|
Plant Physiol, June 2002, Vol. 129, pp. 733-746
Remodeling of DNA Methylation and Phenotypic and
Transcriptional Changes in Synthetic Arabidopsis
Allotetraploids1
Andreas
Madlung,2
Ricardo W.
Masuelli,2
Brian
Watson,
Steve H.
Reynolds,
Jerry
Davison, and
Luca
Comai*
Department of Botany, Box 355325 University of Washington, Seattle,
Washington 98195 (A.M., B.W., S.H.R., J.D., L.C.); and Laboratorio de
Biología Molecular, Facultad de Ciencias Agrarias,
Universidad Nacional Cuyo y Consejo Nacional de Investigaciones
Científicas y Técnicas, C.C.7 Chacras de Coria (5505),
Mendoza, Argentina (R.W.M.)
 |
ABSTRACT |
The joining of different genomes in allotetraploids played a
major role in plant evolution, but the molecular implications of this
event are poorly understood. In synthetic allotetraploids of
Arabidopsis and Cardaminopsis arenosa, we previously
demonstrated the occurrence of frequent gene silencing. To explore the
involvement of epigenetic phenomena, we investigated the occurrence and
effects of DNA methylation changes. Changes in DNA methylation patterns were more frequent in synthetic allotetraploids than in the parents. Treatment with 5-aza-2'-deoxycytidine, an inhibitor of DNA
methyltransferase, resulted in the development of altered morphologies
in the synthetic allotetraploids, but not in the parents. We profiled
mRNAs in control and 5-aza-2'-deoxycytidine-treated parents and
allotetraploids by amplified fragment length polymorphism-cDNA. We show
that DNA demethylation induced and repressed two different
transcriptomes. Our results are consistent with the hypothesis that
synthetic allotetraploids have compromised mechanisms of epigenetic
gene regulation.
 |
INTRODUCTION |
Allotetraploids are formed by
hybridization between two species and inherit a complete diploid set of
chromosomes from each parental species. Although many established wild
and cultivated allopolyploids are fertile, well adapted, and
genetically stable, allopolyploids of more recent origin commonly
display genomic and phenotypic instability (Soltis and Soltis, 1995 ;
Pikaard, 1999 ; Comai, 2000 ).
As a consequence of the union of two genomes, abnormal phenotypes have
been reported (Comai, 2000 ; Schranz and Osborn, 2000 ). The causes of
these phenotypes are largely unknown. McClintock (1984) described
similar phenomena as "genomic shock," which she defined as a
preprogrammed response to an unusual challenge resulting in extensive
restructuring of the genome. This "unusual challenge" may involve
epigenetic gene silencing, which results from homologous DNA-DNA or
DNA-RNA interactions. The hybridization of redundant and diverged
homeologous sets of genes in allopolyploids might trigger widespread
gene silencing and changes in chromatin structure and DNA methylation patterns.
Recent molecular data are consistent with the gene silencing
hypothesis. Previously, we have reported about 1% changes in gene
expression by comparing synthetic allotetraploids derived by
hybridizing 4x Arabidopsis and 4x Cardaminopsis arenosa
(also known as Arabidopsis arenosa; Comai et al.,
2000 ). These changes can involve both normal genes and genes related to
transposons. The corresponding natural allotetraploid,
Arabidopsis suecica, was examined by Lee and Chen
(2001) , who demonstrated similar silencing levels. Furthermore, they
found that silencing was related to methylation and could be reversed
by treatment with the DNA demethylating agent 5-aza-2'-deoxycytidine
(azadC). Instability can also be manifested by genomic rearrangements.
Synthetic hybrids of wheat (Triticum aestivum) displayed
rapid and widespread loss of DNA sequences and changes in DNA
methylation (Ozkan et al., 2001 ; Shaked et al., 2001 ). These results
corroborate McClintock's hypothesis of genomic shock as a major factor
during allotetraploidization. The understanding of this phenomenon,
however, is still rudimentary.
Here, we explore the relationship between phenotypic instability and
epigenetic determinants. We show that in Arabidopsis, allotetraploidization leads to nonrandom changes in methylation patterns throughout the genome. Further, we demonstrate that
demethylating the genome with the methylation inhibitor azadC greatly
exaggerates phenotypic abnormalities in the allotetraploids, but not in
the parents. Concomitantly, decreased methylation correlates with more
gene expression changes in the allotetraploids than in the parents.
Taken together, these results suggest that the formation of
allotetraploid genomes destabilizes chromatin regulation.
 |
RESULTS |
We reported previously that the crossing of tetraploid Arabidopsis
with the natural tetraploid C. arenosa produced
allotetraploids whose hybrid phenotype was described in detail (Comai
et al., 2000 ; Fig. 1). We established
inbreeding allotetraploids lines derived from four
F1s, each the product of pollinating a tetraploid of Arabidopsis ecotype Ler with the same C. arenosa individual. To determine whether gross changes in cytosine
methylation were associated with allotetraploidization, we compared
percent methylation of TaqI sites (TCGA) in diploid
Arabidopsis Ler (one individual, 18.3% ± 2.4%), in
tetraploid Arabidopsis Ler (two individuals, 20.6% ± 1.5%
and 23.8% ± 1.8%, respectively), in C. arenosa (two individuals, 28.8% ± 1.5% and 30.9% ± 1.5%, respectively) and in
F3 synthetic allotetraploids (three individuals,
21.4% ± 1.3%, 22.8% ± 1.4%, and 25.9% ± 1.7%, respectively).
The results suggest that no major changes in the level of CG
methylation occurred upon allotetraploidization. However, the method
used could not reveal whether methyl groups were relocated to other
sequences within the genome upon allotetraploidization. To test this
possibility, we employed methylation-sensitive amplification
polymorphism (MSAP) analysis, which assesses cytosine methylation at
specific restriction sites throughout the genome.

View larger version (104K):
[in this window]
[in a new window]
|
Figure 1.
Phenotype of parents and allotetraploid progeny:
tetraploid C. arenosa:whole plant (a) and inflorescence (c);
tetraploid Arabidopsis ecotype Landsberg erecta
(Ler) LC612:whole plant (b) and inflorescence (d);
allotetraploid offspring from Arabidopsis cross with C. arenosa:whole plant (g), allotetraploid inflorescences from
different sibling lines resembling more closely either the C. arenosa (e) or the Arabidopsis (f) parent.
|
|
Allotetraploidization Leads to Genome-Wide Changes in the
Cytosine Methylation State
For MSAP analysis, we used the isoschizomeric
methylation-sensitive enzymes HpaII and MspI,
which cut at CCGG sites. An example of this analysis is presented
in Figure 2. Table I summarizes the
different types of cytosine methylation
patterns at the CCGG sites found in the parental lines. Interestingly,
one-sixth of the methylated sites detected by comparative
HpaII/MspI digestion suggested hemimethylation
(mCCGG/GGCC; Roberts and Macelis, 2001 ), whose occurrence has been
indicated previously in carrot (Daucus carota; Zhou
et al., 1998 ). We compared 623 MSAP products of four F3 plants with those displayed in the parental
lanes (Fig. 2). Differences between F3 plants and
parents were frequent. However, only some of these differences were
scored as methylation changes as exemplified in Figure 2. Because
C. arenosa is an outbreeding species with a relatively high
level of polymorphisms, we disregarded changes involving C. arenosa products if they could also be interpreted as
polymorphisms that were inherited as heterozygous loci and were
segregating in the F3 generation. In addition, we
disregarded subtle changes in band intensity (see Fig. 2).

