First published online July 18, 2002; 10.1104/pp.003624
Plant Physiol, August 2002, Vol. 129, pp. 1507-1520
ADP-Ribosylation Factor 1 of Arabidopsis Plays a Critical Role in
Intracellular Trafficking and Maintenance of Endoplasmic Reticulum
Morphology in Arabidopsis1
Mi Hee
Lee,2
Myung Ki
Min,2
Yong Jik
Lee,
Jing Bo
Jin,
Dong Han
Shin,
Dae Heon
Kim,
Kwang-Hee
Lee, and
Inhwan
Hwang*
Center for Plant Intracellular Trafficking (M.H.L., Y.J.L., J.B.J.,
D.H.K., K.-H.L., I.H.) and Division of Molecular and Life Sciences
(M.K.M., D.H.S., I.H.), Pohang University of Science and Technology,
Pohang, 790-784, Korea
 |
ABSTRACT |
ADP-ribosylation factors (Arf), a family of small
GTP-binding proteins, play important roles in intracellular trafficking in animal and yeast cells. Here, we investigated the roles of two Arf
homologs, Arf1 and Arf3 of Arabidopsis, in intracellular trafficking in
plant cells. We generated dominant negative mutant forms of Arf 1 and
Arf3 and examined their effect on trafficking of reporter proteins in
protoplasts. Arf1[T31N] inhibited trafficking of
H+-ATPase:green fluorescent protein (GFP) and
sialyltransferase (ST):GFP to the plasma membrane and the Golgi
apparatus. In addition, Arf1[T31N] caused relocalization of the Golgi
reporter protein ST:GFP to the endoplasmic reticulum (ER). In
protoplasts expressing Arf1[T31N], ST:red fluorescent protein
remained in the ER, whereas H+-ATPase:GFP was mistargeted
to another organelle. Also, expression of Arf1[T31N] in
protoplasts resulted in profound changes in the morphology of the ER.
The treatment of protoplasts with brefeldin A had exactly the same
effect as Arf1[T31N] on various intracellular trafficking pathways.
In contrast, Arf3[T31N] did not affect trafficking of any of these
reporter proteins. Inhibition experiments using mutants with various
domains swapped between Arf1 and Arf3 revealed that the N-terminal
domain is interchangeable for trafficking inhibition. However, in
addition to the T31N mutation, motifs in domains II, III, and IV of
Arf1 were necessary for inhibition of trafficking of
H+-ATPase:GFP. Together, these results strongly suggest
that Arf1 plays a role in the intracellular trafficking of cargo
proteins in Arabidopsis, and that Arf1 functions through a brefeldin
A-sensitive factor.
 |
INTRODUCTION |
In eukaryotic cells, a large number
of proteins are transported to their final destination after
translation by a process called intracellular trafficking. The
mechanism of intracellular trafficking has been extensively studied in
animal, plant, and yeast cells. Based on numerous studies, the general
mechanism of intracellular trafficking is thought to be similar in
various organisms (Rothman, 1994 ; Jahn and Südhof, 1999 ; Bassham
and Raikhel, 2000 ), implying that the fundamental aspects of
intracellular trafficking between the endoplasmic reticulum (ER), Golgi
apparatus, vacuole, and plasma membrane are similar in plant cells as
well. In fact, many plant proteins have been shown to complement
mutations in corresponding proteins in yeast cells (Bassham et al.,
1995 ; Takeuchi et al., 1998 ). Also, proteins such as clathrin, coatomer subunits of coat protein I (COPI) vesicles, and many small
GTP-binding proteins have been identified in plant cells (Memon et al.,
1993 ; Regad et al., 1993 ; Lebas and Axelos, 1994 ; Blackbourn and
Jackson, 1996 ; Contreras et al., 2000 ), although in most cases, the
exact biological roles of these proteins have not been directly
addressed. However, differences in trafficking also exist between plant
and animal cells. It has recently been shown that plant cells have at
least two different types of vacuoles: the lytic and storage vacuoles
(Paris et al., 1996 ; Neuhaus and Rogers, 1998 ; Jauh et al., 1999 ). The
lytic vacuole is thought to be similar to the vacuole of yeast cells or
the lysosome of animal cells, whereas an organelle similar to the
storage vacuole is absent in yeast and animal cells, implying that
transportation of cargo molecules to the storage vacuole is likely
unique to plant cells (Matsuoka et al., 1990 ; Bednarek and Raikhel,
1991 ; Neuhaus et al., 1991 ; Chrispeels and Raikhel, 1992 ; Schroeder et
al., 1993 ; Saalbach et al., 1996 ; Frigerio et al., 1998 ).
