|
|
||||||||
|
First published online May 16, 2002; 10.1104/pp.002675 Plant Physiol, June 2002, Vol. 129, pp. 638-649 Regulation of the Cell Expansion Gene RHD3 during Arabidopsis Development1Department of Molecular, Cellular, and Developmental Biology, University of Michigan, Ann Arbor, Michigan 48109-1048
The RHD3 (ROOT HAIR
DEFECTIVE3) gene encodes a putative GTP-binding protein
required for appropriate cell enlargement in Arabidopsis. To obtain
insight into the mechanisms of RHD3 regulation,
we conducted a molecular genetic dissection of RHD3 gene
expression and function. Gene fusion and complementation studies show
that the RHD3 gene is highly expressed throughout
Arabidopsis development and is controlled by two major regulatory
regions. One regulatory region is located between
The proper development of plant
shape is at least partly dependent on regulated cell expansion (Steeves
and Sussex, 1989 The Arabidopsis root epidermis has been exploited for
studying the molecular and cellular basis of plant cell morphogenesis because of its simplicity and accessibility (Schiefelbein et al., 1997 In previous studies, several genetic loci involved in
Arabidopsis root epidermal cell morphogenesis have been identified. For
example, the RHD (ROOT HAIR DEFECTIVE)
1-4 genes (Schiefelbein and Somerville, 1990 To gain insight into the molecular regulation of RHD3, we analyzed RHD3 expression by in situ hybridization, RHD3 promoter-GUS reporter gene fusions, and molecular complementation experiments. These studies document the critical role of a 5'- non-transcribed region and the large first intron in regulating RHD3 gene expression and function. In addition, we analyzed the potential role of other RHD genes and plant hormones in regulating the RHD3 gene.
RHD3 Is Expressed throughout the Arabidopsis Plant To study the expression pattern of the RHD3 gene, we
first employed whole-mount in situ RNA hybridization experiments with RHD3 probes on Arabidopsis seedling roots. RHD3
transcripts were detected in the elongation zone of wild-type seedling
roots (Fig. 1, A and B). This result is
consistent with the postulated RHD3 role in regulating cell
enlargement. The rhd3-3 mutant, which bears a nonsense
mutation, exhibits a greatly reduced transcript level in a
northern-blot analysis (Wang et al., 1997
To examine RHD3 expression in greater detail, we constructed
and analyzed a RHD3 promoter-
Based on these results, we used the same genomic RHD3 DNA sequences (1.6 kb of 5'-non-coding sequence, the first exon, and the first intron) to generate a translational fusion to the GUS reporter gene (designated construct X1; Fig. 2). Twelve independent transgenic lines bearing this construct were obtained and analyzed, and the pattern of GUS accumulation was similar in all lines. These RHD3 regulatory sequences direct high levels of GUS expression throughout the root, including the root elongation zone (Fig. 1, E-H). When the transgenic X1 plants were incubated in GUS substrates for an extended period of time (8-16 h), stained cells were detected in all plant tissues. For example, GUS expression was observed in the cotyledons (Fig. 1K) and hypocotyl (data not shown) of seedlings, the leaf (Fig. 1M), stem (Fig. 1O), and pedicel (Fig. 1Q) of mature plants, and the stigmatic papillae cells and anther of flowers (Fig. 1, S-U). In addition, GUS expression was detected throughout the developing embryo of these RHD3::GUS lines (Fig. 1W). These results suggest that the RHD3 gene is expressed throughout the Arabidopsis plant and therefore may participate in a fundamental cellular process. Identification of RHD3 Regulatory Regions To study the regulation of RHD3, a series of deletion constructs of the X1 RHD3::GUS fusion were generated (Fig. 2). The H2 construct is essentially the same as X1 except that it lacks 100 bp at the 5' end (Fig. 2). Transgenic H2 plants exhibit the same GUS expression pattern as construct X1 (data not shown), suggesting that the distal 100-bp upstream sequence is not required for regulating RHD3 expression. The RHD3::GUS construct H1 is similar to H2 except
that it is a transcriptional fusion and lacks the entire 558-bp first
intron of RHD3 as well as 73 bp of the first exon that
flanks this first intron (Fig. 2). GUS expression in H1 transgenic
plants was found to be restricted to the vascular tissues of the roots
(Fig. 1, I and J), and discontinuous weak expression in the vascular
tissue of the cotyledon (Fig. 1L), leaf (Fig. 1N), stem (Fig. 1P),
pedicel (Fig. 1R), and the flower sepals (Fig. 1V), and no detectable expression in the developing embryo (Fig. 1X). In addition,
quantitative GUS assays showed that the average GUS activity in the
seedlings roots from the H1 lines is less than 1% of the activity
present in the H2 lines (29,300 versus 210 pmol methylumbelliferone
min Two additional constructs, B2 and B4, were generated that contain
approximately 600 bp of the 5' non-transcribed sequence plus 90 bp of