View larger version (134K):
[in this window]
[in a new window]
|
Figure 2.
Examples of MSAP analysis. Selected portions of
autoradiographs from MSAP polyacrylamide gels. At, Arabidopsis; Ca,
C. arenosa; Ap, allopolyploids; H,
EcoRI-HpaII products; M,
EcoRI-MspI products. Large arrows indicate
differential MSAP products due to hypermethylation (H) or demethylation
(D). Small arrows indicate products that, although differential, were
not scored because they appeared weak or could be explained as C. arenosa polymorphisms. Bands appearing in the allopolyploids
that are absent in both parents result from a loss of methylation at
the restriction enzyme cut site (D). In cases where bands are present
in the parents but absent in the allopolyploids, methylation occurred
at the cut site, preventing the display (H).
|
|
Of the 623 products scored, 52 (8.3%) showed polymorphic methylation
patterns between the parents and the F3 progeny.
Of these, 40 were invariable across the four F3
individuals analyzed, whereas 12 varied in pattern between the
allotetraploids. Depending on their status in the progeny, the
first 40 were classified into either a demethylation or
hypermethylation group (Table II).
Twenty-five of 40 (62.5%) that underwent demethylation were subgrouped
in nine different classes, D1 through D9 (Table II). Fifteen of 40 (37.5%) displayed an increase in methylation levels and were
subgrouped into six classes, H1 through H6 (Table II). The analysis
indicates that the methylation pattern of the allotetraploid genome is
subject to considerable changes and that many of these changes are not random because the same changes occurred in multiple allotetraploid individuals grown under different conditions (see "Materials and Methods").
Fragments that differed in methylation status between parents and
F3s were eluted from the gel, re-amplified, and
sequenced. Some fragments yielded poor sequence quality presumably due
to the co-amplification of background fragments. In 23 cases,
satisfactory sequence was obtained and compared with the GenBank
database using the BLASTN and BLASTX programs (Altschul et al., 1990 ).
Of the 23 tested, nine had no similarity to GenBank entries, whereas 14 had high similarity to characterized regions of the Arabidopsis genome
(Table III). Eight of these were within
genes, whereas the rest were in intergenic regions. One of them
displayed structural similarity to miniature inverted-repeat
transposable elements.
Demethylation Increases Phenotypic Instability
The joint occurrence of phenotypic abnormalities, gene silencing
(Comai et al., 2000 ) and cytosine methylation of previously un-methylated sites (Fig. 2; Tables I-III), suggested that
demethylation might restore the allotetraploids to a stable phenotype
similar to that of A. suecica, if hypermethylation was the
main reason for the observed abnormalities.
We treated F2 and F3
plants from each of the four original allotetraploid lines as well as
their parents, diploid Arabidopsis, and the natural allotetraploid
A. suecica with the demethylating agent azadC.
Parents and untreated, as well as azadC-treated plants, were grown to
maturity and compared phenotypically. Diploid and tetraploid
Arabidopsis and A. suecica treated with azadC grew normally
(data not shown) and C. arenosa displayed relatively less
frequent and less severe abnormalities, whereas the allotetraploids consistently produced abnormal phenotypes (Table
IV). Some of the displayed abnormalities
were also seen in untreated allotetraploids but at much reduced
severity. The experiment was repeated five times with similar results.
The most common abnormality was a semidwarf phenotype that displayed
many secondary inflorescences with shorter and zigzag internodes.
Other frequent abnormalities included fasciation of the shoots and
homeotic transformations of the flowers (Fig.
3), including dipetalous and
tetrapetalous phylloid flowers, apetala-like flowers, open
carpels, or cauliflower-like inflorescences. Abnormal
and normal body sectors sometimes appeared on the same plants
(Fig. 3). Other examples of phenotypic abnormalities included dwarfism,
aberrant branching patterns, and tumor formation (Fig. 3; data not
shown). Often, these phenotypes affected only lateral inflorescences
and showed occasional reversion during branching or further apical
growth. In certain cases, abnormalities changed in intensity along the
axis of growth. In contrast, untreated synthetic allotetraploids
displayed the usual variability but failed to show most of the aberrant
phenotypes displayed by the azadC-treated cohort. Although most of the
azadC-treated synthetic allotetraploids were sterile, a few produced
seed upon selfing. Plants originating from these seeds generally
differed from the parent, displaying either the normal hybrid phenotype
or an altered phenotype unrelated to the parents (data not
shown).

View larger version (90K):
[in this window]
[in a new window]
|
Figure 3.
Induction of abnormal phenotypes by azadC
treatment of F2 allotetraploids. Vastly differing
degrees of fasciation of the inflorescence of untreated (a) and
azadC-treated (b, inflorescence; p, inflorescence stem) plants.
Abnormal branching patterns in azadC-treated plants (c and g).
Branching was either altered in the entire plant (g) or only in one or
more branches (b, k, and m). Flowers displayed homeotic abnormalities
(d-f and m-o). The phylloid petal phenotype of the plant shown (m,
top view; n, side view; o), accompanied by fasciation (p), affected
only two branches, whereas the rest of this plant displayed a normal
morphology (l). See Figure 4C for analysis of centromeric repeat
methylation in the affected versus unaffected tissue.
|
|
Treatment with azadC Causes Centromeric Demethylation
To verify that the azadC affected genome methylation equally in
all genotypes, we examined cytosine methylation at the CCGG sites in
the centromeric repeat region of 180-bp units in parents and
allotetraploids in the presence or absence of azadC. If the CCGG sites
are hypomethylated, they become susceptible to HpaII digestion and the repeats produce a ladder of variable multimers differing by 180 bp. Figure 4A shows that
treatment with azadC decreased methylation in all genotypes, although
somewhat less markedly in C. arenosa. The use of
species-specific probes on replicate gel blots confirmed that the
degree of methylation of the centromeric repeats depended on the genome
of origin. When we tested the methylation state of three individual
allotetraploids treated with azadC, we noticed that one of the
three individuals displayed differential methylation patterns on its
two genomes (Fig. 4B). This individual showed normal demethylation in
response to azadC on its C. arenosa genome, but
the methyl-sensitive enzymes failed to digest the Arabidopsis-specific
180-bp repeat, suggesting heavier methylation in this region of the
Arabidopsis-derived genome. We compared the repeat methylation status
in a dimorphic plant (Fig. 4C). A branch displaying severely altered
flowers and fasciation (Fig. 3, M-P) had strongly hypomethylated DNA
(Fig. 4C, "Alt" lane), whereas a morphologically normal branch of
the same plant (Fig. 3L) had a distinct pattern of higher methylation (Fig. 4C, "Nor" lane).