Interestingly, precursor-accumulating vesicles have been shown to
transport proteins to the storage vacuole directly from the ER in
pumpkin seeds (Hara-Nishimura et al., 1998 ). In addition, storage
proteins such as vicilin have been shown to be sorted to the storage
vacuole at the cis-Golgi (Hillmer et al., 2001 ). Although the presence
of these unique pathways in plant cells has been demonstrated, proteins
involved in these pathways are largely unknown.
To understand regulation of trafficking in plant cells, we
investigated possible roles of ADP-ribosylation factors (Arfs), 20-kD guanine nucleotide-binding proteins that are members
of the small ras-like GTPase superfamily. Numerous studies have
demonstrated the pivotal role of Arfs on various steps of intracellular
trafficking pathway in various organisms (Balch et al., 1992 ; Dascher
and Balch, 1994 ; Gaynor et al., 1998 ; Goldberg, 1998 ; Pacheco-Rodriguez et al., 1998 ; Spang et al., 1998 ; Lanoix et al., 1999 ; Zhao et al.,
1999 ; Jackson and Casanova, 2000 ). Among various steps of intracellular
trafficking, Arf1 has been shown to be specifically involved in
retrograde trafficking from the Golgi apparatus to the ER and from the
trans-Golgi network to the endosome (Dascher and Balch, 1994 ; Ooi et
al., 1998 ; Goldberg, 1999 ; Poon et al., 1999 ; Roth, 1999 ; Jackson and
Casanova, 2000 ). During retrograde trafficking, Arf1 has been shown to
be involved in the formation of COP1 vesicles (Wieland and Harter,
1999 ). Also, Arf1 has also been proposed to be involved in the sorting
of cargo proteins (Lanoix et al., 1999 ; Goldberg, 2000 ). However, it is
not known whether Arf plays a role in intracellular trafficking in
plant cells. Highly homologous proteins such as Arabidopsis Arf1 and Arf3 have been found in plants (Regad et al., 1993 ; Memon et al., 1993 ;
Lebas and Axelos, 1994 ). Also, the fact that brefeldin A (BFA) inhibits
intracellular trafficking in plants in much the same way as in animal
and yeast cells (Gomez and Chrispeels, 1993 ; Boevink et al., 1999 )
suggests that these Arf homologs may also play roles in intracellular
trafficking. This notion was further supported by a recent report
showing that Arf1 is localized at the Golgi apparatus (Pimpl et al.,
2000 ), as in the case of animal cells (Balch et al., 1992 ; Dascher and
Balch, 1994 ; Roth, 1999 ).
In this study, we asked whether Arabidopsis Arf proteins play any role
in intracellular trafficking in vivo. To address this question in
Arabidopsis, we co-expressed various green fluorescent protein (GFP)
reporters and Arf mutants as cargoes and regulators of intracellular
trafficking, respectively, and then examined the effect in protoplasts
prepared from Arabidopsis leaf tissues.
Here, we present evidence that Arf1 plays a critical role in the
trafficking of H+-ATPase and sialyltransferase
(ST):GFP to the plasma membrane and the Golgi apparatus, respectively.
