-linking of cell wall structural proteins in plant disease resistance.
Plant Cell
6: 1703-1712[Abstract/Free Full Text]
-
Bucher M, Schroeer B, Willmitzer L, Riesmeier JW
(1997)
Two genes encoding extensin-like proteins are predominantly expressed in tomato root hair cells.
Plant Mol Biol
35: 497-508[CrossRef][ISI][Medline]
-
Cassab G
(1998)
Plant cell wall proteins.
Annu Rev Plant Physiol Plant Mol Biol
49: 281-309[CrossRef][ISI]
-
Cormack RGH
(1945)
Cell elongation and the development of root hairs in tomato roots.
Am J Bot
32: 190-196
-
Daram P, Brunner S, Persson BL, Amrhein N, Bucher M
(1998)
Functional analysis and cell-specific expression of a phosphate transporter from tomato.
Planta
206: 225-233[CrossRef][ISI][Medline]
-
Deblaere R, Bytebier B, De Greve H, Deboeck F, Schell J, Van Montagu M, Leemans J
(1985)
Efficient octopine Ti plasmid-derived vectors for Agrobacterium-mediated gene transfer to plants.
Nucleic Acids Res
13: 4777-4788[Abstract/Free Full Text]
-
Depicker A, Stachel S, Dhaese P, Zambryski P, Goodman HM
(1982)
Nopaline synthase: transcript mapping and DNA sequence.
J Mol Appl Genet
1: 561-573[Medline]
-
Devreux J, Haeberli P, Smithies O
(1984)
A comprehensive set of sequence analysis programs for the VAX.
Nucleic Acids Res
12: 387-395
-
DiCristina M, Sessa G, Dolan L, Linstead P, Baima S, Ruberti I, Morelli G
(1996)
The Arabidopsis Athb-10 (GLABRA2) is an HD-Zip protein required for regulation of root hair development.
Plant J
10: 393-402[CrossRef][ISI][Medline]
-
Dolan L, Janmaat K, Willemsen V, Linstead P, Poethig S, Roberts K, Scheres B
(1993)
Cellular organisation of the Arabidopsis thaliana root.
Development
119: 71-84[Abstract]
-
Epstein J, Lamport D
(1984)
An intramolecular linkage involving isodityrosine in extensin.
Phytochemistry
23: 1241-1246[CrossRef]
-
Fillatti J, Kiser J, Rose R, Comai L
(1987)
Efficient transfer of a glyphosate tolerance gene into tomato using a binary Agrobacterium tumefaciens vector.
Bio/Technology
5: 726-730[CrossRef]
-
Filpula DR, Lee SM, Link RP, Strausberg SL, Strausberg RL
(1990)
Structural and functional repetition in a marine mussel adhesive protein.
Biotechnol Prog
6: 171-177[CrossRef][Medline]
-
Fleming AJ, Mandel T, Roth I, Kuhlemeier C
(1993)
The patterns of gene expression in the tomato shoot apical meristem.
Plant Cell
5: 297-309[Abstract]
-
Franck A, Guilley H, Jonard G, Richards K, Hirth L
(1980)
Nucleotide sequence of Cauliflower Mosaic virus DNA.
Cell
21: 285-294[CrossRef][ISI][Medline]
-
Galway ME, Masucci JD, Lloyd AM, Walbot V, Davis RW, Schiefelbein JW
(1994)
The TTG gene is required to specify epidermal cell fate and cell patterning in the Arabidopsis root.
Dev Biol
166: 740-754[CrossRef][ISI][Medline]
-
Gielen J, De Beuckeleer M, Seurinck J, Deboeck F, De Greve H, Lemmers M, Van Montagu M, Schell J
(1984)
The complete nucleotide sequence of the TL-DNA of the Agrobacterium tumefaciens plasmid pTiAch5.
EMBO J
3: 835-846[ISI][Medline]
-
Gillespie CS, Sherman DL, Blair GE, Brophy PJ
(1994)
Periaxin, a novel protein of myelinating Schwann cells with a possible role in axonal ensheathment.
Neuron
12: 497-508[CrossRef][ISI][Medline]
-
Gilroy I, Jones DL
(2000)
Through form to function: root hair development and nutrient uptake.
Trends Plant Sci
5: 56-60[CrossRef][ISI][Medline]
-
Grierson C, Roberts K, Feldmann K, Dolan L
(1997)
The COW1 locus of Arabidopsis acts after RHD2, and in parallel with RHD3 and TIP1, to determine the shape, rate of elongation, and number of root hairs produced from each site of hair formation.