View larger version (52K):
[in this window]
[in a new window]
|
Figure 4.
Effect of azadC and differential methylation of
Arabidopsis and C. arenosa centromeric repeats in the hybrid
genomes. Shown are replicate gels of HpaII-digested DNA,
probed with either the Arabidopsis or the C. arenosa 180-bp
centromeric repeat (A). Gel lanes loaded with DNA from control and from
azadC-treated plants are marked and +, respectively. The size
in bp of the markers (first lane) is indicated on the left. B, Analysis
of replicate blots of four allotetraploid plants either probed with the
Arabidopsis or the C. arenosa 180-bp centromeric repeat (one
control and three azadC-treated). C, Analysis of altered (Alt, see Fig.
3, M-P) and normal (Nor, see Fig. 3L) branches from the same
azadC-treated plant. A.t., Tetraploid Arabidopsis 612; Allo,
synthetic allotetraploids; C.a., C. arenosa;
A.s., A. suecica.
|
|
Genome Demethylation Causes Increased Rates of Transcriptional
Changes in Allotetraploids
Demethylation of allotetraploids with azadC did not normalize the
phenotype but instead increased the frequency of phenotypic abnormalities when compared with untreated plants (Fig. 3). Therefore, we asked if demethylation caused by azadC would lead to an increased incidence of transcriptional changes in allotetraploids when compared with their parents. To investigate this possibility, we employed cDNA-AFLP display (Fig. 5; Bachem et al., 1996 ). Differences in the cDNA-AFLP patterns between the genotypes were frequent. We categorized these differences into distinct groups shown in Table V. We observed more transcriptional
variation between the untreated and azadC-treated allotetraploids as
compared with transcriptional variation between untreated or
azadC-treated Arabidopsis parents, suggesting a higher rate of gene
activation in azadC-treated allotetraploids than in azadC-treated
Arabidopsis. To verify that the increased rate of transcriptional
changes was due to the treatment with azadC and not simply a result of
the allotetraploidization process, we compared the AFLP patterns of
untreated Arabidopsis with those of untreated allotetraploids. Here,
the variation was significantly less pronounced than in the
azadC-treated allotetraploids (Table V). Changes in the AFLP patterns
often differed among the four tested allotetraploid individuals, either
azadC treated or untreated. Changes in the AFLP pattern that could be
explained by differentially inherited polymorphic markers from C. arenosa were not scored; therefore, a comparison between C. arenosa and the allotetraploids was not performed. Similarly, we
did not include the natural allopolyploid A. suecica in the
cDNA-AFLP analysis because the maternal ecotype is not available for
comparison. We did include in our changes, however, AFLP products that
appeared in the allotetraploids but not in either parent. The
comparison did not use the C. arenosa individual that was
the ancestor of the allotetraploids. Thus, it is possible that the
allotetraploid-specific bands may have resulted from polymorphisms that
were not present in the reference C. arenosa but were
inherited from the original C. arenosa ancestor. We suspect
that many of these AFLP products represent activated genes and are not
polymorphisms because induction of new bands was also observed in
azadC-treated Arabidopsis, which has no polymorphisms. Further, we used
untreated sibling allotetraploids to compare expression patterns of the
putatively azadC-activated genes with the untreated controls, which
allowed us to further decrease the number of false positives.

View larger version (86K):
[in this window]
[in a new window]
|
Figure 5.
Example of cDNA-amplified fragment length
polymorphism (AFLP) analysis. Selections of autoradiographs from
cDNA-AFLP polyacrylamide gels. A.t., Arabidopsis;
C.a., C. arenosa; + or indicate the
presence or absence of azadC during seed germination. Bold arrows
indicate products that were activated in azadC-treated allotetraploids.
Thin arrows indicate Arabidopsis products that were differentially
silenced azadC-treated allotetraploids. All samples were run in
duplicate representing separate RNA preparations from comparable
tissues.
|
|
For ultimate confirmation of transcriptional changes, several
differentially displayed AFLP bands were excised and eluted from the
gel, re-amplified, sequenced, and the sequence compared with the
GenBank database. Most of the sequences originated from genes, but a
few were also from intergenic regions (data not shown). In a few cases,
we verified differential expression of the sequences by RT-PCR using
cDNA from the original plants as template. Figure 6 shows
examples of differentially regulated genes. Where possible, we designed
species-specific primers to amplify exclusively the transcript from
either the Arabidopsis genome or the C. arenosa genome
(139-1 and 139-2). Gene 139 was well expressed in the untreated parents. Expression of both the C. arenosa homeolog and the
Arabidopsis homeolog appeared strongly reduced in the untreated
allotetraploids. AzadC treatment diminished gene expression in
Arabidopsis but not in the C. arenosa parent. In the
allotetraploids, azadC restored expression of the C. arenosa
homeolog with high efficiency and of the Arabidopsis homeolog with
partial efficiency. In cases where species-specific primers could not
be made (genes 19 and 109, Fig. 6), RT-PCR merely revealed differential
expression between treated and untreated allotetraploids. For gene 19, only two untreated allotetraploids were tested and found to show no
transcription, whereas azadC-treated allotetraploids displayed vigorous
transcription. Gene 109 showed a similar pattern: All tested
azadC-treated allotetraploids displayed transcription, whereas
transcription was turned off in two of the four tested untreated
allotetraploids. The sequences of genes 19, 109, and 139 were compared
with sequences in the GenBank database. The GenBank annotation states
similarity of gene 19's product to a dehydrogenase from Arabidopsis,
containing an Myb-like DNA binding domain (GenBank accession no.
AAF81310.1). Gene 109's product displays similarity to a regulator of
chromosome condensation (GenBank accession no. BAB10107.1), and gene 139's product resembles a putative DNA binding protein (GenBank accession no. AAK64037.1).

View larger version (104K):
[in this window]
[in a new window]
|
Figure 6.
Reverse transcriptase (RT)-PCR
verification of differential cDNA-AFLP products. Three bands that
displayed differential transcription patterns in the AFLP-cDNA analysis
were chosen and subjected to RT-PCR verification. Primers were made
either specifically to the parental species (no. 139) or, if that was
not possible, to the consensus sequence (nos. 19 and 109).
A.t, Arabidopsis; C.a, C. arenosa.
