Plant Physiol, April 2002, Vol. 128, pp. 1169-1172

SCIENTIFIC CORRESPONDENCE

Calmodulin as a Potential Negative Regulator of Arabidopsis COR Gene Expression¹

Department of Plant Sciences, University of Oxford, South Parks Road, Oxford OX1 3RB, United Kingdom

	INTRODUCTION

TOP INTRODUCTION AKNOWLEDGEMENTS LITERATURE CITED

Previous studies have implicated calmodulin as a signaling component required for the cold induction of COR (cold on regulated) genes in Arabidopsis (Braam and Davis, 1990; Tähtiharju et al., 1997). Here, we present data that show that overexpression of calmodulin in planta causes inhibition of COR gene expression.

We have previously investigated the role of calcium in low-temperature signaling in plants (Knight et al., 1991, 1996, Plieth et al., 1999). This work has shown that low temperature causes rapid transient elevations in cytosolic free calcium concentration. Our work, along with the work of others, shows that calcium is required for low-temperature induction of COR gene expression (Monroy and Dhindsa, 1995; Knight et al., 1996; Tähtiharju et al., 1997). Calcium-dependent signaling components must act downstream of low temperature-induced increases in cellular calcium concentration. As such, calmodulin is an excellent candidate, likely to be involved in transducing calcium signals in plants in response to a variety of stimuli (Zielinski, 1998). There are some data to possibly suggest that calmodulin might be required for cold induction of COR genes (Braam and Davis, 1990; Tähtiharju et al., 1997).

To investigate the effect of calmodulin overexpression in Arabidopsis, we expressed the CaM3 isoform of calmodulin (Perera and Zielinski, 1992) using the steroid-inducible pTA7001 binary vector (Aoyama and Chua, 1997; McNellis et al., 1998). The CaM3 coding sequence was PCR amplified from cDNA with primers to add XhoI and SpeI restriction sites at the 5' and 3' ends, respectively (using the primers 5' cgcgctcgagataacaatggcggatcagctcaccgac 3' and 5' gcgcactagtcagcatcacttagccatcatg 3'; restriction sites underlined). This allowed the directional cloning of the CaM3 coding sequence into pTA7001 in front of the Gal4-VP16-glucocorticoid receptor (GVG)-induced promoter (Aoyama and Chua, 1997; McNellis et al., 1998). In addition, a translation initiation consensus sequence (5'ATAACA 3') was added directly upstream of the ATG start codon. Two versions of the coding sequence were produced, a native wild-type sequence and a (K₁₁₆R) mutation, designed to test the role of trimethylation in the regulation of calmodulin activity in vivo (Harding et al., 1997). The mutant version of the CaM3 coding region was produced by overlap extension PCR mutagenesis (Ho et al., 1989). The full DNA sequences of both mutant and wild-type CaM3 coding regions were confirmed by dideoxynucleotide sequencing. Both binary constructs were transformed into Arabidopsis Columbia (Col-0) wild type by floral dipping (Clough and Bent, 1998) and transformants selected by growth on hygromycin (Aoyama and Chua, 1997; McNellis et al., 1998).

To test the effects of calmodulin overexpression, T₂ seedlings were grown in sterile shaking culture in 1× Murashige and Skoog medium and 1% (w/v) Suc, pH 5.7, for 7 d and then CaM3 expression was induced by adding 30 mM dexamethasone in ethanol to a final concentration of 30 µM for 48 h. An equal volume (to 0.1% [v/v]) of ethanol was added to control samples. To identify transgenic lines overexpressing CaM3, dexamethasone-induced CaM3 transcripts were monitored in samples that had been cold treated for 14 h at 4°C (to induce COR gene expression to measurable levels). Figure 1 shows RNA gel-blot analysis to detect the CaM3 transcripts in five CaM3 transgenic lines (C1-C5), five mutant (K₁₁₆R) CaM3 transgenic lines (K1-K5), and two Col-0 wild type controls (W1 and W2). This blot was also hybridized with a probe for -tubulin (as described previously; Knight et al., 1999) transcripts simultaneously, to act as a control for RNA loading. All tracks shown are from the same blot and all samples were from cold-treated plants as described above. The Col-0 wild type controls showed relatively low levels of expression of CaM3. There was a range of expression levels of CaM3 in the 10 transgenic lines tested, from as low as wild type, e.g. C4, to the highest level, e.g. C5. This range of expression levels has been observed in previous studies using the pTA7001 expression system (Aoyama and Chua, 1997).

