First published online April 9, 2002; 10.1104/pp.010747
Plant Physiol, May 2002, Vol. 129, pp. 321-332
Isolation and Characterization of Homogentisate Phytyltransferase
Genes from Synechocystis sp. PCC 6803 and
Arabidopsis
Beth
Savidge,
James D.
Weiss,
Yun-Hua H.
Wong,
Michael W.
Lassner,1
Timothy A.
Mitsky,
Christine K.
Shewmaker,
Dusty
Post-Beittenmiller, and
Henry E.
Valentin*
Monsanto Company, Calgene Campus, 1920 Fifth Street, Davis,
California 95616 (B.S., M.W.L., C.K.S.); and Monsanto Company, 800 N. Lindbergh Boulevard, St. Louis, Missouri 63167 (J.D.W.,
Y.-H.H.W., T.A.M., D.P.-B., H.E.V.)
 |
ABSTRACT |
Tocopherols, synthesized by photosynthetic organisms, are
micronutrients with antioxidant properties that play important roles in
animal and human nutrition. Because of these health benefits, there is
considerable interest in identifying the genes involved in tocopherol
biosynthesis to allow transgenic alteration of both tocopherol levels
and composition in agricultural crops. Tocopherols are generated from
the condensation of phytyldiphosphate and homogentisic acid (HGA),
followed by cyclization and methylation reactions. Homogentisate
phytyltransferase (HPT) performs the first committed step in this
pathway, the phytylation of HGA. In this study, bioinformatics techniques were used to identify candidate genes,
slr1736 and HPT1, that encode HPT from
Synechocystis sp. PCC 6803 and Arabidopsis, respectively. These two genes encode putative membrane-bound proteins, and contain amino acid residues highly conserved with other
prenyltransferases of the aromatic type. A Synechocystis
sp. PCC 6803 slr1736 null mutant obtained by
insertional inactivation did not accumulate tocopherols, and was
rescued by the Arabidopsis HPT1 ortholog. The membrane
fraction of wild-type Synechocystis sp. PCC 6803 was
capable of catalyzing the phytylation of HGA, whereas the membrane
fraction from the slr1736 null mutant was not. The
microsomal membrane fraction of baculovirus-infected insect cells
expressing the Synechocystis sp. PCC 6803 slr1736 were also able to perform the phytylation
reaction, verifying HPT activity of the protein encoded by this gene.
In addition, evidence that antisense expression of HPT1
in Arabidopsis resulted in reduced seed tocopherol levels, whereas
seed-specific sense expression resulted in increased seed tocopherol
levels, is presented.
 |
INTRODUCTION |
Tocopherols are important lipophilic
antioxidants that are synthesized by photosynthetic organisms. These
include higher plants and certain eukaryotic algae where they are
synthesized in the plastids, as well as photosynthetic prokaryotes such
as blue-green algae. The four major forms of tocopherols, , ,
, and , differ in the position and number of methyl groups (Fig.
1). The predominant form in the leaves of
higher plants is -tocopherol, whereas in seeds -tocopherol is
often the major isoform (Tan, 1989 ; Demurin et al., 1996 ).
Tocopherols predominantly function as antioxidants in vivo in
photosynthetic organisms and in animals, as well as in isolated
compounds such as oils. The antioxidant properties of tocopherols
derive from their ability to quench free radicals and different
tocopherols may be optimal as antioxidants for different biological
systems. For human and animal utility, -tocopherol has the highest
vitamin E activity and has been implicated in a variety of health
areas, including possible benefits in preventing cardiovascular
disease, certain cancers, and cataract formation (DellaPenna, 1999 ;
Bramley et al., 2000 ). The amounts of vitamin E needed to
achieve these effects are often quite high, 100 to 400 International
Units (I.U.) and even up to 800 I.U. compared with the
recommended daily allowance of 40 I.U. In fats and oils, tocopherols protect unsaturated fatty acids from oxidation. In these
systems, -tocopherol appears to have the greater utility (Parkhurst et al., 1968 ; Chow and Draper, 1974 ; Gottstein and Grosch, 1990 ). In fact, tocopherols are often included in
processed oils to help stabilize the fatty acids. For human health as
well as food and feed utility, it is desirable to have plants with increased tocopherol content along with those where the tocopherol composition is customized.
Tocopherols contain an aromatic head group, which is derived from
homogentisic acid (HGA) and a hydrocarbon portion, which arises from
phytyldiphosphate (phytyl-DP). HGA is derived from the shikimic acid
pathway and phytyl-DP is generated from the condensation of four
isoprenoid units. The isoprenoid contribution to tocopherol
biosynthesis is thought to come primarily from the plastidal
methyl-erythritol phosphate pathway, and not the cytosolic mevalonic
acid pathway (Arigoni et al., 1997 ; Lichtenthaler et al.,
1997 ). The condensation of HGA and phytyl-DP to form
2-methyl-6-phytylplastoquinol, the first committed step in tocopherol
biosynthesis, is a prenyltransferase reaction that is performed by a
homogentisate phytyltransferase (HPT; Fig.
2). Subsequent cyclization and
methylation reactions (Soll et al., 1980 ; Fiedler et al., 1982 ;
Marshall et al., 1985 ) result in the formation of the four major
tocopherols (Fig. 1). The enzymatic reactions in tocopherol
biosynthesis were identified 15 to 20 years ago (Soll et al.,
1980 ; Schultz-Siebert et al., 1987 ), but cloning of the genes
encoding these enzymes has only occurred in the last few years.
Tocopherol biosynthesis takes place in the plastid and the enzymes are
associated with the chloroplast envelope (Soll et al., 1980 ,
1985 ). The membrane association of the enzymes has made purification difficult (Soll et al., 1980 , 1985 ; Camara and
d'Harlingue, 1985 ). With the advent of genomics and the
availability of complete genome sequences of a number of organisms,
including Synechocystis sp. PCC 6803 and Arabidopsis, it has
become possible to use bioinformatics techniques to identify and clone
additional genes in the tocopherol pathway.
The first enzyme cloned in the tocopherol pathway, -tocopherol
methyl transferase ( -TMT), was identified in
Synechocystis sp. PCC 6803 and Arabidopsis using
bioinformatics (Shintani and DellaPenna, 1998 ). In that study,
the Arabidopsis -TMT was shown to alter seed tocopherol composition
when overexpressed in Arabidopsis.  Tocopherol, normally the
predominant tocopherol isomer in Arabidopsis seeds, was almost
completely converted to -tocopherol.
HPT catalyzes the first committed reaction in the tocopherol pathway,
and was unidentified previously. Concomitant with this study,
slr1736 was found to encode a HPT in
Synechocystis sp. PCC 6803 (DellaPenna et al., 2000 ; Savidge
et al., 2000 ; Collakova and DellaPenna, 2001 ; Schledz et al., 2001 ) and
the Arabidopsis HTP was identified (DellaPenna et al., 2000 ; Savidge et
al., 2000 ; Collakova and DellaPenna, 2001 ).
There are prenyltransferases that condense prenyl groups with allylic
chains and those that condense prenyl chains with aromatic groups. The
prenyltransferases that catalyze sequential condensations of
isopentenylpyrophosphate with allylic chains share common features, including Asp-rich motifs, and lead to the formation of compounds with
two isoprenoid units, such as geranylpyrophosphate, or to much longer
molecules, such as rubber, which contains greater than 1,000 isoprenoid
units (Chen et al., 1994 ; Ogura et al., 1997 ).