Actin was used as a control gene and either amplified in the same PCR
reaction (multiplex, no. 19, and no. 139) or, if competition between
bands did not allow multiplexing, amplified in separate reaction tubes
(no. 109). A, 139-1 (Arabidopsis specific) and 139-2 (C. arenosa specific) are not transcribed in the azadC-treated
allotetraploids. B, 19 is not transcribed in two untreated
allotetraploids but highly active in the azadC-treated allotetraploids.
C, 109 is transcribed in all azadC-treated, but only two of four
untreated, allotetraploids. The c-DNA used for the RT-PCR analysis of
all three genes was prepared from the original RNA used for c-DNA-AFLP
analysis in Figure 5.
|
|
 |
DISCUSSION |
The allotetraploid offspring from crosses of Arabidopsis and
C. arenosa display phenotypic instability, high embryo
lethality, and frequent gene silencing (Comai et al., 2000 ). The
mechanisms underlying this phenomenon, however, are poorly understood.
To test the hypothesis that allotetraploidization results in partial loss of epigenetic gene regulation affecting genome methylation and
gene expression, we investigated methylation patterns in newly formed
allotetraploids and explored the effect of the demethylating agent
azadC on phenotypic and transcriptional changes in these plants.
We set out by investigating overall CG DNA methylation at
TaqI restriction sites in F3
allotetraploids and found no gross changes between parents and the
allotetraploids. To sample defined sequence sites for methylation
changes we employed MSAP analysis, which revealed frequent changes in
F4 allotetraploids, involving both increases and
decreases in methylation but no overall hyper- or hypomethylation (Fig.
2; Tables I and II). Interestingly, many of the changes in methylation
state were observed in different individual siblings, indicating that
at least some methylation changes were either inherited or were locus
specific. Close to one-half of the sequenced differential MSAP DNA
fragments did not have a match in the sequence databases: They could
represent heterochromatic regions that either have not been sequenced
or that are unique to C. arenosa.
To investigate if large-scale methylation changes occur in
heterochromatic regions of the genome, we compared cytosine methylation of the 180-bp centromeric repeats, which represent 1% to 2% of the
genome (Martinez-Zapater et al., 1986 ; Round et al., 1997 ) and are
almost completely methylated in wild-type Arabidopsis (Vongs et al.,
1993 ). We confirmed this finding and also showed, using
species-specific probes, that the repeats in C. arenosa, A. suecica, and the allotetraploids are highly methylated
(Fig. 4A), suggesting that the observed phenotypic variability is not a
result of gross differences in heterochromatic methylation. Treatment
with azadC led to demethylation in all tested genotypes (Fig. 4A). In
one of the C. arenosa individuals, however, demethylation was not as pronounced as in the other individuals tested (Fig. 4A).
When we tested several allotetraploid individuals for their centromeric
repeat methylation state, we noticed that one of the three individuals
in Figure 4B showed demethylation of only one of its genomes (compare
lane 3 with 7). This might indicate preferential methylation of one of
the two genomes and is reminiscent of nucleolar dominance in which one
set of rRNA genes in A. suecica is preferentially silenced (Chen et al., 1998 ). We also found an instance of differential methylation in two branches of the same allotetraploid plant differing in morphology (Fig. 4C).
The frequent gene silencing and phenotypic abnormalities observed
previously in synthetic F2 allotetraploids could
be explained by the simple assumption that many loci in these
plants became methylated and thus silenced. We hypothesized, therefore,
that a demethylating treatment might relieve many of the observed
abnormalities. Contrary to this expectation, treatment with azadC
caused exaggerated phenotypic instability specific to the synthetic
allotetraploids, which showed frequent morphological abnormalities
(Fig. 3), whereas azadC-treated parents remained unaffected in the case
of Arabidopsis or lightly affected in the case of C. arenosa. Remarkably, the natural allotetraploid A. suecica was also unaffected by azadC. Although untreated
allotetraploids also display instability in the first few generations
after the allotetraploidization event, the phenotypic changes in
untreated allotetraploids were in some cases similar but much less
intense than those observed in the azadC-treated allotetraploids. For
example, light fasciation as shown in Figure 3A is common in newly
constructed allotetraploids and mostly affects inflorescence stems.
Allotetraploids treated with azadC, however, often displayed entire
sectors with vastly exaggerated fasciation (Fig. 3B). In some cases,
flowers were affected and displayed various levels of homeotic
abnormalities (Fig. 3, C-K). Therefore, it appears as if demethylation
of the genome does not restore the normal phenotype in allotetraploids but further exaggerates the abnormalities.
To further test our original hypothesis that demethylation would
reactivate genes that had become methylated and thus silenced in
response to allotetraploidization, we used cDNA-AFLPs to quantify the
level of transcriptional changes in the azadC-treated plants as
compared with the untreated cohort. If the original hypothesis was
correct, allotetraploids would display azadC-induced changes comparable
with those displayed by the azadC-treated parents and fewer than the
changes displayed by the untreated allotetraploids. However, analogous
to our phenotypic observations, the results from the cDNA-AFLP analysis
(Fig. 5; Table V) showed that
allotetraploids treated with azadC displayed more than three times the
number of transcriptional changes observed in parental Arabidopsis
treated with azadC. This result suggests that demethylation with azadC leads to greater transcriptional instability in newly formed
allotetraploids than in their parents. Therefore, demethylating
treatment of allotetraploids increases both phenotypic and
transcriptional abnormalities as if an already disturbed chromatin
structure might be more susceptible than the corresponding structure of
the parents.
To verify the transcriptional changes in azadC-treated allotetraploids,
we performed RT-PCR analysis on a number of differentially regulated
genes (Fig. 6). In the documented cases,
genes were chosen that were active in parent plants and had become
partially or fully silenced in individual untreated allotetraploids. In some cases, these genes were reactivated by azadC treatment (19 and
109). In other cases (139-1), reactivation varied from weak to complete
but differed in pattern between the two different sets of homeologs.
Why did the azadC-treated allotetraploids show such increased
phenotypic variability? Are the silenced or (re-) activated genes
directly responsible for the observed phenotypic changes? It is not
possible to assign a cause-and-effect relationship between the putative
functions of the differentially expressed genes and the observed
phenotypes in our experiments. We note, nevertheless, that the genes
shown in Figure 6 contained DNA-binding domains, as did silenced genes
described in previous studies (Comai et al., 2000 ; Lee and Chen, 2001 ).
This category of genes may be more susceptible to allotetraploidization
and to perturbed chromatin regulation. For example, the silenced gene
encoding the putative transcription factor RAP2.1 (an
APETALA2-class gene) contains repeated elements in its 5'
promoter region and is naturally methylated in Arabidopsis, yet
actively transcribed (Comai et al., 2000 ). Interestingly, in the
methylation-deficient cmt3 background, RAP2.1 was
shown to be hypomethylated (Tompa, et al., 2002 ), suggesting epigenetic
regulation of this gene. Further, it has been suggested that genes
encoding transcription factors are more likely than other genes to gain
novel regulatory patterns through insertion of transposable elements in
their promoter regions (White et al., 1994 ). If this is the case, genes
encoding transcription factors may also be more susceptible to
epigenetic regulation (Martienssen, 1998 ) and could become selectively
unstable under compromised heterochromatin suppression. Destabilization
of this class of genes may be responsible for the phenotypic effects we
observed in the allotetraploids.