the distal first exon sequence transcriptionally fused to the GUS
reporter gene (Fig. 2). The B2 construct has this RHD3 DNA
segment in the correct orientation, and B4 has this in the reverse
orientation (as a negative control), with respect to the GUS
gene-coding region (Fig. 2). No GUS staining was observed in transgenic
plants harboring either of these constructs (data not shown),
suggesting that these sequences are not sufficient to drive gene
expression at a detectable level. Comparing the expression patterns of
constructs B2 and H1 leads to the conclusion that sequences located
between The First Intron Is Required to Confer Appropriate RHD3 Expression The dramatically different expression patterns conferred by constructs H2 and H1 indicate that the 631-bp intragenic sequence plays an important role in regulating RHD3 expression. To determine whether it is the 73-bp proximal first exon segment or the 558-bp intron sequence that possesses a regulatory function, a construct (designated H2-I) was generated that is identical to H2 except that it lacks the first intron (Fig. 4). The GUS gene expression pattern in H2-I transgenic plants is similar to H1 (Fig. 5A; data not shown), indicating that the 73-bp proximal first exon sequence does not have a major effect on the reporter gene expression; thus, the RHD3 expression pattern is dependent on the first intron sequence.
The effect of the intron sequence was explored by conducting RNA-blot (northern) analysis with the H2, H2-I, and H1 lines. Using a GUS-specific probe, we discovered an abundant RNA of the appropriate size in seedling RNA from the H2, but no hybridizing band was detected in the H2-I or H1 lines (Fig. 6). This indicates that the RHD3 intron is required for proper gene transcription or RNA stability.
To test the possibility that the first intron may possess a transcriptional enhancer-like element, a GUS reporter fusion was constructed with the first intron sequence placed upstream of the 1.5-kb RHD3 native promoter (construct H1Ia; Fig. 4) and upstream of the 0.6-kb promoter fragment in the B2 construct (construct B2I; Fig. 4). In addition, the RHD3 first intron was placed upstream of the heterologous cauliflower mosaic virus 35S minimal promoter (containing 46-bp promoter sequences and unable to induce detectable expression by itself) and the cauliflower mosaic virus 35S constitutive promoter fused to the GUS reporter (constructs 35SMI and 35Sia, respectively; Fig. 4). Furthermore, GUS fusions were made with the intron placed in an inverse orientation upstream of the 1.5-kb RHD3 native promoter and the 35S constitutive promoter (constructs H1Ib and 35Sib, respectively; Fig. 4). If the RHD3 intron sequence acts as an enhancer-like element to influence gene transcription, these constructs would be expected to confer a high level of GUS expression. However, transgenic lines bearing these constructs failed to exhibit a detectable difference in GUS expression (assessed by histochemical staining) compared with lines with the intron-less control constructs (data not shown). One possible explanation for the results above is that the first RHD3 intron regulates expression only when it is located within the transcribed portion of a gene. To test this, GUS constructs were generated with the first intron (in its correct orientation) within the transcribed non-coding region downstream of the 1.5-kb native RHD3 promoter and the 35S constitutive promoter (constructs H1Ic and 35Sic, respectively; Fig. 4). Surprisingly, transgenic plants bearing these constructs actually exhibited a reduction in GUS expression, compared with plants containing the intron-less control constructs (Fig. 5, B-D). Reverse transcriptase-PCR experiments indicated that the intron was spliced properly from the H1Ic transcript (data not shown). Together, comparing the effects of the H1Ic and H2 constructs, the first RHD3 intron apparently affects gene expression only when located at its normal position. RHD3 Gene Function Is Dependent on the Presence of the First Intron Although the above results show that the first intron is required for appropriate RHD3 gene expression, the significance of this intron for RHD3 function was not clear. As described, the 12A RHD3 construct, which contains the RHD3 promoter and first intron fused to the RHD3 cDNA, can fully complement the rhd3 mutant phenotype (Fig. 3; Table I). A construct was generated (designated 12A-I) that contains the same upstream regulatory sequences as the 12A construct fused to the RHD3 cDNA, except that the first intron was excluded (Fig. 7A). This construct was introduced into the rhd3-2 and rhd3-3 mutant lines, and the resulting transgenic plants exhibited either the rhd3 mutant phenotype or a phenotype intermediate between the rhd3 mutant and wild type (Fig. 7, B-G; Table I). The inability of this construct to complement the rhd3 mutant shows that the first intron is required for RHD3 gene function.