Prenyltransferases that catalyze condensations with nonisoprenoid groups have an Asp-rich motif (Saiki et al., 1993 )
distinct from that of the allylic class (Ashby and Edwards,
1990 ; Carottoli et al., 1991 ; Marrero et al., 1992 ), and
include UbiA, which attaches a prenyl group to
4-hydroxybenzoic acid, and chlorophyll synthase, which attaches
a prenyl group to chlorophyllide (Melzer, 1994 ; Oster and
Rudiger, 1997 ; Oster et al., 1997 ).
The first committed step in tocopherol biosynthesis is catalyzed by an
aromatic prenyltransferase that transfers a phytyl chain to HGA.
Assuming that structural features are shared among aromatic
prenyltransferases, bioinformatics techniques were used to identify
candidate genes encoding HPT in both Synechocystis sp. PCC
6803 and Arabidopsis, which were then characterized by biochemical and
genetic studies. Furthermore, the current study provides evidence that
seed-specific expression of HPT1 increases tocopherol levels
2-fold in Arabidopsis seed, an important first step in increasing
tocopherol levels in the feed and food supply.
 |
RESULTS |
Position-Specific Iterative (PSI)-BLAST Analysis
The HPT is thought to catalyze both the condensation of phytyl-DP
with HGA and the decarboxylation of HGA, resulting in the formation of
2-methyl-6-phytylplastoquinol (Fig. 2). To identify the gene encoding
this enzyme, a PSI-BLAST profile (Altschul et al., 1997 ) was
generated using the Escherichia coli
4-hydroxybenzoate-octaprenyltransferase (ubiA, Gen-Bank
accession no. 1790473) amino acid sequence as a query. UbiA was chosen
for profile generation because the reaction catalyzed by this
enzyme, the prenylation of 4-hydroxybenzoic acid to form
3-octaprenyl-4-hydroxy-benzoic acid, closely resembles that of the HGA
phytyltransferase. The PSI-BLAST profile was used to search the
Synechocystis sp. PCC 6803 genome (available at CyanoBase,
http://www.kazusa.or.jp/cyano/index.html) for genesthat may
encode a prenyltransferase belonging to the aromatic type. The search
resulted in the identification of five candidate genes: slr1736, slr0926, sll1899,
slr0056, and slr1518 (Table
I).
View this table:
[in this window]
[in a new window]
|
Table I.
Synechocystis and Arabidopsis putative
phytyltransferases identified by PSI-BLAST
E. coli UbiA protein sequence was used as a query in a
PSI-BLAST search against Synechocystis and Arabidopsis
public databases. Names given to the genes identified in the search are
listed for each species along with known genes for which homology is
shared and corresponding annotation. Predicted targeting (PSORT) for
Arabidopsis proteins is indicated.
|
|
A parallel PSI-BLAST search was performed on the Arabidopsis
public database (TBLASTN) and resulted in the identification of four
putative prenyltransferase genes that appeared to be potential orthologs of genes identified in the Synechocystis sp. PCC
6803 search (Table I). These sequences were originally designated ATPT2 (Arabidopsis prenyltransferase 2), ATPT3,
ATPT4, and ATPT12 (GenBank accession nos.
3004556, 4454035, 3341672, and 2129675, respectively). However, after
functional characterization, ATPT2 was renamed as
HPT1 and will be referred to as such for the remainder of
the paper. Although Slr1736 and its putative ortholog, HPT1, are
annotated as unknown proteins, they do share low levels of similarity
to chlorophyll synthase (ATPT12; Gaubier et al., 1995 ). Chlorophyll synthase catalyzes a reaction similar to that of the HPT,
adding phytyl-DP to chlorophyllide. After obtaining 5' sequences of the
four putative prenyltransferases sequences by RACE, only HPT1 and ATPT12 were strongly predicted to encode
plastid targeted proteins (PSORT). Based on predicted targeting
information and the observation that ATPT12 is likely
chlorophyll synthase, HPT1 and the putative
Synechocystis sp. PCC 6803 ortholog,
slr1736, were the strongest candidates to encode HPT.
To determine if HPT1 and slr1736 encode HPT,
isolation and functional testing of both genes were pursued. Primers
for slr1736 were designed based on the published
sequence (CyanoBase, http://www.kazusa.or.jp/cyanobase/). The
sequence of the PCR product was verified and the product was cloned into appropriate vectors for functional testing. The
full-length Arabidopsis HPT1 cDNA was isolated (GenBank
accession no. AY089963) by performing 5' and 3' RACE based on a
partial expressed sequence tag sequence. HPT1
encodes a 44-kD protein with 393 amino acids. Comparison of the
full-length clone to the public predicted protein from Arabidopsis
genomic sequence (Arabidopsis public database) revealed that the public
predicted sequence lacked 110 amino acids in the amino terminus and 17 amino acids from the carboxy terminus. This inaccurate prediction is
likely attributable to the fact that HPT1 contains 13 exons,
most of which are only 100 to 130 bp long. The public predicted protein
did not contain a plastid targeting sequence, and had only low levels
of similarity to another prenyltransferase, chlorophyll synthase,
making it difficult to infer function until the full-length sequence
was obtained. Both Slr1736 and HPT1 have predicted transmembrane
domains, based on Kyte-Doolittle hydropathy plotting (Kyte and
Doolittle, 1982 ), suggesting that they are membrane proteins. Using
ChloroP (Emanuelsson et al., 1999 ;
http://www.cbs.dtu.dk/services/ChloroP/), the putative plastid transit
peptide cleavage site of HPT1 is between amino acids 36 and 37;
however, an alignment of HPT1 and Slr1736 (Fig. 3A) suggested that the transit peptide
could be considerably longer. ClustalW was used to align Slr1736 and
HPT1, revealing 37% identity overall, and several regions with higher
levels of identity. Site-directed mutagenesis of another
prenyltransferase of the aromatic type, heme-O-synthase
(Saiki et al., 1993 ), resulted in the identification of a
putative catalytic domain. The region corresponding to the putative
catalytic domain was compared among Slr1736, HPT1, other Arabidopsis
putative prenyltransferases, as well as UbiA, which was used as the
query in the original PSI-BLAST search (Fig. 3B). Amino acid residues
identified as essential for catalytic activity in
heme-O-synthase are conserved among these proteins,
suggesting that this region may also play a role in catalysis.

View larger version (38K):
[in this window]
[in a new window]
|
Figure 3.
Protein alignment of HPT1 and Slr1736 and
conserved putative catalytic domain. A, Alignment of HPT1 and Slr1736
using the ClustalW algorithm. B, Alignment of putative catalytic domain
of Slr1736 and Arabidopsis putative prenyltransferases identified using
UbiA as a query in a PSI-BLAST search. Gray shading indicates
identity. Underlined sequence corresponds to the putative catalytic
domain. Asterisks indicate amino acids required for catalytic activity
in heme-O-synthase, which are conserved in HPT1. The
putative chloroplast target peptide processing site is indicated by an
arrowhead.
|
|
Synechocystis sp. PCC 6803 slr1736 Null
Mutant and Complementation with HPT1
To determine if slr1736 plays a role in tocopherol
biosynthesis, a null mutant in Synechocystis sp. PCC 6803 was generated in the slr1736 ORF via insertion of the
nptI gene. A confirmed mutant strain was assayed for
tocopherol content and composition using HPLC. No tocopherols were
detected in the null strain (Fig. 4),
suggesting ORF slr1736 is essential for tocopherol
biosynthesis. A complementation experiment was performed with the
Synechocystis sp. PCC 6803 slr1736 null mutant to
determine if HPT1 is the ortholog of slr1736. A
vector, pMON21690, containing HPT1 under control of the
Tac (Russell and Bennet, 1982 ) promoter, was
transformed into the slr1736 null strain and grown under
standard conditions for 5 d. HPLC analysis demonstrated that
tocopherol biosynthesis was restored in this strain (Fig. 4C), thus
confirming that HPT1 and slr1736 encode proteins
of similar function.