An important and still largely unanswered question is the nature of the
signals that induce epigenetic regulation. Given that both parents and
the derived allopolyploids are tetraploids, the observed effects most
likely result from hybridization rather than from a change in ploidy.
Therefore, incompatibilities between loci located on different genomes
may play a major role in the establishment of allotetraploids.
Previously described epigenetic phenomena suggest further
possibilities. In some cases, such as the PAI gene system or
in posttranscriptional silencing of transgenes (Luff et al., 1999 ), one
gene organized as an inverted tandem duplication can trigger its own
transcriptional silencing and methylation as well as that of unlinked
homologous loci, perhaps through formation of dsRNAs (Muskens et al.,
2000 ; Wassenegger, 2000 ). In other cases, such as the formation of
SUPERMAN epialleles, global genome demethylation triggers
hypermethylation of certain loci (Jacobsen and Meyerowitz, 1997 ). It is
not known whether a sequence-specific property of SUPERMAN
or the location of this gene within the genome context causes the
observed methylation changes in the clark kent alleles
(Jacobsen and Meyerowitz, 1997 ). Similar mechanisms to those discussed
above could contribute to epigenetic remodeling of allopolyploids.
 |
CONCLUSION |
We have shown that phenotypic instability in newly formed
allotetraploids is accompanied by nonrandom changes in the methylation state of the combined genomes and by remodeled transcription involving both gene silencing and gene activation. Hypersensitivity of the allotetraploids to azadC is consistent with compromised chromatin regulation, resulting in transcriptional changes at sensitive loci. We
suggest that this syndrome is triggered by incompatibilities between
the two genomes. The same mechanisms may play a role in phenomena that
occur when divergent genomic combinations are made such as in wide
hybridizations, crosses resulting in hybrid vigor or heterosis, or when
hybrids display unexpected behavior during the introgression of genes
from wild accessions into established cultivars. Thus, remodeling of
chromatin in wide crosses could have economic and evolutionary
implications by affecting changes in phenotype that may be either
disruptive or adaptive.
 |
MATERIALS AND METHODS |
Plant Lines, Growth, and Allotetraploidization
Allotetraploid plants were generated as described elsewhere
(Comai et al., 2000 ). In brief, Arabidopsis tetraploids (ecotype Ler, LC612; 4x = 2n = 20) were
used as the female recipient of pollen from Cardaminopsis
arenosa (Washington University no. 9509; 4x = 2n = 32). Four separate F1s were
produced (49-2A, 49-2B, 605A, and 605B) using pollen from one C.
arenosa individual. Inbreeding lines were subsequently advanced
by self-pollination and were called 1, 2, 3, and 4,
respectively. A. suecica Sue-1
(2n = 26) was obtained from Fumiaki Katagiri
(Massachusetts Institute of Technology, Cambridge). Plants were grown
in a soil-less peat mix (Sunshine no. 5) in a growth room at
22°C ± 3°C under 16 h of artificial daylight (TL80
fluorescent bulbs, Philips, Eindhoven, The Netherlands) and
8 h of darkness. Some plants (see below) were grown in a
greenhouse at 21°C ± 4°C., with supplemental light to provide
16-h days.
For azadC treatment, F2 or F3 allotetraploid
seed and seed from each parental line and from several Arabidopsis
ecotypes (Metz, Niederzenz, No-0, Columbia, and
Ler) was surface sterilized, cold-treated for 2 d,
and plated on one-half-strength Murashige and Skoog salts (Invitrogen,
Rockville, MD) supplemented with 40 µg mL 1 of azadC (10 µM). Controls were plated on medium lacking azadC. Seedlings were transplanted to potting soil when their roots reached 2 cm in length and were subsequently grown in growth rooms or greenhouse
as described above. Plants were scored at the juvenile and adult stage
on a subjective scale of abnormalities, from normal (5) to severely
abnormal (1). The observations were converted to numerical values
(normal versus affected) in the following way: azadC-treated
individuals were scored as affected if they ranked lower than any
individual in the control. In one experiment, five azadC-treated
C. arenosa individuals were scored "4" and one was
scored "3." All controls scored "5." Thus, six azadC-treated plants were scored as affected. It should be noted that none of these
plants displayed the severity of symptoms of treated synthetic allopolyploids, which were often scored as "1" through
"3." The data in Table IV were subjected to Fisher Exact Test for
independence (http://home.clara.net/sisa/fisher.htm) by pair-wise
comparison with the C. arenosa data in a 2 × 2 table format. The two-tailed probability was computed using the "sum
of small P values" method.
Taq Site Methylation Analysis
Taq site analysis was performed as described
(Cedar et al., 1979 ). In brief, genomic DNA (0.5-2.0 µg) was treated
with RNAse A and RNAseT1 and cleaved with TaqI. The
terminal cytosine was labeled with [ -32P] ATP. The labeled and
digested DNA was separated by thin-layer chromatography and exposed to
a PhosphorImager screen. Quantification was performed using ImageQuant
software (IQMac version 1.2, Molecular Dynamics, Sunnyvale, CA).
The 5-methylcytosine levels were calculated by the formula 5-methyl
deoxycitidine monophosphate/(5-methyl deoxycitidine monophosphate + deoxycitidine monophosphate).
DNA Analysis
DNA was prepared as described elsewhere (Comai et al., 2000 ). To
assess the methylation status of the 180-bp repeats, 0.25 µg of
HpaII-digested (with 10 units of enzyme
µg 1 of DNA) genomic DNA were separated on a 0.8%
(w/v) agarose gel, blotted on Biodyne-B nylon membrane, and
hybridized to species-specific centromeric probes. To verify the
completeness of HpaII digestion of the genomic DNA, we
examined the appearance of stereotypical banding in the
ethidium-bromide-stained gels of the digested DNA. To prepare the
Arabidopsis centromeric probe, we first amplified the insert of the pUC
derivative plasmid pARR20 (a gift of Eric Richards, Washington
University, St. Louis) with forward and reverse M13 primers. To prepare
the C. arenosa centromeric probe, we amplified the
180-bp repeat from C. arenosa genomic DNA using primers
CAcenL (AGCTTCTTATTGCTCTCAACGG) and CAcenR (TTAGAAGCTCCAAAACCGAAAA). For the PCR, we used the time-release enzyme AmpliTaq Gold
(Perkin-Elmer Applied Biosystems, Foster City, CA) with the
following cycle conditions: 9 min at 94°C, followed by 35 cycles (20 s at 94°C, 30 s at 57°C, and 40 s at 72°C).