To test whether increased transcription of the RHD3 gene could substitute for the presence of the first intron, a construct was generated (35S::RHD3, Fig. 4) in which the RHD3 cDNA was placed under control of the constitutive 35S promoter. After transformation of rhd3-3 mutant plants, this transgene did not rescue the rhd3 mutant phenotype (Fig. 5E), although a partially complemented phenotype was observed in three of 14 lines (Fig. 5F). The results from a northern-blot analysis showed that the failed complementation was not due to transgene inactivation (e.g. cosuppression); in fact, the overall level of RHD3 RNA is much greater in the 35S-RHD3 lines than in wild-type plants (Fig. 8). This indicates that the high level of gene transcription directed by the 35S promoter is not sufficient to ensure RHD3 gene function.
In a related experiment, we sought to determine whether the 35S promoter might complement the rhd3 mutant if the first intron is included in the transcribed (non-translated) region in the proper orientation (construct 35SI::RHD3, Fig. 4). However, when introduced into rhd3 mutant plants, this transgene did not fully complement the mutant phenotype (Fig. 5, G and H), although reverse transcriptase-PCR analysis indicated that the intron was spliced properly from the 35SI::RHD3 transcript (data not shown). This result is consistent with the reporter gene expression studies with the 35SIc construct (Fig. 5C). Taken together, these data indicate that the first intron is necessary for appropriate RHD3 expression and function, and it does not act properly when placed in abnormal locations. Root Hair Development Genes and Plant Hormones Do Not Affect RHD3 Gene Expression To attempt to define factors that regulate the activity of the
RHD3 promoter and/or first intron, we examined the
possibility that RHD3 expression may be regulated by its own
protein or by other RHD gene products. Thus, the full-length
RHD3 promoter::GUS reporter gene
constructs (X1 and H2) were introduced into the rhd3 mutant
or into the rhd1, rhd2, rhd4, and
rhd6 mutants. GUS activity in each of these lines was found
to be indistinguishable from the wild-type
RHD3::GUS plants, based on histochemical analysis in roots (data not shown). This indicates that these RHD genes do not
regulate the activity of the RHD3 promoter or first intron. In addition, double-mutant combinations between rhd3 and
rhd1 (Schiefelbein and Somerville, 1990
To determine whether the plant hormones auxin and ethylene may affect RHD3 expression, three sets of experiments were conducted. First, transgenic seedlings bearing the full-length RHD3::GUS constructs (X1 and H2) were transferred from standard growth media to media supplemented with 30 and 300 nm indole-3-acetic acid (an auxin), 5 and 50 µm 1-aminocyclopropane-1-carboxylic acid (a precursor to ethylene biosynthesis), or 5 µm aminoethoxyvinyl-Gly (an ethylene biosynthesis inhibitor), and then tested for GUS activity by histochemical staining. Although these hormone and inhibitor treatments significantly altered root morphogenesis, they did not cause a detectable change in the RHD3::GUS expression (data not shown). In a second test of the effect of hormones on RHD3 gene
expression, RHD3::GUS activity was examined in
various hormone-related mutant backgrounds. These mutants included the
aux1 (Pickett et al., 1990 In a third test of the relationship between RHD3 and plant hormones, double mutants were constructed and analyzed that contained the rhd3 and either the eto1, ctr1, or axr2 mutations. Because each of these mutants exhibit a cell size defect in the root epidermis (Table II), we were able to use this character to determine the genetic relationships between the rhd3 and these mutations. As shown in Table II and Figure 9, J through L, the rhd3 ctr1, rhd3 eto1, and rhd3 axr2 double mutants each display a phenotype indicative of an additive interaction of the single mutations, consistent with the possibility that the genes act in separate pathways.