View larger version (20K):
[in this window]
[in a new window]
|
Figure 4.
HPLC chromatographic analysis of ethanol extracts
of wild-type Synechocystis sp. PCC 6803, slr1736
null mutant, and slr1736 null mutant complemented with
HPT1. A, Wild-type Synechocystis sp. PCC 6803 transformed with control vector. Peak 4 corresponds to -tocopherol
at 4.6 min. B, slr1736 null mutant lacking tocopherol peak
at 4.6 min. C, slr1736 null mutant complemented with
Arabidopsis HPT1 with tocopherol signal apparent at 4.6 min.
A compound eluting at 8.5 min represents the tocol internal standard
(peak 5). Peak 1 corresponds to the solvent front, and peaks 2 and 3 are two unknown compounds.
|
|
Phytyltransferase Activity of the slr1736 Gene
Product
The reaction carried out by HPT results in the formation of
2-methyl-6-phytylplastoquinol from the condensation of HGA and phytyl-DP (Fig. 2). To confirm that the slr1736 gene product
catalyzed this reaction, slr1736 was expressed in the
Baculovirus Expression System (Invitrogen, Carlsbad, CA) and assayed
for activity (Table II). The membrane
fraction from slr1736 expressing Sf9 cells was able to
catalyze the phytylation of HGA to generate
2-methyl-6-phytylplastoquinol, whereas membrane fractions from Sf9
control cells showed no conversion (Table II). In addition, HPT
activity was detected in membrane fractions from
Synechocystis sp. PCC 6803 wild type, but not in the null
strain (Table II; Fig. 5). The ability of
the slr1736 gene product to catalyze this reaction, combined
with the genetic data described above, provides strong evidence that
slr1736 encodes a phytyltransferase involved in tocopherol
biosynthesis. Membrane fractions from spinach chloroplasts were used as
a positive control in the phytyltransferase assay.
View this table:
[in this window]
[in a new window]
|
Table II.
Homogentisate phytyltransferase activity
Homogentisate phytyltransferase activity is defined as picomoles
2-methyl-6-phytylplastoquinone formation per milligram protein per
hour.
|
|

View larger version (18K):
[in this window]
[in a new window]
|
Figure 5.
HPT activity of Synechocystis sp. PCC
6803 wild-type and slr1736 null mutant membrane fractions.
A, Formation of
[3H]2-methyl-6-phytylplastiquinone in membrane
fractions of Synechocystis sp. PCC 6803 wild-type cells from
[3H]HGA and phytyl-DP. B, Lack of accumulation
of [3H]2-methyl-6-phytylplastiquinone formation
by membrane fractions from Synechocystis sp. PCC 6803 slr1736 null mutants.
|
|
HPT1 Expression in Arabidopsis Seed
Because phytylation of HGA is the first committed step of
tocopherol biosynthesis, it was hypothesized that expression of HPT1 in Arabidopsis may result in increased tocopherol
levels. To test this hypothesis, we expressed HPT1 under the
seed-specific napin promoter. Tocopherol analysis of pooled segregating
T2 seed from the
pNapin::HPT1 sense lines indicated that expression
of HPT1 resulted in up to a 60% increase in total seed
tocopherol (Fig. 6). Statistical
evaluation of tocopherol data from pNapin::HPT1 events compared with controls revealed that 33 of 36 independent events
produced elevated tocopherol levels. The analysis of
T3 seed pools from three selected events (1,848, 1,860, and 1,863) demonstrated that the transgenic populations were
distinct (P < 0.001) from wild-type and vector
controls (Table III), further validating
the increased tocopherol phenotype. Whereas homozygous lines,
identified by kanamycin selection, generally produced the highest
tocopherol content (up to a 2-fold increase), only events 1,848 and
1,863 showed significant differences in tocopherol content between
homozygous and hemizygous in T3 seed populations.
Based on their kanamycin selection pattern, these three lines were also determined to have a single insert. Genomic PCR using gene-specific and
napin promoter-specific primers demonstrated that
T3 plants from the three events, 1,848, 1,860, and 1,863, all contain the HPT1 transgene (data not
shown).

View larger version (65K):
[in this window]
[in a new window]
|
Figure 6.
Tocopherol content of T2
seed from pNapin::HPT1 Arabidopsis plants. A,
Total tocopherol levels (ng mg 1 seed) in
individual pools of segregating T2 seed derived
from 36 independent transgenic events containing the pCGN10822
construct (pNapin::HPT1) compared with vector (VC)
and wild-type (WT) control populations. B, Total tocopherol levels (ng
mg 1 seed) in individual pools of
T2 seed derived from 86 independent transgenic
events harboring the pCGN10803 construct
(e35S::HPT1antisense) are
compared with control populations. Error bars on control samples
represent the 95% confidence interval with the sample size indicated
as n. The gray bar in the background includes the 95%
confidence interval of both controls. Seed tocopherol levels of
wild-type ( ), vector control ( ), and T2
transgenic lines ( ).
|
|
To determine if HPT1 is required for tocopherol accumulation
in Arabidopsis seed, an antisense expression construct under control of
the enhanced cauliflower mosaic virus e35S promoter was tested.
Tocopherol levels were assayed in pooled segregating T2 seed from 88 independent transformation
events. Seed tocopherol levels of 19 events fell outside of the lower
limit of the 95% confidence interval for the controls, indicating that
HPT1 is necessary for tocopherol biosynthesis. Two events
(1,393 and 1,401) with significantly reduced tocopherol levels were
carried forward to the T3 generation, revealing
up to a 10-fold decrease in total tocopherols in some individual
T3 pools (data not shown). Statistical analysis
of T3 seed pools from these lines demonstrated
that the transgenic populations were distinct from wild-type and vector controls, further validating the reduced tocopherol phenotype (Table
III). Genomic PCR using gene-specific and e35S promoter-specific primers demonstrated that T3 plants from the two
events, 1,393 and 1,401, both contain the HPT1 transgene in
the antisense orientation (data not shown). Because of the low HPT
enzyme activity observed in chloroplast preparations (Table II), enzyme
assays were not performed on HPT1-expressing or
HPT1-antisense seed samples. The whole plant phenotype of
T2 antisense lines did not differ substantially from the wild type. These combined sense and antisense data further confirm that HPT1 encodes an HGA phytyltransferase, and show
that it is possible to alter tocopherol levels in seed using this gene.
 |
DISCUSSION |
Vitamin E is comprised of a mixture of various tocopherols, with
-tocopherol being the most bioactive (Sheppard and
Pennington, 1993 ). Tocopherols are naturally occurring
micronutrients, produced in plants and cyanobacteria. Many studies have
demonstrated that the antioxidant activity of these molecules has the
potential to positively impact human and animal health. Therefore,
tocopherols are valuable micronutrients and there is consequently
interest in developing plants that produce high levels of natural
tocopherols. One possible strategy to elevate tocopherol levels is to
increase flux through the pathway by overexpressing the enzyme that
catalyzes the first committed step in tocopherol biosynthesis,
the HPT.
Evidence that slr1736 is involved in tocopherol biosynthesis
in Synechocystis sp. PCC 6803 has been reported recently
(Schledz et al., 2001 ). In that study, an slr1736 deletion
mutant produces reduced levels of tocopherol, and based on a
colorimetric assay, accumulates HGA. Other prenyllipids including
phylloquinones, plastoquinones, and carotenoids are not affected in
this mutant. However, slr1736 occurs in an operon-like
structure with a downstream gene (slr1737). Even though the
amino acid sequence of slr1736 has similarity to known
prenyltransferases, complementation analysis of these genes in the
deletion mutant, or an enzyme assay of a recombinant expressed gene, is
necessary to verify function and that loss of Slr1736 activity is
responsible for the mutant phenotype. Here, the isolation and
characterization of HPT from Synechocystis sp. PCC 6803 (slr1736) and Arabidopsis (HPT1) is described.