Radiolabeled probes were prepared by single-stranded PCR of the above
PCR products using the M13 reverse primer and the CAcenL primer,
respectively. Hybridized blots were washed in 0.2× SSC at 60°C and
visualized using a PhosphorImager.
MSAP Analysis
For MSAP analysis, DNA was isolated from four 1
F3 sibling plants derived from the same F2
plant (631), which in turn was the offspring of the original
F1 allotetraploid (49-2A; Comai et al., 2000 ). Two of the
siblings were grown in a growth room, and two in a greenhouse (see
above). For the analysis, we followed a modified AFLP protocol
developed to assay DNA methylation. This adaptation incorporates the
use of methylation-sensitive frequent-cutter restriction enzymes, such
as the isoschizomers HpaII and MspI, with
a rare cutter such as EcoRI. The adapters for
EcoRI were the same as those used in the AFLP protocol
(Bachem et al., 1996 ). The adapters for
HpaII-MspI digest fragments were designed
according to Xiong and colleagues (1999) .
All the primers designed for the EcoRI fragments had the
same core and enzyme-specific sequence (5'-GACTGCGTACCAATTC-3') and the following combinations of three selective nucleotides were added to
the basic sequence: ACA, AGA, ACC, AAA, and AAC. The EcoRI primers were used in combination with two
HpaII-MspI primers that bear four
selective nucleotides: 5'-CATGAGTCCTGCTCGGTCAA-3' and
5'-CATGAGTCCTGCTCGGTCCA-3. The genomic DNA (1 µg) was digested with
20 units of EcoRI (New England Biolabs, Beverly,
MA) in a final volume of 40 µL of the appropriate buffer for
3 h at 37°C. For the second digestion, 20 units of
HpaII (Life Technologies/Gibco-BRL, Cleveland) or
MspI (New England Biolabs) were used. The digested fragments were ligated to the adapters in a buffer containing 0.5 mM dithiothreitol, 1 mM ATP, and 20 units of T4 DNA ligase (New England Biolabs), and incubated at 37°C
for 2 h. The pre-amplification was performed by using 1 µL of
the ligation products and 0.2 µM of the
EcoRI and HpaII-MspI
primers, without the selective nucleotides, in a final volume of 50 µL containing 1× PCR buffer, 0.1 mM dNTP, and 1 unit of
Taq polymerase. The PCR reactions were performed with
the following program: 30 s at 72°C, 3 min at 94°C, and 30 cycles consisting of 1 min at 94°C, 1 min at 56°C, 2 min at 72°C, and a final extension step of 5 min at 72°C. The pre-amplification products were diluted 1:10 (v/v) and 1 µL was used in the
selective amplification reaction with the EcoRI
and HpaII-MspI primers, end labeled with
[ -32P]ATP, in a final volume of 20 µL. The
other components were the same as the pre-amplification reactions. The
PCR program was the same as in the original AFLP protocol.
The specificities of HpaII and MspI are
described in the REBASE database of restriction enzymes (Roberts and
Macelis, 2001 ). In summary, when methylation affects both DNA strands,
HpaII is blocked by methylation of either the internal
or external cytosine, whereas MspI is blocked only by
methylation of the external cytosine. Hemimethylation of the outside C
blocks MspI but not HpaII. To follow
changes in methylation, MSAP analysis for each genotype was performed
in duplicate, displaying the HpaII-EcoRI
and MspI-EcoRI products, respectively
(referred to as HpaII and MspI lanes). A
product appearing in both lanes with the same relative intensity indicates that the corresponding CCGG site is either un-methylated or
only partially methylated. Partial methylation, due to differences in
methylation state between copies of the same locus, results in changes
in product intensity between genotypes. A difference in product
intensity between the HpaII and the MspI
lanes of the same genotype indicates differential methylation between
the internal and external cytosine. A stronger MspI
product is caused by hypomethylation of the external relative to the
internal cytosine residue. A stronger HpaII fragment is
due to hemimethylation of the external cytosine.
Isolation and Direct Sequencing of the MSAP Fragments
The MSAP fragments were eluted by rehydrating the gel in boiling
water for 5 min and re-amplified with the appropriate primers. The
eluted DNA was diluted 1:1,000 (v/v) and 1 µL was used for PCR
amplification in a final volume of 50 µL, the reaction and cycling
conditions were the same as the selective amplification described
above. The PCR products were checked by agarose gel electrophoresis and
1 µL was used as a template for direct sequencing according to
standard Big Dye terminator protocols (ABI, Sunnyvale, CA). The
analysis of DNA similarity of the sequences obtained was performed by
using the Advanced BLASTN program at the National Center for
Biotechnology Information site.
cDNA-AFLP Analysis and RT-PCR
RNA was prepared from the inflorescence tips (buds, flowers,
petioles, and connected stem) of four azadC-treated plants and four
comparable controls. The four azadC-treated plants had the following
genotype and phenotype: plant 1, F2 1 line, semidwarf, thick stems, small non-serrated leaves, and small flowers; plant 2, F2 3 line, semidwarf, regular stems, small serrated
leaves, and small flowers often displaying fasciated carpels; plant 3, F2 3 line, normal size, and flowers and leaves but
heavily fasciated; and plant 4, F2 4 line, dainty dwarf,
thin stems, and small flowers with many in terminal position on
inflorescence. The four control plants had typical phenotypes with
larger bodies, serrated leaves, and larger, usually normal, flowers.
The cDNA-AFLP analysis was performed as described (Bachem et al., 1996 ;
Ditt et al., 2001 ), except that the amplification primers contained
three base extensions. Verification of AFLP patterns by RT-PCR was
essentially performed as described (Ditt et al., 2001 ). All samples
were run in duplicate and variations were scored only if they were
clearly apparent in both replicates. As in the MSAP analysis, we
disregarded differential bands involving C. arenosa
products if they could also be interpreted as polymorphisms that were
not inherited in the tested allotetraploids. In addition, we
disregarded subtle changes in band intensity (see Fig. 5 for examples).
Isolation and sequencing of cDNA-AFLP products was performed as
described for MSAP fragments above. The data in Table V were subjected
to Fisher Exact Test for independence (http://home.clara.net/sisa/fisher.htm) by pair-wise comparison in a
2 × 2 table format. The two-tailed probability was computed using
the "sum of small P values" method.
 |
ACKNOWLEDGMENTS |
We thank Yvonne Stevens for help with the azadC treatment and
Nicole Riddle for providing her methylcytosine thin-layer
chromatography analysis protocol. We thank our collaborators
researching the functional genomics of plant polyploids, and J. Chris Pires for stimulating discussions and comments.
 |
FOOTNOTES |
Received January 29, 2002; returned for revision March 12, 2002; accepted March 27, 2002.
1
This work was supported in part by the U.S.