 |
RESULTS |
In Vivo Functional Assay for Intracellular Trafficking in
Protoplasts
In this study, we developed a new functional assay for
intracellular trafficking using protoplasts of Arabidopsis as a model system. The assay consists of two important components, reporter and
effector proteins. To monitor intracellular trafficking in the
protoplasts using a fluorescent microscope, we used reporter proteins
tagged with GFP (Davis and Vierstra, 1998 ) or red fluorescent protein
(RFP; Heikal et al., 2000 ). We have previously used
H+-ATPase:GFP and ST:GFP as a reporter for
trafficking to the plasma membrane and the Golgi apparatus,
respectively (Kim et al., 2001 ). Also, we used a GFP fusion protein
with chaperon BiP to use as a marker for the ER. As shown in Figure
1A, H+-ATPase:GFP
was present at the plasma membrane (Fig. 1A, a and d), and BiP:GFP was
present as numerous networks with blots (Fig. 1A, b). ST:GFP gave
punctate staining patterns (Fig. 1A, c). Also, we generated similar
fusion proteins with RFP ST:RFP, BiP:RFP, and
H+-ATPase:RFP and compared localization of these
RFP fusion proteins with that of corresponding GFP forms. As in the
case of ST:GFP, ST:RFP gave punctate staining patterns (Fig. 1A, c and
d). When we directly compared localization between ST:GFP and ST:RFP by cotransforming into protoplasts, the green and red punctate stains closely overlapped each other (Fig. 1B, a-c), indicating that both the
green and red forms of ST fusion proteins are targeted to the Golgi
apparatus. Also, an RFP fusion form of H+-ATPase,
H+-ATPase:RFP, was targeted to the plasma
membrane as in the case of H+-ATPase:GFP (data
not shown). These results suggest that the tetramer formation of RFP
(Heikal et al., 2000 ) per se may not affect localization of these
reporter proteins. Another important issue we addressed was efficiency
of cotransformation. In this assay, it is essential that both effector
and reporter plasmids are expressed in the same protoplasts. Therefore,
we first examined the efficiency of cotransformation using two reporter
proteins. The efficiency of cotransformation was over 95% when two
reporter proteins, BiP:RFP and H+-ATPase:GFP,
were used (Fig. 1C). Even with three constructs, the cotransformation
efficiency was over 90% (Fig. 1C). These results strongly suggest that
the cotransformation approach is a very efficient method of introducing
multiple plasmid DNAs into protoplasts.

View larger version (34K):
[in this window]
[in a new window]
|
Figure 1.
Establishment of an in vivo functional assay for
intracellular trafficking in protoplasts. A, Targeting of various
reporter proteins. Protoplasts were transformed with various reporter
constructs and examined 12 to 48 h after transformation.
Transformation efficiency varied from 5% to 40%. Green and red images
are GFP and RFP signals, respectively. Autofluorescence of chlorophyll
is depicted in blue. CH, Chloroplast. Bar = 20 µm. B,
Colocalization of ST:GFP and ST:RFP. Two constructs, ST:GFP
and ST:RFP, were introduced into protoplasts and
localization of green and red fluorescent signals were examined 24 to
48 h after transformation. Note that the autofluorescence of
chlorophyll is depicted in blue. CH, Chloroplast. Bar = 20 µm.
C, Estimation of cotransformation efficiency. Equimolar amounts of
plasmid DNAs (30 µg in total) were mixed and introduced into
protoplasts. To estimate cotransformation efficiency, images of more
than 200 transformed protoplasts were taken randomly from samples at
24 h after transformation. To avoid taking images from the same
protoplasts more than once, no more than 50 images were captured from
each slide. Also, these images were carefully compared to make sure
they were not from the same protoplasts. Most of the protoplasts had
unique patterns of chloroplasts and RFP or GFP signals, which allowed
us to distinguish individual protoplasts. The images were stored in a
computer and analyzed for double or triple transformation. Error bars
indicate means ± SD (n = 3). D and T indicate protoplasts cotransformed with two plasmids
(H+-ATPase:GFP plus
BiP:RFP) and three plasmids
(H+-ATPase:GFP plus
BiP:RFP plus NLS:GFP; Pih et al., 2000 ),
respectively.
|
|
Arf1[T31N] May Cause Fusion of the Golgi Membranes to the
ER
To understand the biological roles of Arf1 and Arf3,
we examined the effect of the GDP-binding dominant-negative mutants
Arf1[T31N] and Arf3[T31N] on intracellular trafficking by
expressing them transiently in protoplasts derived from
leaf tissues of Arabidopsis. The dominant negative mutant
form is thought to compete with the wild-type proteins for effector
proteins such as guanine nucleotide exchange factor (GEF), thereby
inhibiting the activity of the wild-type proteins. In animal cells,
Arf1[T28N] causes relocation of Golgi-resident proteins to the ER
through the disassembly of the Golgi apparatus (Dascher and Balch,
1994 ; Peters et al., 1995 ). We investigated whether Arabidopsis
Arf1[T31N] can cause disassembly of the Golgi apparatus as in animal
cells. To address this, we examined localization of Golgi-resident
proteins in the presence of Arf1[T31N]. As a marker protein for the
Golgi resident proteins, we decided to use ST:GFP (Wee et al., 1998 ;
Jin et al., 2001 ; Kim et al., 2001 ).