View larger version (36K): [in this window] [in a new window]   Figure 1.   Dexamethasone-induced expression of CaM3 in Arabidopsis. RNA gel-blot analysis of CaM3 and -tubulin transcript levels in wild type and CaM3-overexpressing transgenic lines, all treated with dexamethasone and cold as described in the main text. W1 and W2 are RNA samples from wild-type (Col-0) plants, C1 through C5 are from transgenic lines harboring the CaM3 construct, and K1 through K5 are from transgenic lines harboring the construct containing the mutated form of the CaM3 coding sequence.

To assess the effect of overexpression of CaM3 upon the cold-induced expression of COR genes, this blot was reprobed with probes for two COR genes; namely, LTI78 (=RD29A=COR78; Nordin et al., 1993) and KIN1/KIN2 (=COR6.6/COR6.6a; Kurkela and Franck, 1990; Kurkela and Borg-Franck, 1992). Probes for these COR genes were prepared as previously described (Knight et al., 1999). As can be seen from comparing Figure 2 with Figure 1, there is generally an inverse correlation between CaM3 expression and COR gene expression; i.e., in lines expressing CaM3 to relatively high levels (i.e. C1, C5, K2, K3, K4, and K5), there was a corresponding decrease in cold-induced COR gene expression as compared with the wild-type controls (W1 and W2). This correlation suggests that overexpression of CaM3 represses cold-induced COR expression. Expression of -tubulin (shown in Fig. 1) was unaffected by CaM3 overexpression.

View larger version (53K): [in this window] [in a new window]   Figure 2.   COR gene expression in Arabidopsis overexpressing CaM3. RNA gel-blot analysis of LTI78 and KIN1/2 transcript levels in wild type and CaM3 overexpressing transgenic lines. All treatments and samples are as described in the legend for Figure 1 (this is the same blot reprobed with probes for LTI78 and KIN1/2).

It has been shown previously in tobacco (Nicotiana tabacum) that unmethylated calmodulin can selectively hyperactivate NAD kinase, whereas other enzyme rates are unperturbed (Harding et al., 1997). This indicates that calmodulin methylation may have a regulatory function. To test whether the effect of repression of COR gene expression in the cold by calmodulin was subject to regulation by trimethylation, we compared the effects of expressing both mutant (un-methylatable) and wild-type forms of CaM3 coding sequences (Fig. 2). There did not seem to be any differences between the potency of the wild type and mutant CaM3 sequences to exert their effect on COR gene expression. Therefore, methylation does not play a role in the inhibition of cold-induced COR gene expression in Arabidopsis by overexpression of CaM3.

The steroid-inducible system we used relies on the constitutive expression of a chimeric transactivator, GVG, which when it binds steroid, can activate the expression of the gene cloned in front of the recognition site in the DNA (Aoyama and Chua, 1997). It could be that overexpression of GVG may lead to activation of nontarget genes. Therefore, to verify that the repression of COR gene expression was due specifically to overexpression of CaM3, and not because of the expression of the GVG chimeric transactivator (Aoyama and Chua, 1997), the expression of COR genes in response to cold was monitored in transgenic CaM3 lines and compared with lines transformed with the same vector (pTA7001) but lacking the CaM3 coding sequence. These latter lines also express the GVG transactivator that interacts with the steroid. Figure 3 shows the comparison between a transgenic CaM3 line and a transgenic vector control that both express comparable levels of GVG transcripts, along with a Col-0 control. All tracks shown are from the same blot. Seedlings were grown in the same way as described above, and induced for 48 h with 30 µM dexamethasone. The seedlings were then either incubated at 20°C or 4°C for 14 h. As can be seen in Figure 3, dexamethasone treatment ("+") causes a large increase in CaM3 transcript levels in the CaM3 transgenic lines both at 20°C and 4°C. The levels of CaM3 transcripts were low and consistent in the vector transgenic controls, ethanol controls (""), and wild-type controls. The low-temperature treatment produced an increase in the levels of both LTI78 and KIN1/2 transcripts (levels at 20°C were undetectable). Application of steroid ("+" in Fig. 3) had no effect on the expression of these COR genes in the Col-0 wild type and the vector transgenic control relative to the -tubulin loading standard. However, the levels of these COR transcripts in the CaM3 transgenic line were clearly and substantially reduced at 4°C in the presence of steroid ("+" in Fig. 3), relative to the corresponding ethanol control ("" in Fig. 3). Taken together, these data show that the effect on COR gene repression is specific to CaM3 expression and is independent of GVG expression.