Department of Agriculture-National Research Initiative Competitive
Grants Program (grant to L.C.) and by the National Science
Foundation Plant Genome Research Program (grant no. NSF 0077774).
2
These authors contributed equally to the paper.
*
Corresponding author; e-mail comai{at}u.washington.edu; fax
206-685-1728.
Article, publication date, and citation information can be found at
www.plantphysiol.org/cgi/doi/10.1104/pp.003095.
 |
LITERATURE CITED |
-
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ
(1990)
Basic local alignment search tool.
J Mol Biol
215: 403-410[CrossRef][Web of Science][Medline]
-
Bachem CWB, van der Hoefen RS, de Bruijn SM, Vreugdenhil D, Zabeau M, Visser RGF
(1996)
Visualization of differential gene expression using a novel method of RNA fingerprinting based on AFLP: analysis of gene expression during potato tuber development.
Plant J
9: 745-753[CrossRef][Web of Science][Medline]
-
Cedar H, Solage A, Glaser G, Razin A
(1979)
Direct detection of methylated cytosine in DNA by use of the restriction enzyme MspI.
Nucleic Acids Res
6: 2125-2132[Abstract/Free Full Text]
-
Chen ZJ, Comai L, Pikaard CS
(1998)
Gene dosage and stochastic effects determine the severity and direction of uniparental ribosomal RNA gene silencing (nucleolar dominance) in Arabidopsis allopolyploids.
Proc Natl Acad Sci USA
95: 14891-14896[Abstract/Free Full Text]
-
Comai L
(2000)
Genetic and epigenetic interactions in allopolyploid plants.
Plant Mol Biol
43: 387-399[CrossRef][Web of Science][Medline]
-
Comai L, Tyagi AP, Winter K, Holmes-Davis R, Reynolds SH, Stevens Y, Byers B
(2000)
Phenotypic instability and rapid gene silencing in newly formed Arabidopsis allotetraploids.
Plant Cell
12: 1551-1568[Abstract/Free Full Text]
-
Ditt RF, Nester EW, Comai L
(2001)
Plant gene expression response to Agrobacterium tumefaciens.
Proc Natl Acad Sci USA
98: 10954-10959[Abstract/Free Full Text]
-
Jacobsen SE, Meyerowitz EM
(1997)
Hypermethylated SUPERMAN epigenetic alleles in Arabidopsis.
Science
277: 1100-1103[Abstract/Free Full Text]
-
Lee HS, Chen ZJ
(2001)
Protein-coding genes are epigenetically regulated in Arabidopsis polyploids.
Proc Natl Acad Sci USA
98: 6753-6758[Abstract/Free Full Text]
-
Luff B, Pawlowski L, Bender J
(1999)
An inverted repeat triggers cytosine methylation of identical sequences in Arabidopsis.
Mol Cell
3: 505-511[CrossRef][Web of Science][Medline]
-
Martienssen R
(1998)
Transposons, DNA methylation and gene control.
Trends Genet
14: 263-264[CrossRef][Web of Science][Medline]
-
McClintock B
(1984)
The significance of responses of the genome to challenge.
Science
226: 792-801[Free Full Text]
-
Martinez-Zapater JM, Estelle MA, Somerville CR
(1986)
A highly repeated DNA sequence in Arabidopsis thaliana.
Mol Gen Genet
204: 417-423[CrossRef]
-
Muskens MW, Vissers AP, Mol JN, Kooter JM
(2000)
Role of inverted DNA repeats in transcriptional and posttranscriptional gene silencing.
Plant Mol Biol
43: 243-260[CrossRef][Web of Science][Medline]
-
Ozkan H, Levy A, Feldman M
(2001)
Allopolyploidy-induced rapid genome evolution in the wheat (Aegilops-Triticum) group.
Plant Cell
13: 1735-1747[Abstract/Free Full Text]
-
Pikaard CS
(1999)
Nucleolar dominance and silencing of transcription.
Trends Plant Sci
4: 478-483[CrossRef][Web of Science][Medline]
-
Roberts RJ, Macelis D
(2001)
REBASE-restriction enzymes and methylases.
Nucleic Acids Res
29: 268-269[Abstract/Free Full Text]
-
Round EK, Flowers SK, Richards EJ
(1997)
Arabidopsis thaliana centromere regions: genetic map positions and repetitive DNA structure.
Genome Res
7: 1045-1053[Abstract/Free Full Text]
-
Schranz ME, Osborn TC
(2000)
Novel flowering time variation in resynthesized polyploid Brassica napus.
J Hered
91: 242-246[Abstract/Free Full Text]
-
Shaked H, Kashkush K, Ozkan H, Feldman M, Levy AA
(2001)
Sequence elimination and cytosine methylation are rapid and reproducible responses of the genome to wide hybridization and allopolyploidy in wheat.
Plant Cell
13: 1749-1759[Abstract/Free Full Text]
-
Soltis DE, Soltis PS
(1995)
The dynamic nature of polyploid genomes.
Proc Natl Acad Sci USA
92: 8089-8091[Free Full Text]
-
Tompa R, McCallum CM, Delrow J, Henikoff JG, van Steensel B, Henikoff S
(2002)
Genome-wide profiling of DNA methylation reveals transposon targets of CHROMOMETHYLASE3.
Curr Biol
12: 65-68[CrossRef][Web of Science][Medline]
-
Vongs A, Kakutani T, Martienssen RA, Richards EJ
(1993)
Arabidopsis thaliana DNA methylation mutants.
Science
260: 1926-1928[Abstract/Free Full Text]
-
Wassenegger M
(2000)
RNA-directed DNA methylation.
Plant Mol Biol
43: 203-220[CrossRef][Web of Science][Medline]
-
White SE, Habera LF, Wessler SR
(1994)
Retrotransposons in the flanking regions of normal plant genes: a role for copia-like elements in the evolution of gene structure and expression.
Proc Natl Acad Sci USA
91: 11792-11796[Abstract/Free Full Text]
-
Xiong LZ, Xu CG, Saghai Maroof MA, Zhang Q
(1999)
Patterns of cytosine methylation in an elite rice hybrid and its parental lines, detected by a methylation-sensitive amplification polymorphism technique.
Mol Gen Genet
261: 439-446[CrossRef][Web of Science][Medline]
-
Zhou Y, Magill CW, Magill JM, Newton RJ
(1998)
An apparent case of nonsymmetrical and sustained strand-specific hemimethylation in the Dc8 gene of carrot.
Genome
41: 23-33[Medline]
© 2002 American Society of Plant Physiologists
This article has been cited by other articles:

|
 |

|
 |
 
B. Chaudhary, L. Flagel, R. M. Stupar, J. A. Udall, N. Verma, N. M. Springer, and J. F. Wendel
Reciprocal Silencing, Transcriptional Bias and Functional Divergence of Homeologs in Polyploid Cotton (Gossypium)
Genetics,
June 1, 2009;
182(2):
503 - 517.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Wei, Y. Tao, G. Liu, C. Chen, R. Luo, H. Xia, Q. Gan, H. Zeng, Z. Lu, Y. Han, et al.