First, we used the transient expression approach by transforming
protoplasts with ST:GFP together with
Arf1[T31N]. As shown in Figure
2A, green fluorescent signals were
present as punctate stains in the protoplasts expressing Arf1 (Fig. 2A,
a; Kim et al., 2001 ), indicating that ST:GFP was localized at the Golgi apparatus. The percentage of transformed protoplasts with punctate stains was more than 95% (Fig. 2B). In contrast, in the presence of
Arf1[T31N], diffuse GFP patterns (Fig. 2A, b) were observed in more
than 90% of transformed protoplasts (Fig. 2B), indicating that
Arf1[T31N] has a profound effect on the localization of ST:GFP or the
morphology of the Golgi apparatus. However, Arf3[T31N] did not affect
the pattern of ST:GFP (Fig. 2, A and C). To confirm that these Arf
proteins were expressed in the protoplasts, we performed protein
gel-blot analysis using proteins obtained from the transformed
protoplasts. In this case, the wild-type and mutant forms of Arf1 and
Arf3 were tagged with the T7 epitope (Zheng et al., 1999 ). As shown in
Figure 2D, the wild-type and mutant forms of Arf1 and Arf3 were all
expressed at high levels when detected using a monoclonal T7 antibody.
The expression levels of all four Arf proteins appeared to be similar
when the level was normalized based on the level of co-expressed GFP.
This result strongly suggests that the differential effect of
Arf1[T31N] and Arf3[T31N] on the localization of ST:GFP is not due
to the difference at the level of these proteins but is likely caused
by the functional difference of the two Arf isoforms.

View larger version (39K):
[in this window]
[in a new window]
|
Figure 2.
The effect of Arf1[T31N] on localization of
transiently expressed ST:GFP in protoplasts. A, The effect of
Arf1[T31N] on localization of ST:GFP. Protoplasts were transformed
with various constructs and fluorescent images were obtained 12 to
48 h after transformation. Green and red images are GFP signals
and autofluorescence of chlorophyll, respectively. B and C, The
percentage of transformed protoplasts with punctate stains in the
presence of Arf1 and Arf1[T31N] (B), and Arf3 and Arf3[T31N]
(C). Protoplasts were transformed with ST:GFP plus
Arf1 (B, Arf1), ST:GFP plus
Arf1[T31N] (B, Arf1[T31N]), ST:GFP plus
Arf3 (C, Arf3), or ST:GFP plus
Arf3[T31N] (C, Arf3[T31N]). Images of more than 200 transformed protoplasts were analyzed as described in Figure 1. Images
were analyzed by more than one person who did not know the experimental
setting. D, Protein gel-blot analysis of T7-tagged Arf proteins. Total
cellular extracts were prepared from protoplasts transformed with
T7:Arf constructs. A GFP construct was
cotransformed to estimate transformation efficiency. Protein extracts
were analyzed by protein gel-blot analysis using a monoclonal anti-T7
antibody (T7) and a polyclonal anti-GFP antibody (GFP). 1, Arf1; 2, Arf1[T31N]; 3, Arf3; and 4, Arf3[T31N]. C, Protein extracts
obtained from untransformed protoplasts.
|
|
Next, we investigated the localization of the green fluorescent signals
of ST:GFP in the presence of Arf1[T31N]. To address this question, we
performed colocalization of ST:GFP with BiP:RFP, the ER marker protein.
In contrast to the control protoplasts (Fig.
3a), the diffuse green fluorescent signal
of ST:GFP closely overlapped the red fluorescent signal of BiP:RFP in
the presence of Arf1[T31N] (Fig. 3d), indicating that ST:GFP was
localized at the ER. In addition, the morphology of the ER network was
profoundly changed in the presence of Arf1[T31N], implying that
Arf1[T31N] may also affect the morphology of the ER (see below and
Fig. 10). However, this transient expression approach cannot clearly
address the question of relocation of ST:GFP from the Golgi apparatus to the ER because trafficking of ST:GFP from the ER to the Golgi apparatus may be blocked at the ER by co-expressed Arf1[T31N]. Therefore, we carried out the relocation experiment using protoplasts obtained from transgenic plants expressing ST:GFP constitutively. As
shown in Figure 4, ST:GFP in the
transgenic plants was found as punctate stains (Fig. 4a), as would be
expected for Golgi localization. Also, expression of Arf1 did not
change the pattern of ST:GFP (Fig. 4b). In contrast, when the
protoplasts from the transgenic plants were transformed with
Arf1[T31N], green fluorescent signals were present as
diffuse patterns (Fig. 4c) similar to those seen with transiently
expressed ST:GFP.