HPT activity was demonstrated for slr1736 in the baculovirus
system and HPT1 was shown to complement the
slr1736 null mutant. Further, it was shown that expression
of the Arabidopsis gene, HPT1, under a seed-specific
promoter led to increased levels of seed tocopherols.
Using the UbiA protein sequence as a query in a PSI-BLAST search,
several HTP candidates from Synechocystis sp. PCC 6803 and Arabidopsis were identified. Based on the level of similarity to the
UbiA protein, efforts were focused on one Arabidopsis candidate, HPT1,
and the corresponding Synechocystis sp. PCC 6803 ortholog, Slr1736, to test in functional and enzymatic assays. It is worthwhile to note that when UbiA was used as a query in a standard BLAST search
(which performs only a single pass) of the Arabidopsis public database,
the only significant hit was to the putative UbiA Arabidopsis ortholog,
ATPT3 (8e 3). In contrast, the use
of a protein profile generated by the iterative PSI-BLAST program
(fourth iteration) resulted in a score of
1e 18 for HPT1 and
2e 29 for Slr1736. The increased
sensitivity of this program was particularly important given that the
public predicted protein of HPT1 lacked a significant portion of the
amino terminus and lacked the last 17 amino acids at the carboxy
terminus, making it more difficult to identify similarity to known
proteins and targeting signal peptides.
The fact that Slr1736 and HPT1 share conserved amino acid residues
known to be required for catalytic function in another aromatic
prenyltransferase (Fig. 3) suggests that these residues may be involved
in catalysis of the prenyltransfer reaction. These residues are also
found in the other Arabidopsis prenyltransferases presented, as well as
in UbiA, suggesting that these residues function in a broad array of
prenyltransferase reactions.
Characterization of the tocopherol null mutant of slr1736 in
Synechocystis sp. PCC 6803 and Arabidopsis HPT1
antisense lines with substantially reduced seed tocopherol levels
confirmed that these genes are essential for tocopherol biosynthesis.
Restoration of tocopherol biosynthesis in the Synechocystis
sp. PCC 6803 slr1736 null mutant by HPT1
confirmed that these genes are orthologs. Interestingly, the
slr1736 null strain was not compromised in its ability to
grow, indicating that tocopherols are not required for the growth of
this cyanobacterium under growth conditions used here. Whereas
tocopherols were not detected in the slr1736 null mutant in
this study, Schledz et al. (2001) report a 90% reduction in tocopherol
levels. The basis for this discrepancy is unclear.
Molecular analysis of slr1736 and HPT1, described
above, suggests that these genes encode HPTs. To demonstrate that these genes encode functional HPT, an enzyme assay was developed. HPT is
thought to catalyze the phytyltransfer from phytyl-DP onto HGA and the
decarboxylation reaction to yield 2-methyl-6-phytyl plastoquinol. Soll
et al. (1980) determined that in spinach, the HPT activity is
associated with membrane fractions. HPT1 and
slr1736 are predicted to encode integral membrane proteins,
agreeing with these observations. Enzyme assays of
Synechocystis sp. PCC 6803 wild-type and slr1736
null mutant membrane fractions confirmed that slr1736 is
essential for this activity (Table II). Expression of
slr1736 in insect cells conferred HPT activity to the
membrane fraction, further confirming that these genes encode for HPT activity.
In a previously published study of a screen for Arabidopsis carotenoid
mutants (Norris et al., 1995 ), a putative mutant in HPT or a
related step, pds2, was identified. The gene encoding PDS2 has not been cloned, but it maps to chromosome III,
whereas HPT1 maps to the top of chromosome II. Thus,
pds2 does not correspond to HPT1. There are a
variety of functions that could be encoded by PDS2,
including a regulatory factor or effector molecule. Further mapping or
other studies will be needed to determine the sequence of
PDS2, but the identification of at least two loci involved in controlling this step points to the diversity of regulation that
the sequencing of the Arabidopsis genome will allow us to explore.
In plants, HPT1 was shown to be important for tocopherol
accumulation based on the reduction of total tocopherols in
e35S::HPT1 antisense T3 seed
pools (Table III). Total tocopherol levels as low as 50 ng
mg 1 tissue were observed, which is 10-fold
lower than in wild-type seed. Interestingly, the levels of
-tocopherol were not significantly reduced in individual
T3 lines, whereas - and -isoforms are dramatically reduced in the most affected progeny (data not shown). These data suggest that there is still sufficient -tocopherol to
saturate -TMT, such that wild-type levels of -tocopherol are
still achieved.
Expression of HPT1 under the seed-specific napin promoter
resulted in up to a 2-fold increase in tocopherols in
T3 homozygous seeds. These data further validate
the role of HPT1 in tocopherol biosynthesis in Arabidopsis
seed and demonstrate that tocopherol levels can be modified in seed.
The majority of the increase in total tocopherols was caused by an
increase in -tocopherol (data not shown). -Tocopherol did
not increase, again indicating that -TMT is saturated at wild-type
levels of -tocopherol.
The initial step in tocopherol biosynthesis is the condensation of HGA
and phytyl-DP by HPT. It is often assumed that the first committed step
in a pathway will be a regulated step. As a consequence, one might
predict that enhanced expression of such an enzyme would lead to
increased flux through a given pathway. An example of increased flux
was demonstrated in another plastidial isoprenoid pathway, with
the overexpression of phytoene synthase in canola
(Brassica napus) seeds resulting in a 50-fold
increase in carotenoid levels (Shewmaker et al., 1999 ).
Expression of HPT1 under the napin promoter consistently
resulted in elevated levels of total tocopherols in seed; however, the
magnitude of increase was not above 2-fold in homozygous
T3 seed. In the high-carotenoid canola seeds, the
50-fold increase was possible only because carotenoids normally
comprise such a small fraction of the total isoprenoid population. The
overall increase in isoprenoid units was only 4-fold (Shewmaker et
al., 1999 ). These data suggest that there may be a limit to the
level that isoprenoids can be increased without increasing flux through
the methyl-erythritol phosphate pathway. In fact, there are studies
that demonstrate that geranylgeranylpyrophosphate, a phytol precursor,
may be limiting in tocopherol biosynthesis (Furuya et al.,
1987 ).
The antioxidant properties of tocopherols are strongly implicated in
many aspects of human health, including heart disease, cancer, and
inflammatory responses. Because of these demonstrated health benefits,
there is interest in developing ways to increase the intake of natural
tocopherols in human and animal diets. One strategy is to increase the
levels of tocopherols in oilseed crops by engineering components of the
tocopherol biosynthetic pathway. To engineer the pathway, it is first
necessary to identify the genes that encode all of the enzymes of the
pathway. In this study, the HPT responsible for the first committed
step in tocopherol biosynthesis was identified from Arabidopsis and
Synechocystis sp. PCC 6803. It was further demonstrated that
seed-specific expression of the Arabidopsis HPT1 in
Arabidopsis can elevate seed tocopherols 2-fold, a first step in
engineering oilseeds for high levels of tocopherols.
 |
MATERIALS AND METHODS |
Bacterial Strains and Growth Conditions
Cultures of Synechocystis sp. PCC 6803 were grown
photoautotrophically in BG11 media (Sigma, St. Louis) at 30°C under a
light intensity of 50 µE m 2 s 1, and 70%
relative humidity. Growth media for null mutants was supplemented with
25 µg mL 1 of kanamycin. Plasmids were stabilized in
Synechocystis sp. PCC 6803 by addition of 10 µg
mL 1 gentamycin. For growth on solid media, BG11 was
supplemented with 10 mM TES, pH 8.0, and 15 g
L 1 agar.