We have conducted a detailed study of the expression and regulation of the Arabidopsis RHD3 gene, which encodes a putative GTP-binding protein required for normal cell enlargement throughout plant development. One of the major findings is the critical role of the first intron of RHD3 for appropriate gene expression and function. This intron is notable because of its relatively large size (558 bp) and its location adjacent to the translation start codon (in codon no. 2). These features initially suggested a possible regulatory function for the first intron sequences. Comparison of reporter gene expression patterns between constructs containing this region (H2) and lacking this region (H1) shows a qualitative and quantitative difference in the expression pattern. In the absence of the intron, gene expression is reduced by two orders of magnitude (as determined both by RNA-blot hybridization and reporter enzyme activity) and is restricted to vascular tissue. The functional importance of this intron is demonstrated by complementation analyses in which a construct containing the first intron (12A) is able to fully complement the rhd3 mutant, whereas a construct lacking the first intron (12A-I) cannot (Fig. 7). Thus, the first intron is required for the high-level expression and appropriate function of RHD3. This research has also yielded clues regarding the mechanism responsible for the effect of the RHD3 first intron. First, gene fusion experiments show that the intron cannot significantly increase reporter gene expression when placed upstream of the RHD3 native promoter or upstream of the heterologous 35S promoter, whether in the correct or the reverse orientation. This shows that the RHD3 first intron does not exhibit classic transcriptional enhancer-like properties. Second, the RHD3 first intron is unable to direct a high level of reporter gene expression or 35S::RHD3 cDNA expression when placed in the 5'-transcribed (non-coding) region, which implies that its normal location within the translated region is critical for its effect on RHD3 gene expression. Third, the 35S promoter is unable to drive appropriate expression of the RHD3 cDNA to enable complete complementation of the rhd3 mutant, despite the fact that the 35S::RHD3 rhd3 plants accumulate a greater amount of RHD3 RNA than do wild-type plants (Fig. 8). This result implies that the RHD3 first intron does not simply act by increasing the RHD3 transcript level; rather, it likely plays a regulatory role in RHD3 mRNA metabolism. Taken together, our results suggest that the RHD3 first intron acts posttranscriptionally to regulate the production of mature RHD3 mRNA. An interesting possibility raised by our results is that the position
or context of the RHD3 intron is critical for its ability to
direct appropriate gene expression. Although several plant introns have
been shown previously to influence gene expression (Callis et al.,
1987 In addition to the first intron, another important RHD3
regulatory sequence was identified using the reporter gene fusions. This region is located in the upstream sequences between A second goal of the present study was to define the relationship between the RHD3 gene product and other possible regulators of cell expansion. Using the RHD3::GUS reporter gene and double-mutant tests, we have demonstrated that other root hair development genes (RHD1, RHD2, RHD4, and RHD6), the plant hormones auxin and ethylene, and hormone-related genes (AUX1, AXR2, ETO1, EIN2, and CTR1) do not significantly affect RHD3 gene expression. These data suggest that RHD3 functions in an independent pathway from these loci and hormones in the control of plant cell morphogenesis. This RHD3 expression study supports the view that the RHD3
protein is involved in a fundamental cellular process that is required for regulated cell enlargement to occur during plant development. Whole-mount in situ hybridization and RHD3
promoter::GUS reporter gene fusion studies show that the
RHD3 gene is highly expressed in most plant tissues,
including the embryo, flower, shoot, and root tissues. These results
are consistent with our previous data from a northern-blot analysis,
which showed that RHD3 transcripts accumulate in all plant
organs (Wang et al., 1997
Plant Materials and Growth Conditions The rhd3 mutant alleles were described previously