View larger version (32K):
[in this window]
[in a new window]
|
Figure 3.
Colocalization of ST:GFP and BiP:RFP in the
presence of Arf1[T31N]. Protoplasts were transformed with
ST:GFP, BiP:RFP, and Arf1[T31N] and
localization of reporter proteins was examined. Green and red images
are GFP and RFP signals, respectively. The blue signals in d indicate
autofluorescence of chlorophyll. Bar = 20 µm.
|
|

View larger version (32K):
[in this window]
[in a new window]
|
Figure 4.
The effect of Arf1[T31N] on the localization of
constitutively expressed ST:GFP. Protoplasts obtained from transgenic
plants constitutively expressing ST:GFP were transformed with the
constructs indicated. The effect of these Arf1 proteins on the
localization of ST:GFP was examined 24 h after transformation.
Green and red images are GFP and RFP signals, respectively. The blue
signals in a, b, and c indicate autofluorescence of chlorophyll.
Bar = 20 µm.
|
|
Next, we transformed protoplasts prepared from transgenic plants with
Arf1[T31N] and BiP:RFP to examine the
localization of ST:GFP in the presence of Arf1[T31N]. The green
fluorescent signals of ST:GFP closely overlapped the red fluorescent
signals of BiP:RFP (Fig. 4, d-f) in the presence of Arf1[T31N].
These results strongly suggest that the Golgi apparatus may be
disassembled in the presence of Arf1[T31N], which results in fusion
of the Golgi membranes together with Golgi resident proteins such as
ST:GFP to the ER in Arabidopsis protoplasts, as in animal cells
(Dascher and Balch, 1994 ; Peters et al., 1995 ). However, we cannot rule
out the possibility that ST:GFP that had been localized at
the Golgi apparatus may be turned over during incubation time
with Arf1[T31N] and that ST:GFP that was localized at the ER in the
presence of Arf1[T31N] may result from de novo synthesis. To address
this question, we examined the half-life of ST:GFP in the protoplasts
in the presence of cycloheximide, an inhibitor of protein synthesis. As
shown in Figure 5, in the presence of
cycloheximide, protein synthesis was nearly completely inhibited (Fig.
5, lane C). At this condition, the amount of ST:GFP was nearly the same
for up 36 h when the protein level was normalized based on the
loading control, indicating that degradation of ST:GFP is relatively
minor for 36 h if there is any. Thus, these results indirectly
support the notion that ST:GFP localized at the Golgi apparatus is
likely relocated to the ER in the presence of Arf1[T31N], instead of
being turned over, during 24 h of incubation time.

View larger version (18K):
[in this window]
[in a new window]
|
Figure 5.
Stability of ST:GFP in protoplasts in the presence
of cycloheximide. Protoplasts were transformed with ST:GFP
and incubated for expression of ST:GFP for 12 h. At 12 h
after transformation, cycloheximide (100 µg
mL 1) was added and further incubated for the
indicated periods of time. The level of ST:GFP was examined from
protein extracts prepared from protoplasts by western-blot analysis
using a monoclonal anti-GFP antibody. As a control (lane C),
cycloheximide was added to protoplasts right after transformation. En
indicates an endogenous protein that was detected by the monoclonal
anti-GFP antibody and used as a loading control for the western-blot
analysis.
|
|
Arf1[T31N], But Not Arf3[T31N], Inhibits Trafficking of
H+-ATPase:GFP to the Plasma Membrane
We next examined the effect of Arf1[T31N] on trafficking of
H+-ATPase:GFP to the plasma membrane. As shown in
Figure 6A,
H+-ATPase:GFP was correctly targeted to the
plasma membrane in the presence of Arf1 (Fig. 6A, b). However, when
Arf1[T31N] was co-expressed with the reporter protein, the green
fluorescent signal of H+-ATPase:GFP was present
as punctate stains or aggregates in the protoplasts (Fig. 6A, c1-c4,
arrowheads) and not at the plasma membrane. The targeting efficiency of
H+-ATPase:GFP to the plasma membrane
was more than 95% in control protoplasts (Fig. 6B), whereas it dropped
to less than 5% in the presence of Arf1[T31N] (Fig. 6B), indicating
that co-expression of Arf1[T31N] resulted in very efficient
inhibition. In contrast, Arf3[T31N] did not affect trafficking of
H+-ATPase:GFP to the plasma membrane (Fig. 6, C
and D). Together, these results suggest that Arf1, but not Arf3, plays
a role in the trafficking of H+-ATPase:GFP to the
plasma membrane.