View larger version (83K): [in this window] [in a new window]   Figure 3.   CaM3 overexpression causes repression of COR gene expression. RNA gel-blot analysis of CaM3, -tubulin, LTI78, KIN1/2, and GVG transcript levels in wild-type (Col-0) plants, a CaM3-overexpressing transgenic line, and a vector control transgenic line. RNA samples are from plants either treated at low (4°C) or ambient (20°C) temperature with either dexamethasone in ethanol (+) or ethanol alone () as described in the main text.

The cold-induced expression of COR genes such as KIN1/2 and LTI78 has previously been demonstrated to be regulated by intracellular calcium using a combination of approaches, namely in planta calcium measurements (Knight et al., 1996), pharmacological analysis (Tähtiharju et al., 1997), and microinjection studies (Wu et al., 1997). A reasonable amount of knowledge has accumulated about events upstream of cold-induced cytosolic calcium elevations. There appears to be a role for membrane fluidity and the cytoskeleton in cold sensing in plants (Mazars et al., 1997; Orvar et al., 2000; Sangwan et al., 2001). This is in some way coupled to influx of calcium from outside the cell (Monroy and Dhindsa, 1995; Knight et al., 1996), and also IP₃ and cADPR-mediated calcium release from internal stores (Knight et al., 1996; Wu et al., 1997). However, the specific targets (calcium-dependent proteins) that transduce these cold-induced intracellular calcium signals have not yet been identified. Candidates for such targets are calmodulin and calcium-dependent protein kinases (Zielinski, 1998; Harmon et al., 2001). It has been suggested that calmodulin is involved in the cold induction of COR genes because calmodulin genes are themselves induced by low temperature (Braam and Davis, 1990), and also calmodulin inhibitors have been shown to inhibit cold-induced expression of KIN1 and KIN2 (Tähtiharju et al., 1997). Our data presented here show that the overexpression of calmodulin can inhibit the low temperature-induced expression of KIN1/2 and LTI78. Thus, the possibility is raised that calmodulin might also act as a negative agent with respect to COR gene expression in planta. In this case, in addition to positive calcium-dependent pathways leading to increased COR gene expression at low temperature (Monroy and Dhindsa, 1995; Knight et al., 1996; Tähtiharju et al., 1997), there would also be negative calcium-dependent pathways involving calmodulin. In such a scenario, it might be speculated that calmodulin would act in tandem with positive calcium-mediated signaling components, e.g. calcium-dependent protein kinases.

With respect to mechanisms explaining the results we observed, it has been shown that Ca-ATPases are activated by calmodulin and in this way are likely to reduce intracellular calcium concentration (Hwang et al., 2000). COR genes such as LTI78 and KIN1/2 require calcium for expression (Knight et al., 1996; Tähtiharju et al., 1997); thus, overexpression of CaM3 might reduce COR gene expression through this mechanism. It must be pointed out that it is likely that the effect of calmodulin overexpression on intracellular calcium levels would be much more profound than any potential effect of calmodulin during normal cold signaling, but it is still possible that this mechanism is utilized in such circumstances. Alternatively, calmodulin may directly inhibit a protein signaling component required for the expression of COR genes. Such interactions are known to occur between calmodulin and signaling components, e.g. nitric oxide synthase (Kondo et al., 1999). In the red-light induction of gene expression mediated by phytochrome, two signaling branches lead from this receptor, one calcium dependent and the other mediated by cGMP. Flux through the calcium-dependent pathway, which involves calmodulin, inhibits action through the cGMP pathway in a process known as reciprocal control (Bowler et al., 1994). For instance, the cGMP-mediated induction of CHS gene expression can be inhibited by micro-injecting calmodulin into plant cells. Thus, in our system, it could be that calmodulin overexpression acts in a similar way to exert a negative effect on the pathway leading to COR gene expression, causing it to be inhibited.

Upon request, all novel materials described in this publication will be made available in a timely manner for noncommercial research purposes, subject to the requisite permission from any third-party owners of all or parts of the material. Obtaining any permissions will be the responsibility of the requestor.