Inaugural Article: A transcriptomic analysis of superhybrid rice LYP9 and its parents
PNAS,
May 12, 2009;
106(19):
7695 - 7701.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Tu, J. Sun, X. Ge, and Z. Li
Chromosome elimination, addition and introgression in intertribal partial hybrids between Brassica rapa and Isatis indigotica
Ann. Bot.,
May 1, 2009;
103(7):
1039 - 1048.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. M. Hazzouri, A. Mohajer, S. I. Dejak, S. P. Otto, and S. I. Wright
Contrasting Patterns of Transposable-Element Insertion Polymorphism and Nucleotide Diversity in Autotetraploid and Allotetraploid Arabidopsis Species
Genetics,
May 1, 2008;
179(1):
581 - 592.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Chen, M. Ha, E. Lackey, J. Wang, and Z. J. Chen
RNAi of met1 Reduces DNA Methylation and Induces Genome-Specific Changes in Gene Expression and Centromeric Small RNA Accumulation in Arabidopsis Allopolyploids
Genetics,
April 1, 2008;
178(4):
1845 - 1858.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Kashkush and V. Khasdan
Large-Scale Survey of Cytosine Methylation of Retrotransposons and the Impact of Readout Transcription From Long Terminal Repeats on Expression of Adjacent Rice Genes
Genetics,
December 1, 2007;
177(4):
1975 - 1985.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. M. Stupar, P. B. Bhaskar, B. S. Yandell, W. A. Rensink, A. L. Hart, S. Ouyang, R. E. Veilleux, J. S. Busse, R. J. Erhardt, C. R. Buell, et al.
Phenotypic and Transcriptomic Changes Associated With Potato Autopolyploidization
Genetics,
August 1, 2007;
176(4):
2055 - 2067.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. J. Evans
Ancestry Influences the Fate of Duplicated Genes Millions of Years After Polyploidization of Clawed Frogs (Xenopus)
Genetics,
June 1, 2007;
176(2):
1119 - 1130.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. L. Keyte, R. Percifield, B. Liu, and J. F. Wendel
Infraspecific DNA Methylation Polymorphism in Cotton (Gossypium hirsutum L.)
J. Hered.,
September 1, 2006;
97(5):
444 - 450.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. T. GRANT-DOWNTON and H. G. DICKINSON
Epigenetics and its Implications for Plant Biology 2. The 'Epigenetic Epiphany': Epigenetics, Evolution and Beyond
Ann. Bot.,
January 1, 2006;
97(1):
11 - 27.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Wang, L. Tian, H.-S. Lee, N. E. Wei, H. Jiang, B. Watson, A. Madlung, T. C. Osborn, R. W. Doerge, L. Comai, et al.
Genomewide Nonadditive Gene Regulation in Arabidopsis Allotetraploids
Genetics,
January 1, 2006;
172(1):
507 - 517.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. N. Lukens, J. C. Pires, E. Leon, R. Vogelzang, L. Oslach, and T. Osborn
Patterns of Sequence Loss and Cytosine Methylation within a Population of Newly Resynthesized Brassica napus Allopolyploids
Plant Physiology,
January 1, 2006;
140(1):
336 - 348.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Nomura, A. Ishihara, R. C. Yanagita, T. R. Endo, and H. Iwamura
Three genomes differentially contribute to the biosynthesis of benzoxazinones in hexaploid wheat
PNAS,
November 8, 2005;
102(45):
16490 - 16495.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. D. Rabinowicz, R. Citek, M. A. Budiman, A. Nunberg, J. A. Bedell, N. Lakey, A. L. O'Shaughnessy, L. U. Nascimento, W. R. McCombie, and R. A. Martienssen
Differential methylation of genes and repeats in land plants
Genome Res.,
October 1, 2005;
15(10):
1431 - 1440.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Pontes, N. Neves, M. Silva, M. S. Lewis, A. Madlung, L. Comai, W. Viegas, and C. S. Pikaard
Chromosomal locus rearrangements are a rapid response to formation of the allotetraploid Arabidopsis suecica genome
PNAS,
December 28, 2004;
101(52):
18240 - 18245.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. L. Adams, R. Percifield, and J. F. Wendel
Organ-Specific Silencing of Duplicated Genes in a Newly Synthesized Cotton Allotetraploid
Genetics,
December 1, 2004;
168(4):
2217 - 2226.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. MADLUNG and L. COMAI
The Effect of Stress on Genome Regulation and Structure
Ann. Bot.,
October 1, 2004;
94(4):
481 - 495.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Wang, L. Tian, A. Madlung, H.-S. Lee, M. Chen, J. J. Lee, B. Watson, T. Kagochi, L. Comai, and Z. J. Chen
Stochastic and Epigenetic Changes of Gene Expression in Arabidopsis Polyploids
Genetics,
August 1, 2004;
167(4):
1961 - 1973.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. C. Pires, K. Y. Lim, A. Kovarik, R. Matyasek, A. Boyd, A. R. Leitch, I. J. Leitch, M. D. Bennett, P. S. Soltis, and D. E. Soltis
Molecular cytogenetic analysis of recently evolved Tragopogon (Asteraceae) allopolyploids reveal a karyotype that is additive of the diploid progenitors
Am. J. Botany,
July 1, 2004;
91(7):
1022 - 1035.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. B. Della Vedova and K. C. Cone
Paramutation: The Chromatin Connection
PLANT CELL,
June 1, 2004;
16(6):
1358 - 1364.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. E. Schranz and T. C. Osborn
De novo variation in life-history traits and responses to growth conditions of resynthesized polyploid Brassica napus (Brassicaceae)
Am. J. Botany,
February 1, 2004;
91(2):
174 - 183.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Lund, M. Lauria, P. Guldberg, and S. Zaina
Duplication-Dependent CG Suppression of the Seed Storage Protein Genes of Maize
Genetics,
October 1, 2003;
165(2):
835 - 848.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Kato and E. Lam
Chromatin of endoreduplicated pavement cells has greater range of movement than that of diploid guard cells in Arabidopsis thaliana
J. Cell Sci.,
June 1, 2003;
116(11):
2195 - 2201.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Bushell, M. Spielman, and R. J. Scott
The Basis of Natural and Artificial Postzygotic Hybridization Barriers in Arabidopsis Species
PLANT CELL,
June 1, 2003;
15(6):
1430 - 1442.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
K. L. Adams, R. Cronn, R. Percifield, and J. F. Wendel
Genes duplicated by polyploidy show unequal contributions to the transcriptome and organ-specific reciprocal silencing
PNAS,
April 15, 2003;
100(8):
4649 - 4654.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|