Construction of slr1736 Deletion Plasmid and
Synechocystis sp. PCC 6803 Transformation
Synthetic oligos A, B, C, and D were generated to amplify
regions from the 5' and 3' ends of slr1736 (A,
5'-TAATGTGTACATTGTCGGCCTC-3'; B,
5'-GCAATGTAACATCAG-AGATTTTGAGACACAACGTGGCTTTCCACAATTCCCC-GCACCGTC-3'; C,
5'-GGTATGAGTCAGCAACACCTTC-TTCACGAGGCAGACCTCAGCGGAATTGGTTTAGGTTA-TC-3'; and D, 5'-AGGCTAATAAGCACAAATGGGA-3'). The underlined nucleotides indicate regions homologous to the nptI gene. The 5'
ends of primers B and C contain a 40-bp region of DNA sequence that is
complementary to the 5' and 3' sequence of the nptI gene
from pUC4K (GenBank accession no. X06404), respectively. The 5' and the
3' fragments of slr1736 were PCR amplified and gel
purified (spin columns, Qiagen Inc., Valencia, CA) separately. The
nptI gene was obtained from pUC4K by
HincII digest followed by gel purification. To insert the nptI gene into slr1736, the purified
5' and 3' slr1736 fragments were mixed in a 1:1 ratio
with the purified nptI gene annealed and amplified for
40 cycles under the following conditions: 1 min of incubation at
94°C, 1 min at 55°C, and 1 min at 72°C (+5 s per cycle) using
pfu polymerase (Stratagene, La Jolla, CA) in 100 µL of
total reaction volume (Zhao and Arnold, 1997 ). A volume of 1 to 5 µL
of this reaction was used as template DNA for a second amplification
reaction using primers A and D, so that the resulting product contained
100 to 200 bp of the 5'-end of slr1736,
nptI, and 100 to 200 bp of the 3' end of
slr1736. This PCR product was then cloned into the
vector pGEM-T easy (Promega, Madison, WI), resulting in pMON21681 and
used for stable integration into the Synechocystis sp.
PCC 6803 genome. Synechocystis sp. PCC 6803 transformations were performed as described in Porter (1988) . Cells
grown with 25 µg mL 1 kanamycin were harvested to verify
successful gene disruption by PCR, and for tocopherol analysis.
Plant Vector Construction, Arabidopsis Transformation, and
Plant Growth
HPT1 5' and 3' ends were extended using RACE
(Advantage PCR kit, CLONTECH, Palo Alto, CA) from Arabidopsis accession
No-O inflorescence and silique cDNA libraries using the Marathon cDNA Amplification kit (CLONTECH) plus primers
5'-CCCACCAGCAGCGGA-AACAAGAGAAGAACT-3' and
5'-GTTTCTGGCTTGGGTG-GATTGTTGGTTCAT-3'. The RACE products were sequenced and the information was used to amplify the complete coding
region from the silique cDNA library using the primers 5'-GGATCCGCGGCCGCACA ATGGAGTCTC-TGCTCTCTAGTTCT-3' and
5'-GGATCCTGCAGGTCACT-TCAAAAAAGGTAACAGCAAGT-3'. BamHIand NotI sites flanked the
5' end of the gene and Sse8387I (Fisher Scientific,
Pittsburgh) and BamHI sites flanked the 3' end of the
gene. The PCR product was cloned into the pCR2.1 TA vector
(Invitrogen), resulting in the formation of pCGN10817. The DNA sequence
was confirmed by DNA sequencing. Subsequently, NotI- and
Sse8387I-digested HPT1 was cloned into
the binary expression vectors pCGN8643
(pNapin::HPT1sense::napin
3'; Kridl et al., 1991 ) and pCGN8644
(e35S::HPT1antisense::tml 3'; Chibbar et al., 1993 ), with final construct names pCGN10822 and pCGN10803, respectively. These vectors were electroporated into
Agrobacterium tumefaciens strain ABI and grown under
standard conditions (McBride et al., 1994 ), reconfirmed by
restriction analysis, and transformed into Arabidopsis accession No-O
using the dipping method (Clough and Bent, 1998 ).
T0 plants were grown in a growth chamber under 16 h of
light, 19°C, and T1 seeds were selected on germination
plates with kanamycin (1× Murashige and Skoog salts, 10 g
L 1 Suc, 100 mg L 1 myo-inositol, 1 mg
L 1 thiamine-HCl, 0.5 mg L 1 pyridoxine-HCl,
0.5 mg L 1 nicotinic acid, 0.5 g L 1
MES, 100 mg L 1 carbenicillin, 50 mg L 1
kanamycin, and 20 mg L 1 benlate, pH 5.7) and resistant
plants were grown at 22°C. The number of insertions was determined by
plating segregating T2 seed onto germination plates and
scoring the number of germinating and non-germinating seeds.
Complementation of slr1736 Null Mutant Strain
For complementation of the Synechocystis sp. PCC
6803 slr1736 null mutant, mature HPT1 was
cloned into pSL1211, a vector based on the broad host range plasmid
RSF1010 (Ng et al., 2000 ). The mature HPT1 gene
was amplified from the vector pCGN10817 by PCR using primers HPT1nco.pr
(CCATGGATTCGAGTAAAGTTGTCGC) and HPT1r1.pr (GAATTCACTTCAAAAAAGGTAACAG).
These primers were designed to remove 36 amino-terminal amino acids,
which are predicted to serve a plastidial target sequence. In addition,
these primers engineered an NcoI site at the new
translational start codon and an EcoRI site at the 3'
end of the gene. The PCR product was ligated into pGEM-T easy
(Promega), resulting in the formation of pMON21689 and sequence
confirmed. The NcoI/EcoRI fragment from
pMON21689 was ligated with the EagI/EcoRI
and EagI/NcoI fragments from pSL1211, resulting in the formation of pMON21690. The plasmid pMON21690 was
introduced into the Synechocystis sp. PCC 6803 slr1736 null mutant via conjugation (Elhani and
Wolk, 1988 ).
Baculovirus Expression Vectors
For confirmation of HPT activity of slr1736 and
mature HPT1 expression products, both genes were cloned
as EcoRI fragments into the Bac-to-Bac Baculovirus
Expression Systems (Invitrogen). Integration into the bacmid,
transformation, and gene expression was done according to the
manufacturer's protocol.
HPT Assay
HPT was assayed using tritiated HGA (40 Ci mmol 1)
and nonlabeled phytyl-DP as substrates. Tritiated HGA was obtained by
bromination of unlabeled HGA at room temperature in the presence of
acetic acid and subsequent tritiation in the presence of Pd-activated charcoal in ethanol (Koelsch, 1955 ). 3,4-[3H]HGA was
stored in 0.1% (v/v) H3PO4. Phytyl-DP was
synthesized as described by Joo et al. (1973) . Standard
compounds for 2-methyl-6-phytyl-plastoquinol and
2,3-dimethyl-5-phytylquinol were synthesized as described by Soll et
al. (1980) . The structures were verified by mass spectroscopy. Nonlabeled HGA was obtained from Sigma. -, -, -,
-tocopherol, and tocol, were purchased from Matreya (Pleasant Gap,
PA). For enzyme assays of Synechocystis sp. PCC 6803 strains, total membranes were isolated by a variation of the procedure
of Zak et al. (1999) , in which the chlorophyll content was adjusted to
0.1 to 0.5 mg chlorophyll mL 1, protease inhibitor
cocktail (Roche, Basel) was added to the extraction buffer, and the
ultracentrifugation time for isolation of total membranes was increased
from 30 min to 1 h at 100,000g. Membrane fractions
from insect cells were isolated as described in Cases et al. (1998) .