	AKNOWLEDGEMENTS

TOP INTRODUCTION AKNOWLEDGEMENTS LITERATURE CITED

We would like to thank Professor Nam-Hai Chua and Dr. Juan Pablo Sanchez (Rockefeller University, New York) for the pTA7001 vector and excellent and helpful advice on its use, and Dr. Heather Knight (University of Oxford, UK) for critically reading this manuscript.

	FOOTNOTES

Received September 4, 2001; returned for revision October 9, 2001; accepted December 21, 2001.

¹ This work was supported by the University of Oxford (pump-priming grant).

^* Corresponding author; e-mail helen.townley{at}plants.ox.ac.uk; fax 44-1865-275074.

www.plantphysiol.org/cgi/doi/10.1104/pp.010814.

	LITERATURE CITED

TOP INTRODUCTION AKNOWLEDGEMENTS LITERATURE CITED

• Aoyama T, Chua NH (1997) Plant J 11: 605-612[CrossRef][ISI][Medline]
• Bowler C, Yamagata H, Neuhaus G, Chua NH (1994) Genes Dev 8: 2188-2202[Abstract/Free Full Text]
• Braam J, Davis RW (1990) Cell 60: 357-364[CrossRef][ISI][Medline]
• Clough SJ, Bent AF (1998) Plant J 16: 735-743[CrossRef][ISI][Medline]
• Harding SA, Oh SH, Roberts DM (1997) EMBO J 16: 1137-1144[CrossRef][ISI][Medline]
• Harmon AC, Gribskov M, Gubrium E, Harper JF (2001) New Phytol 151: 175-183[CrossRef]
• Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR (1989) Gene 77: 51-59[CrossRef][ISI][Medline]
• Hwang I, Sze H, Harper JF (2000) Proc Natl Acad Sci USA 97: 6224-6229[Abstract/Free Full Text]
• Knight H, Trewavas AJ, Knight MR (1996) Plant Cell 8: 489-503[Abstract]
• Knight H, Veale EL, Warren GJ, Knight MR (1999) Plant Cell 11: 875-886[Abstract/Free Full Text]
• Knight MR, Campbell AK, Smith SM, Trewavas AJ (1991) Nature 352: 524-526[CrossRef][Medline]
• Kondo R, Tikunova SB, Cho MJ, Johnson JD (1999) J Biol Chem 274: 36213-36218[Abstract/Free Full Text]
• Kurkela S, Borg-Franck M (1992) Plant Mol Biol 19: 689-692[CrossRef][ISI][Medline]
• Kurkela S, Franck M (1990) Plant Mol Biol 15: 137-144[CrossRef][ISI][Medline]
• Mazars C, Thion L, Thuleau P, Graziana A, Knight MR, Moreau M, Ranjeva R (1997) Cell Calcium 22: 413-420[CrossRef][ISI][Medline]
• McNellis TW, Mudgett MB, Li K, Aoyama T, Horvath D, Chua NH, Staskawicz BJ (1998) Plant J 14: 247-257[CrossRef][ISI][Medline]
• Monroy AF, Dhindsa RS (1995) Plant Cell 7: 321-331[Abstract]
• Nordin K, Vahala T, Palva ET (1993) Plant Mol Biol 21: 641-653[CrossRef][ISI][Medline]
• Orvar BL, Sangwan V, Omann F, Dhindsa RS (2000) Plant J 23: 785-794[CrossRef][ISI][Medline]
• Perera IY, Zielinski RE (1992) Plant Mol Biol 19: 649-664[CrossRef][ISI][Medline]
• Plieth C, Hansen UP, Knight H, Knight MR (1999) Plant J 18: 491-497[CrossRef][ISI][Medline]
• Sangwan V, Foulds I, Singh J, Dhindsa RS (2001) Plant J 27: 1-12[CrossRef][ISI][Medline]
• Tahtiharju S, Sangwan V, Monroy AF, Dhindsa RS, Borg M (1997) Planta 203: 442-447[CrossRef][ISI][Medline]
• Wu Y, Kuzma J, Marechal E, Graeff R, Lee HC, Foster R, Chua NH (1997) Science 278: 2126-2130[Abstract/Free Full Text]
• Zielinski RE (1998) Ann Rev Plant Physiol Plant Mol Biol 49: 697-725[CrossRef][ISI]