View larger version (43K):
[in this window]
[in a new window]
|
Figure 6.
The effect of Arf1 and Arf3 mutants on trafficking
of H+-ATPase:GFP to the plasma membrane. A, The
effect of Arf1 mutants on trafficking of
H+-ATPase:GFP. Protoplasts were transformed with
the constructs indicated, and localization of
H+-ATPase:GFP was examined at 12 to 36 h
after transformation. Arrows indicate green fluorescent signals at the
plasma membrane and arrowheads indicate punctate stains in the
protoplasts. CH, Chloroplasts. Bars = 20 µm. B and C, Targeting
efficiency of H+-ATPase:GFP in the presence of
various forms of Arfs. To determine a targeting efficiency estimate,
images of more than 200 transformed protoplasts at each time point were
analyzed based on the GFP patterns of
H+-ATPase:GFP as described in Figure 2. The
patterns shown in A, a, were considered to indicate that
H+-ATPase:GFP was targeted to the plasma
membrane. The patterns shown in A, c-1 to c-4, were considered to
indicate that the protein was not targeted to the membrane. D, The
effect of Arf3 mutants on the trafficking of
H+-ATPase:GFP. Protoplasts were transformed with
H+-ATPase:GFP alone (a),
Arf3 plus H+-ATPase:GFP
(b), and Arf3[T31N] plus
H+-ATPase:GFP (c), and localization
of reporter protein was examined between 12 and 36 h after
transformation. The green and red images indicate GFP signals and
autofluorescence of chlorophyll, respectively. Arrows indicate green
fluorescent signals at the plasma membrane in the protoplasts. CH,
Chloroplasts. Bars = 20 µm.
|
|
In animal cells, BFA and the dominant negative mutant of Arf1 have been
shown to have similar effects on intracellular trafficking (Sata et
al., 1998 ; Morinaga et al., 1999 ). BFA has also been shown to inhibit
intracellular trafficking in plant cells (Gomez and Chrispeels, 1993 ;
Boevink et al., 1999 ). Therefore, we investigated the effect of BFA on
trafficking of H+-ATPase:GFP to the plasma
membrane in the protoplast. As shown in Figure
7, a green fluorescent signal was present
as punctate stains around the nucleus in the presence of BFA (Fig. 7c)
as observed in the presence of Arf1[T31N] (Fig. 6A, c1-c4),
suggesting that, as in animal cells, Arf1 may play a role in the
trafficking of H+-ATPase:GFP to the plasma
membrane through a BFA-sensitive factor (Sata et al., 1998 ; Morinaga et
al., 1999 ).

View larger version (37K):
[in this window]
[in a new window]
|
Figure 7.
The effect of BFA on the targeting of
H+-ATPase:GFP. Targeting of
H+-ATPase:GFP was examined in protoplasts in the
presence (+BFA) and absence ( BFA) of 30 µg
mL 1 BFA. BFA was added right after
transformation. Green and red images are GFP and chlorophyll,
respectively. N and CH indicate nucleus and chloroplast, respectively.
Arrows indicate H+-ATPase:GFP.
|
|
To further understand the role of Arf1 in trafficking in plant cells,
we attempted to determine the localization of
H+-ATPase:GFP in the presence of Arf1[T31N]. To
address this question, H+-ATPase:GFP
and Arf1[T31N] were transformed into protoplasts together with BiP:RFP. As shown in Figure
8A, the green fluorescent signals were
present as a few punctate stains that did not overlap the red
fluorescent signals of BiP:RFP (Fig. 8A, d-f), indicating that
H+-ATPase:GFP is not localized at the ER.
Interestingly, it appeared that the behavior of
H+-ATPase:GFP was different from that of
ST:GFP in the presence of Arf1[T31N]. To confirm this notion,
protoplasts were cotransformed with
H+-ATPase:GFP, ST:RFP, and
Arf1[T31N], and localization of these reporter proteins
was examined. As shown in Figure 8B,
H+-ATPases:GFP did not overlap ST:RFP in
protoplasts transformed with
H+-ATPase:GFP, ST:RFP,
and Arf1[T31N]. Together, these results suggest that
H+-ATPase:GFP was not present at the ER but at
some other organelle.