The HPT assay was validated using spinach (Spinacia
oleracea) chloroplasts and Synechocystis sp. PCC
6803 membrane preparations as positive controls. For HPT assays using spinach chloroplasts, chloroplasts were isolated from 250 g of spinach leaves obtained from local markets as described by Douce and
Joyard (1982) .
The enzyme assay contained 60 µM [3H]HGA,
which had been adjusted to a specific activity of 0.16 to 4 Ci
mmol 1. In addition to HGA, the enzyme assay (final volume
1 mL) contained 50 mM Tris-HCl, pH 7.6, 4 mM
MgCl2, and 100 µM phytyl pyrophosphate. The
reaction was initiated by addition of membrane fractions or chloroplast
preparations and terminated by adding 2 mL of chloroform:methanol (1:2
[v/v]) after 2 h of incubation at 23°C. The extraction
procedure was initiated by addition of tocol (2-5 µg
L 1 final concentration), which served as an internal
standard to monitor the extraction efficiency. Phase separation was
achieved after supplementation with 2 mL of 0.9% (w/v) aqueous NaCl
solution and vigorous shaking. This extraction procedure was repeated
three times. The organic layer containing the prenylquinones was
filtered (0.2-µm Gelman PTFE acrodisc, 13-mm syringe filters, Pall
Gelman Laboratory Inc., Ann Arbor, MI), evaporated under
N2, and then resuspended in 100 µL of ethanol.
The reaction products were separated by isocratic normal-phase HPLC
(90% [v/v] hexane and 10% [v/v] methyl-t-butyl
ether), using a Zorbax silica column (Agilent Technologies, Atlanta), 4.6 × 250 mm (5 µm). Alternatively, samples were analyzed by
isocratic reversed-phase HPLC (0.1% [v/v]
H3PO4 in MeOH), using a Vydac 201HS54 C18
column (Western Analytical, Murrieta, CA), 4.6 × 250 mm, coupled
with a C18 guard column (Alltech, Inc., Nicholasville KY). The amount
of reaction products were calculated based on the specific
radioactivity of the substrate, and adjusted according to the recovery
based on the tocol standard. Tocol recovery was determined based on
fluorescence measurement.
Tocopherol and Chlorophyll Analysis
Tocopherols were separated by normal phase HPLC eluting with a
hexane (solvent A) methyl-t-butyl ether (solvent B)
gradient (gradient conditions: 0-10 min, 90% [v/v] A and 10%
[v/v] B; 11 min, 25% [v/v] A and 75% [v/v] B; and 12 min, 90%
[v/v] A and 10% [v/v] B) using an injection volume of 20 µL, a
flow rate of 1.5 mL min 1, and a run time of 12 min
(40°C). Tocopherol concentration and composition was calculated based
on standard curves for -, -, -, and -tocopherol using
Chemstation software (Agilent Technologies). Synechocystis sp. PCC 6803 samples were harvested in
late logarithmic growth phase by centrifugation. One gram of 0.1-mm
microbeads (Biospecifics Technologies Corp., Lynbrook, NY) and 500 µL
of 1% (w/v) pyrogallol (Sigma) in ethanol were added to a cell
pellet from 1 mL of culture. Tocol was added as internal standard. The mixture was shaken for 1 min in a mini-Beadbeater (Biospecifics Technologies Corp.) on "fast" speed. For seed tocopherol
determination, 10 mg of mature seed was added to 1 g of microbeads
(Biospecifics Technologies Corp.) in a sterile microfuge tube to which
500 µL of 1% (w/v) pyrogallol (Sigma) in ethanol was added.
The mixture was shaken for 3 min in a mini-Beadbeater (Biospecifics
Technologies Corp.) on "fast" speed. The extract was filtered
(0.2-µm Gelman PTFE acrodisc, 13-mm syringe filters, Pall Gelman
Laboratory Inc.) into an autosampler tube. HPLC was performed on a
Zorbax silica HPLC column, 4.6 × 250 mm (5 µm), with a
fluorescent detection using a Hewlett-Packard HPLC (Agilent
Technologies). Sample excitation was at 290 nm, and emission was
monitored at 336 nm. Chlorophyll concentration was determined (Arnon,
1949 ).
Statistical evaluation of seed tocopherol data was performed with Excel
2000 (Microsoft Corp., Seattle). Because T2 seed pools were
derived from independent transformation events, they do not represent
replicates, and cannot be regarded as a homogeneous population.
Therefore, tocopherol data from single events were compared with the
95% confidence interval of control populations. Data points outside
the 95% confidence interval were regarded as significantly different
from the controls. In contrast, T3 seed samples are
homogeneous for the insertion locus of a given event. Therefore,
T3 populations were compared via a Student's t test to the control populations. Populations with a
P value < 0.05 were regarded as significantly different.
 |
ACKNOWLEDGMENTS |
We would like to thank Susan Baszis for technical assistance, as
well as Charlene Levering, Brenda Reed, and Tawnya MacNeil for plant
transformations and care. Robin Emig is thanked for his support in
developing bioinformatics tools. Brad Mckinnis deserves our thanks for
providing tritiated HGA, and Anabayan Kessavalou is thanked for
statistical support. Additional thanks to Thomas J. Savage for critical
reading of the manuscript.
 |
FOOTNOTES |
Received August 16, 2001; returned for revision November 7, 2001; accepted January 24, 2002.
1
Present address: Maxygen, Inc., 515 Galveston Drive, Redwood City, CA 94063.
*
Corresponding author; e-mail henry.e.valentin{at}monsanto.com;
fax 314-694-8275.
Article, publication date, and citation information can be found at
www.plantphysiol.org/cgi/doi/10.1104/pp.010747.
 |
LITERATURE CITED |
-
Altschul S, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ
(1997)
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res
25: 3389-3402[Abstract/Free Full Text]
-
Arigoni D, Sagner S, Latzel C, Eisenreich W, Bacher A, Zenk MH
(1997)
Terpenoid biosynthesis from 1-deoxy-D-xylulose in higher plants by intramolecular skeletal rearrangement.
Proc Natl Acad Sci USA
94: 10600-10605[Abstract/Free Full Text]
-
Arnon DI
(1949)
Copper enzymes in isolated chloroplasts. Polyphenol oxidase in Beta vulgaris.
Plant Physiol
24: 1-15[Free Full Text]
-
Ashby MN, Edwards PA
(1990)
Elucidation of the deficiency in two yeast coenzyme Q mutants.
J Biol Chem
265: 13157-13164[Abstract/Free Full Text]
-
Bramley P, Elmadfa I, Kafatos A, Kelly FJ, Manios Y, Roxborough HE, Schuch W, Sheehy PJA, Wagner K-H
(2000)
Review vitamin E.
J Sci Food Agric
80: 913-938[CrossRef][Web of Science]
-
Camara B, d'Harlingue A
(1985)
Demonstration and solubilization of S-adenosylmethionine:
-tocopherol methyltransferase from Capsicum chromoplasts.
Plant Cell Rep
4: 31-32 -
Carottoli A, Romano N, Ballario P, Morelli G, Macino G
(1991)
The Neurospora Crassa carotenoid biosynthetic gene "Albino 3" reveals highly conserved regions among prenyl transferases.
J Biol Chem
266: 5854-5857[Abstract/Free Full Text]
-
Cases S, Smith SJ, Zheng YW, Myers HM, Lear SR, Sande E, Novak S, Collins C, Welch CB, Lusis AJ, et al
(1998)
Identification of a gene encoding an acyl CoA:diacylglycerol acyltransferase, a key enzyme in triacylglycerol synthesis.