Plant Physiol
115: 981-990[Abstract]
-
Grotewold E, Drummond BJ, Bowen B, Peterson T
(1994)
The myb-homologous P gene controls phlobaphene pigmentation in maize floral organs by directly activating a flavonoid biosynthetic gene subset.
Cell
76: 543-553[CrossRef][ISI][Medline]
-
Heinemeyer T, Wingender E, Reuter I, Hermjakob H, Kel AE, Kel OV, Ignatieva EV, Ananko EA, Podkolodnaya OA, Kolpakov FA, et al
(1998)
Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL.
Nucleic Acids Res
26: 362-367[Abstract/Free Full Text]
-
Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS
fusions:
-glucuronidase as a sensitive and versatile gene fusion
marker in higher plants. EMBO J 3901-3907 -
Katavic V, Haughn G, Reed D, Martin M, Kunst L
(1994)
In planta transformation of Arabidopsis thaliana.
Mol Gen Genet
245: 363-370[CrossRef][Medline]
-
Keller B, Lamb CJ
(1989)
Specific expression of novel cell wall hydroxyproline-rich glycoprotein genes in lateral root initiation.
Genes Dev
3: 1639-1646[Abstract/Free Full Text]
-
Kosugi S, Ohashi Y, Nakajima K, Arai Y
(1990)
An improved assay for beta-glucuronidase in transformed cells: Methanol almost completely suppresses a putative endogenous beta-glucuronidase activity.
Plant Sci
70: 133-140[CrossRef]
-
Kyte J, Doolittle R
(1982)
A simple method for displaying the hydropathic character of a protein.
J Mol Biol
157: 105-132[CrossRef][ISI][Medline]
-
Lawton MA, Dean SM, Dron M, Kooter JM, Kragh KM, Harrison MJ, Yu L, Tanguay L, Dixon RA, Lamb CJ
(1991)
Silencer region of a chalcone synthase promoter contains multiple binding sites for a factor, SBF-1, closely related to GT-1.
Plant Mol Biol
16: 235-249[CrossRef][ISI][Medline]
-
Lee MM, Schiefelbein J
(1999)
WEREWOLF, a MYB-related protein in Arabidopsis, is a position-dependent regulator of epidermal cell patterning.
Cell
99: 473-483[CrossRef][ISI][Medline]
-
Locket TJ
(1990)
A bacteriophage lambda DNA purification procedure suitable for the analysis of DNA from either large or multiple small lysates.
Anal Biochem
185: 230-234[Medline]
-
Masucci J, Schiefelbein J
(1994)
The rhd6 mutation of Arabidopsis thaliana alters root-hair initiation through an auxin- and ethylene-associated process.
Plant Physiol
106: 1335-1346[Abstract]
-
Masucci JD, Schiefelbein JW
(1996)
Hormones act downstream of TTG and GL2 to promote root hair outgrowth during epidermis development in the Arabidopsis root.
Plant Cell
8: 1505-1517[Abstract]
-
Meissner R, Jacobson Y, Melamed S, Levyatuv S, Shalev G, Ashri A, Elkind Y, Levy A
(1997)
A new model system for tomato genetics.
Plant J
12: 1465-1472[CrossRef][ISI]
-
Memelink J, Swords KM, de Kam RJ, Schilperoort RA, Hoge JH, Staehelin LA
(1993)
Structure and regulation of tobacco extensin.
Plant J
4: 1011-1022[CrossRef][ISI][Medline]
-
Murashige T, Skoog F
(1962)
A revised medium for rapid growth and bioassays with tobacco tissue cultures.
Physiol Plant
15: 473-497[CrossRef]
-
Rocha-Sosa M, Sonnewald U, Frommer W, Stratmann M, Schell J, Willmitzer L
(1989)
Both developmental and metabolic signals activate the promoter of a class I patatin gene.
EMBO J
8: 23-29[ISI][Medline]
-
Rosahl S, Schell J, Willmitzer L
(1987)
Expression of a tuber-specific storage protein in transgenic tobacco plants: demonstration of an esterase activity.
EMBO J
6: 1155-1159[ISI][Medline]
-
Ryan E, Grierson C, Cavell A, Steer M, Dolan L
(1998)
TIP1 is required for both tip growth and non-tip growth in Arabidopsis.