(Schiefelbein and Somerville, 1990 Unless otherwise described, Arabidopsis seeds were surface sterilized
and grown on agarose-solidified medium in vertically oriented petri
plates as described previously (Schiefelbein and Somerville, 1990 Microscopy and Expression Assays Root growth rate and epidermal cell length were determined as
previously described (Wang et al., 1997 Constructs and Plant Transformations The 12A construct was described by Wang et al. (1997) For the X1 construct, a XbaI-ClaI fragment containing the 1.6-kb 5'-non-coding sequences, the first exon, the first intron, and three nucleotides of the second exon was subcloned (by filling in the ClaI 3'-protruding end) into the XbaI and SmaI sites of the pBI101.2 vector to generate a translational fusion. The H2 construct was generated the same way as X1 except a HindIII-ClaI promoter fragment was subcloned, which lacks 100 bp from the non-coding 5' end of the XbaI-ClaI fragment. The H1 construct was generated by subcloning the HindIII-XhoI fragment containing the 1.5-kb 5'-non-coding sequences plus about 80 bp of 5'-untranslated sequences of the first exon from the plasmid pR5.2 into the HindIII and SalI sites of the pBI101.2 vector to generate transcriptional fusions. For the B2 and B4 constructs, a 690-bp BamHI-BglII fragment containing about 600 bp of 5'-non-coding sequences and 90 bp of 5'-untranslated sequences of the first exon from the plasmid pR5.2 was subcloned into the BamHI site of the pBI101.2 vector to generate transcriptional fusions, with the B2 construct having the promoter sequences in the correct orientation and B4 in the reverse orientation. For construction of the H2-I clone, the T3 primer and another primer (5' GTGGATCCCCCATTATCGCTCAACGAAACGC 3') were used to amplify the RHD3 upstream sequences and the entire first exon using the genomic clone pR5.2 as the template. The PCR products were subcloned into the HindIII-BamHI sites of the pBI101.2 vector as a HindIII-BamHI fragment to generate a translational fusion. Two other primers (5' TGGAAGCTTGTAATTTATATATCCATCTCTTC 3' and 5' CCTTCGAACTGCAACGTCC-AAGCAATAAAG 3') were used to generate a PCR fragment containing the intron sequence using the genomic clone plasmid pR5.2 as the template and the PCR product was subcloned into the TA cloning vector PCR 2.1 (Invitrogen, Carlsbad, CA) to generate a clone called pR5.2E4. Next, the HindIII fragment containing the first intron sequences was subcloned into the HindIII sites of H1, B2, 35SM (35S 46-bp minimal promoter driving the GUS gene), and pBI121 clones to generate constructs H1Ia, H1Ib, B2I, 35SMI, 35SIa, and 35SIb. In addition, an XbaI-SacI (blunted end) fragment containing the intron sequence from the pR5.2E4 clone was subcloned into the XbaI-SmaI sites of the H1 and pBI121 clones to generate the clones H1Ic and 35SIc. The 35S::RHD3 construct was made by replacing the BamHI-SacI (blunt ended) containing the GUS gene-coding region in the pBI121 vector by a BamHI-EcoRV fragment containing the full-length RHD3 cDNA from the cDNA clone C3I. For the 35SI::RHD3 construct, the XbaI-SacI (blunt ended) fragment containing the intron sequence from pR5.2E4 was subcloned into the XbaI-SmaI sites of the 35S::RHD3 clone. For plant transformation, the above constructs were electroporated into
the Agrobacterium tumefaciens strain GV3101 and
transformed into Arabidopsis plants using vacuum infiltration. The
T1 seeds for each construct were collected in separate
pools, and plated on selection media containing kanamycin (50 µg
mL
We thank Dr. Mark Kinkema (Duke University, Durham, NC) for providing the A. tumefaciens strain GV3101 and helpful suggestions on plant vacuum infiltration transformation. We thank Dr. Hong Ma (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY) for providing the 35SM plasmid (35S minimal promoter-GUS construct).
Received January 14, 2002; returned for revision February 25, 2002; accepted March 11, 2002. 1 This work was supported by the U.S. National Science Foundation (grant no. IBN-9316409) and by the U.S. Department of Agriculture (grant nos. 97-35304-4580 and 01-35304-10134).
2 Present address: Department of Molecular Cell and Developmental Biology, Yale University, New Haven, CT 06520-8104.
* Corresponding author; e-mail schiefel{at}umich.edu; fax 734-647-0884.
Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.002675.
This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|