Proc Natl Acad Sci USA
95: 13018-13023[Abstract/Free Full Text]
-
Chen AK, Kroon PA, Poulter CD
(1994)
Isoprenyl diphosphate synthases: protein sequence comparisons, a phylogenetic tree, and predictions of secondary structure.
Prot Sci
3: 600-607[Web of Science][Medline]
-
Chibbar R, Kartha KK, Datta RSS, Leung N, Caswell K, Mallard CS, Steinhauer L
(1993)
The effect of different promoter-sequences on transient expression of gus reporter gene in cultured barley (Hordeum vulgare L.) cells.
Plant Cell Rep
12: 506-509
-
Chow C, Draper HH
(1974)
Oxidative stability and antioxidant activity of the tocopherols in corn and soybean oils.
Int J Vitam Nutr Res
44: 396-403[Web of Science][Medline]
-
Clough S, Bent AF
(1998)
Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana.
Plant J
16: 735-743[CrossRef][Web of Science][Medline]
-
Collakova E, DellaPenna D
(2001)
Isolation and functional analysis of homogentisate phytyltransferase from Synechocystis sp. PCC 6803 and Arabidopsis.
Plant Physiol
127: 1113-1124[Abstract/Free Full Text]
-
DellaPenna D
(1999)
Nutritional genomics: manipulating plant micronutrients to improve human health.
Science
285: 375-379[Abstract/Free Full Text]
-
DellaPenna D, Collakova E, Coughlan SJ, Helentjaris T
(2000) Phytyl/prenyltransferase nucleic acids, polypeptides and uses
thereof. Patent Application WO 0068393
-
Demurin Y, Skoric D, Karlovic D
(1996)
Genetic variability of tocopherol composition in sunflower seeds as a basis of breeding for improved oil quality.
Plant Breed
115: 33-36[CrossRef]
-
Douce R, Joyard J
(1982)
Purification of the chloroplast envelope.
In
M Edelman, RB Hallick, N-H Chua, eds, Methods of Chloroplast Molecular Biology. Elsevier, Amsterdam, pp 239-256
-
Elhani J, Wolk P
(1988)
Conjugal transfer of DNA into cyanobacteria.
Methods Enzymol
167: 747-754[Web of Science][Medline]
-
Emanuelsson O, Nielsen H, von Heijne G
(1999)
ChloroP, a neural network-based method for predicting chloroplast transit peptides and their cleavage sites.
Prot Sci
8: 978-984[Web of Science][Medline]
-
Fiedler E, Soll J, Schultz G
(1982)
The formation of homogentisate in the biosynthesis of tocopherol and plastoquinone in spinach chloroplasts.
Planta
155: 511-515[CrossRef][Web of Science]
-
Furuya T, Yoshikawa T, Kimura T, Kaneko H
(1987)
Production of tocopherols by cell culture of Safflower.
Phytochemistry
26: 2741-2747[CrossRef]
-
Gaubier P, Wu H-J, Laudie M, Delseny M, Grellar F
(1995)
Chlorophyl synthetase gene from Arabidopsis thaliana.
Mol Gen Genet
249: 58-64[CrossRef][Web of Science][Medline]
-
Gottstein T, Grosch W
(1990)
Model study of different antioxidant properties of
- and -tocopherol in fats.
Fat Sci Technol
4: 139-144 -
Joo CN, Park CE, Kramer KG, Kates M
(1973)
Synthesis and acid hydrolysis of monophosphate and pyrophosphate esters of phytanol and phytol.
Can J Biochem
51: 1527-1536[Medline]
-
Koelsch FC
(1955)
6-Bromo-2-naphthol.
In
EC Horning, ed, Organic Synthesis Collective Vol 3, A Revised Edition Of Annual Volumes 20-29. John Wiley & Sons, Inc., New York, pp 132-133
-
Kridl J, McCarter DW, Rose RE, Scherer DE, Knutzon DS, Radke SE, Knauf VC
(1991)
Isolation and characterization of an expressed napin gene from Brassica napus.
Seed Sci Res
1: 209-219
-
Kyte J, Doolittle RF
(1982)
A simple method for displaying the hydropathic character of a protein.
J Mol Biol
157: 105-132[CrossRef][Web of Science][Medline]
-
Lichtenthaler HK, Rohmer M, Schwender J
(1997)
Two independent biochemical pathways for isopentenyl diphosphate and isoprenoid biosynthesis in higher plants.
Physiol Plant
101: 643-652[CrossRef]
-
Marrero PF, Poulter CD, Edwards PA
(1992)
Effects of site-directed mutagenesis of the highly conserved aspartate residues in domain II of farnesyl diphosphate synthase activity.
J Biol Chem
267: 21873-21878[Abstract/Free Full Text]
-
Marshall P, Morris SR, Threlfall DR
(1985)
Biosynthesis of tocopherols: a re-examination of the biosynthesis and metabolism of 2-methyl-6-phytyl-1,4-benzoquinol.
Phytochemistry
24: 1705-1711[CrossRef]
-
McBride KE, Schaaf DJ, Daley M, Stalker DM
(1994)
Controlled expression of plastid transgenes in plants based on a nuclear DNA-encoded and plastid-targeted T7 RNA polymerase.
Proc Natl Acad Sci USA
91: 7301-7305[Abstract/Free Full Text]
-
Melzer M
(1994)
Characterization of polyprenyldiphosphate: 4-hydroxybenzoate polyprenyltransferase from Escherichia coli.
Biochim Biophys Acta
1212: 93-102[Medline]
-
Ng W-O, Zentella R, Wany Y, Taylor JS, Pakrashi HB
(2000)
phrA, the major photoreactivating factor in cyanobacterium Synechocystis sp. strain PCC 6803 codes for cyclobutane-pyrimidine-dimer-specific DNA photolyase.
Arch Microbiol
173: 412-417[CrossRef][Web of Science][Medline]
-
Norris SR, Barrette TR, DellaPenna D
(1995)
Genetic dissection of carotenoid synthesis in Arabidopsis defines plastoquinone as an essential component of phytoene desaturation.
Plant Cell
7: 2139-2149[Abstract]
-
Ogura K, Koyama T, Sagami H
(1997)
Polyprenyl diphosphate synthases.
In
R Bittman, ed, Subcellular Biochemistry, Vol. 28. Plenum Press, New York, pp 57-87
-
Oster U, Bauer CE, Rudiger W
(1997)
Characterization of chlorophyll A and bacteriochlorophyll A synthases by heterologous expression in Escherichia coli.
Biol Chem
272: 9671-9676[Abstract/Free Full Text]
-
Oster U, Rudiger W
(1997)
The G4 gene of Arabidopsis thaliana encodes a chlorophyll synthase of etiolated plants.
Bot Acta
110: 420-423[Web of Science]
-
Parkhurst R, Skinner WA, Sturm PA
(1968)
The effect of various concentrations of tocopherols and tocopherol mixtures on the oxidative stability of a sample of lard.
J Am Oil Chem Soc
45: 641-642
-
Porter RD
(1988)
DNA transformation.
In
L Packer, AN Glazer, eds, Methods in Enzymology, Section VI, Vol. 167, Cyanobacteria. Academic Press, Inc., San Diego, pp 703-712
-
Russell D, Bennet GN
(1982)
Construction and analysis of in vivo activity of E. coli promoter hybrids and promoter mutants that alter the
35 to 10 spacing.
Gene
20: 231-243[CrossRef][Medline] -
Saiki K, Mogi T, Hori H, Tsubaki M, Anraku Y
(1993)
Identification of the functional domains of heme-O-synthase.