New Phytol
138: 49-58[CrossRef]
-
Sambrook J, Frisch EF, Maniatis T
(1989)
Molecular Cloning: A Laboratory Manual, Ed 2. Cold Spring Harbor Press, Cold Spring Harbor, NY
-
Schiefelbein J, Galway M, Masucci J, Ford S
(1993)
Pollen tube and root-hair tip growth is disrupted in a mutant of Arabidopsis thaliana.
Plant Physiol
103: 979-985[Abstract]
-
Schiefelbein JW, Somerville CR
(1990)
Genetic control of root hair development in Arabidopsis thaliana.
Plant Cell
2: 235-243[Abstract/Free Full Text]
-
Schnabelrauch LS, Kieliszewski M, Upham BL, Alizedeh H, Lamport DT
(1996)
Isolation of pl 4.6 extensin peroxidase from tomato cell suspension cultures and identification of Val-Tyr-Lys as putative intermolecular cross-link site.
Plant J
9: 477-489[CrossRef][ISI][Medline]
-
Schneider K, Mathur J, Boudonck K, Wells B, Dolan L, Roberts K
(1998)
The ROOT HAIRLESS 1 gene encodes a nuclear protein required for root hair initiation in Arabidopsis.
Genes Dev
12: 2013-2021[Abstract/Free Full Text]
-
Schneider K, Wells B, Dolan L, Roberts K
(1997)
Structural and genetic analysis of epidermal cell differentiation in Arabidopsis primary roots.
Development
124: 1789-1798[Abstract]
-
Sessa G, Morelli G, Ruberti I
(1993)
The Athb-1 and -2 HD-Zip domains homodimerize forming complexes of different DNA binding specificities.
EMBO J
12: 3507-3517[ISI][Medline]
-
Showalter AM
(1993)
Structure and function of plant cell wall proteins.
Plant Cell
5: 9-23[Free Full Text]
-
Sievers A, Schnepf E
(1981)
Morphogenesis and polarity of tubular cells with tip growth.
In
O Kiermayer, ed, Cell Biology Monographs, Vol. 8. Springer-Verlag, New York, pp 265-299
-
Solano R, Nieto C, Avila J, Canas L, Diaz I, Paz-Ares J
(1995)
Dual DNA binding specificity of a petal epidermis-specific MYB transcription factor (MYB.Ph3) from Petunia hybrida.
EMBO J
14: 1773-1784[ISI][Medline]
-
Tiré C, De Rycke R, De Loose M, Inzé D, Van Montagu M, Engler G
(1994)
Extensin gene expression is induced by mechanical stimuli leading to local cell wall strengthening in Nicotiana plumbaginifolia.
Planta
195: 175-181[ISI][Medline]
-
von Heijne G
(1986)
A new method for predicting signal sequence cleavage sites.
Nucleic Acids Res
14: 4683-4690[Abstract/Free Full Text]
-
Wada T, Tachibana T, Shimura Y, Okada K
(1997)
Epidermal cell differentiation in Arabidopsis determined by a Myb homolog, CPC.
Science
277: 1113-1116[Abstract/Free Full Text]
-
Walker AR, Davison PA, Bolognesi-Winfield AC, James CM, Srinivasan N, Blundell TL, Esch JJ, Marks MD, Gray JC
(1999)
The TRANSPARENT TESTA GLABRA1 locus, which regulates trichome differentiation and anthocyanin biosynthesis in Arabidopsis, encodes a WD40 repeat protein.
Plant Cell
11: 1337-1350[Abstract/Free Full Text]
-
Wymer CL, Bibikova TN, Gilroy S
(1997)
Cytoplasmic free calcium distributions during the development of root hairs of Arabidopsis thaliana.
Plant J
12: 427-439[CrossRef][ISI][Medline]
-
Ye Z-H, Varner J
(1991)
Tissue-specific expression of cell wall proteins in developing soybean tissues.
Plant Cell
3: 23-37[Abstract/Free Full Text]
© 2002 American Society of Plant Physiologists
This article has been cited by other articles:

|
 |

|
 |
 
Y. Zhang, M. A. R. Mian, K. Chekhovskiy, S. So, D. Kupfer, H. Lai, and B. A. Roe
Differential gene expression in Festuca under heat stress conditions
J. Exp. Bot.,
March 1, 2005;
56(413):
897 - 907.
[Abstract]
| |