J Biol Chem
268: 26927-26934[Abstract/Free Full Text]
-
Savidge B, Lassner MW, Weiss JD, Post-Beittenmiller D
(2000) Protein and cDNA sequences of Arabidopsis
dimethylallyltransferase and the uses thereof on altering
tocopherol synthesis in plants. Patent Application WO 0063391 A2
-
Schledz M, Seidler A, Beyer P, Nuehaus G
(2001)
A novel phytyltransferase from Synechocystis sp. PCC 6803 involved in tocopherol biosynthesis.
FEBS Lett
499: 15-20[CrossRef][Medline]
-
Schultz-Siebert D, Homeyer U, Soll J, Schultz G
(1987)
Synthesis of plastoquinone-9,
-tocopherol and phylloquinone (vitamin K1) and its integration in chloroplast carbon metabolism of higher plants.
In
P Stumpf, JB Mudd, WD Nes, eds, The Metabolism, Structure and Function of Plant Lipids. Plenum Press, New York, pp 29-36 -
Sheppard AJ, Pennington JAT
(1993)
Analysis and distribution of vitamin E in vegetable oils and foods.
In
JFL Packer, ed, Vitamin E in Health and Disease. Marcel Dekker, New York, pp 9-31
-
Shewmaker C, Sheehy JA, Daley M, Colburn S, Ke DY
(1999)
Seed-specific overexpression of phyoene synthase: increase in carotenoids and other metabolic effects.
Plant J
20: 401-412[CrossRef][Web of Science][Medline]
-
Shintani D, DellaPenna D
(1998)
Elevating the Vitamin E Content of plants through metabolic engineering.
Science
282: 2098-2100[Abstract/Free Full Text]
-
Soll J, Kemmerling M, Schultz G
(1980)
Tocopherol and plastoquinone synthesis in spinach chloroplasts subfractions.
Arch Biochem Biophys
204: 544-550[CrossRef][Web of Science][Medline]
-
Soll J, Schultz G, Joyard J, Douce R, Block MA
(1985)
Localization and synthesis of prenylquinones in isolated outer and inner envelop membranes from spinach chloroplasts.
Arch Biochem Biophys
238: 290-299[CrossRef][Web of Science][Medline]
-
Tan B
(1989)
Palm carotenoids, tocopherols and tocotrienols.
J Am Oil Chemists Soc
66: 770-776
-
Zak E, Norling B, Andersson B, Pakrashi HB
(1999)
Subcellular location of the BtpA protein in the cyanobacterium Synechocystis sp. PCC 6803.
Eur J Biochem
261: 311-316[Web of Science][Medline]
-
Zhao H, Arnold FH
(1997)
Optimization of DNA shuffling for high fidelity recombination.
Nucleic Acids Res
25: 1307-1308[Abstract/Free Full Text]
© 2002 American Society of Plant Physiologists
This article has been cited by other articles:

|
 |

|
 |
 
T. E. Clemente and E. B. Cahoon
Soybean Oil: Genetic Approaches for Modification of Functionality and Total Content
Plant Physiology,
November 1, 2009;
151(3):
1030 - 1040.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Yang, C. Yin, W. Li, and X. Xu
{alpha}-Tocopherol Is Essential for Acquired Chill-Light Tolerance in the Cyanobacterium Synechocystis sp. Strain PCC 6803
J. Bacteriol.,
March 1, 2008;
190(5):
1554 - 1560.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Sasaki, K. Mito, K. Ohara, H. Yamamoto, and K. Yazaki
Cloning and Characterization of Naringenin 8-Prenyltransferase, a Flavonoid-Specific Prenyltransferase of Sophora flavescens
Plant Physiology,
March 1, 2008;
146(3):
1075 - 1084.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Maeda, T. L. Sage, G. Isaac, R. Welti, and D. DellaPenna
Tocopherols Modulate Extraplastidic Polyunsaturated Fatty Acid Metabolism in Arabidopsis at Low Temperature
PLANT CELL,
February 1, 2008;
20(2):
452 - 470.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. E. Valentin, K. Lincoln, F. Moshiri, P. K. Jensen, Q. Qi, T. V. Venkatesh, B. Karunanandaa, S. R. Baszis, S. R. Norris, B. Savidge, et al.
The Arabidopsis vitamin E pathway gene5-1 Mutant Reveals a Critical Role for Phytol Kinase in Seed Tocopherol Biosynthesis
PLANT CELL,
January 1, 2006;
18(1):
212 - 224.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Qi, M. Hao, W.-o. Ng, S. C. Slater, S. R. Baszis, J. D. Weiss, and H. E. Valentin
Application of the Synechococcus nirA Promoter To Establish an Inducible Expression System for Engineering the Synechocystis Tocopherol Pathway
Appl. Envir. Microbiol.,
October 1, 2005;
71(10):
5678 - 5684.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Kanwischer, S. Porfirova, E. Bergmuller, and P. Dormann
Alterations in Tocopherol Cyclase Activity in Transgenic and Mutant Plants of Arabidopsis Affect Tocopherol Content, Tocopherol Composition, and Oxidative Stress
Plant Physiology,
February 1, 2005;
137(2):
713 - 723.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Hofius, M.-R. Hajirezaei, M. Geiger, H. Tschiersch, M. Melzer, and U. Sonnewald
RNAi-Mediated Tocopherol Deficiency Impairs Photoassimilate Export in Transgenic Potato Plants
Plant Physiology,
July 1, 2004;
135(3):
1256 - 1268.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. E. Sattler, L. U. Gilliland, M. Magallanes-Lundback, M. Pollard, and D. DellaPenna
Vitamin E Is Essential for Seed Longevity and for Preventing Lipid Peroxidation during Germination
PLANT CELL,
June 1, 2004;
16(6):
1419 - 1432.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Rippert, C. Scimemi, M. Dubald, and M. Matringe
Engineering Plant Shikimate Pathway for Production of Tocotrienol and Improving Herbicide Resistance
Plant Physiology,
January 1, 2004;
134(1):
92 - 100.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. L. Van Eenennaam, K. Lincoln, T. P. Durrett, H. E. Valentin, C. K. Shewmaker, G. M. Thorne, J. Jiang, S. R. Baszis, C. K. Levering, E. D. Aasen, et al.
Engineering Vitamin E Content: From Arabidopsis Mutant to Soy Oil
PLANT CELL,
December 1, 2003;
15(12):
3007 - 3019.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Cheng, S. Sattler, H. Maeda, Y. Sakuragi, D. A. Bryant, and D. DellaPenna
Highly Divergent Methyltransferases Catalyze a Conserved Reaction in Tocopherol and Plastoquinone Synthesis in Cyanobacteria and Photosynthetic Eukaryotes
PLANT CELL,
October 1, 2003;
15(10):
2343 - 2356.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Collakova and D. DellaPenna
The Role of Homogentisate Phytyltransferase and Other Tocopherol Pathway Enzymes in the Regulation of Tocopherol Synthesis during Abiotic Stress
Plant Physiology,
October 1, 2003;
133(2):
930 - 940.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. E. Sattler, E. B. Cahoon, S. J. Coughlan, and D. DellaPenna
Characterization of Tocopherol Cyclases from Higher Plants and Cyanobacteria. Evolutionary Implications for Tocopherol Synthesis and Function
Plant Physiology,
August 1, 2003;
132(4):
2184 - 2195.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Collakova and D. DellaPenna
Homogentisate Phytyltransferase Activity Is Limiting for Tocopherol Biosynthesis in Arabidopsis
Plant Physiology,
February 1, 2003;
131(2):
632 - 642.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|