View larger version (25K):
[in this window]
[in a new window]
|
Figure 8.
Localization of
H+-ATPase:GFP in the presence of Arf1[T31N]. A,
Localization of H+-ATPase. Protoplasts were
transformed with three sets of constructs, either
H+-ATPase:GFP, BiP:RFP,
and Arf1 (a-c) or
H+-ATPase:GFP, BiP:RFP,
and Arf1[T31N] (d-f). Localization of green fluorescent
signals was examined 12 to 36 h after transformation. Arrows and
arrowheads indicate H+-ATPase:GFP and BiP:RFP,
respectively. B, Protoplasts were transformed with
H+-ATPase:GFP, ST:RFP,
and Arf1 or
H+-ATPase:GFP, ST:RFP,
and Arf1[T31N], and localization of reporter proteins was
examined.
|
|
Motifs in the Middle and C-Terminal Regions Are Necessary for
Inhibition of Trafficking by Arf1
Arf has been shown to be regulated by various effector molecules
such as GEFs and GTPase-activating proteins (Kahn et al., 1994 ;
Goldberg, 1998 , 1999 ). These proteins are known to interact with
specific domains of Arf1, such as switches 1 and 2 (Goldberg, 1998 ,
1999 ). To define which domains of Arf1 are necessary for its role in
intracellular trafficking, we made Arf1 and Arf3 mutants with swapped
domains. The Arf molecules were divided into four domains as shown in
Figure 9, A and B. Domain I (amino acid
residues 1-61) is the N-terminal region and includes the P-loop motif
(P) of the GTP-binding domain. Domains II (amino acid residues 62-95) and III (amino acid residues 96-130) include the second (G') and third
(G) GTP-binding motifs, respectively. Finally, domain IV (amino acid
residues 131-181 for Arf1 and 131-182 for Arf3) is the C-terminal
region downstream of the third GTP-binding motif. These domains were
exchanged to make hybrid mutants. In addition to domain exchanges, all
these constructs had the dominant-negative mutation [T31N] at the
P-loop.

View larger version (36K):
[in this window]
[in a new window]
|
Figure 9.
Trafficking of
H+-ATPase:GFP in the presence of various hybrid
mutants between Arf1[T31N] and Arf3[T31N]. A, Sequence alignment of
Arf1 and Arf3 isoforms of Arabidopsis. P, G', and G indicate the three
GTP-binding motifs. Vertical arrows indicate the boundary of the
domains. B, Schematic presentation of various hybrid constructs between
Arf1[T31N] and Arf3[T31N]. The first (I),
second (II), third (III), and fourth (IV) domains are regions
containing amino acid residues from 1 to 61, 62 to 95, 96 to 130, and
131 to 181, respectively. The subscripts 1 and 3 in the names of the
constructs indicate domains derived from Arf1 and Arf3, respectively.
Ns in the diagrams indicate T31 N mutations. P, G', and G indicate the
three GTP-binding motifs. C,
H+-ATPase:GFP was transformed into
protoplasts together with various hybrid constructs. The trafficking of
H+-ATPase:GFP was examined 20 to 30 h after
transformation. a through i represent protoplasts transformed with
constructs a through i, respectively, in B. Green and red fluorescent
signals are GFP and chlorophyll, respectively. At least three
independent transformation experiments were carried out for each
condition. Arrows indicate the green fluorescent signals of
H+-ATPase:GFP. CH, Chloroplast.
|
|
The effects of these mutants on trafficking of
H+-ATPase:GFP were examined in protoplasts after
transformation. As shown in Figure 9C, the mutant
I3[T31N]II1III1IV1,
consisting of domain I of Arf3 [T31N] and domains II, III, and IV of
Arf1, completely inhibited trafficking of
H+-ATPase:GFP to the plasma membrane (Fig. 9C,
d). This indicates that the first N-terminal domain of Arf3 can
functionally replace that of Arf1. However, the opposite mutant
I1[T31N]II3III3IV3, consisting of domain I of Arf1[T31N] and domains II, III, and IV of Arf3 did not inhibit trafficking (Fig. 9C, c), which suggests that the T31 N mutation and additional motif(s) in the downstream region of Arf1 are necessary for inhibition of trafficking. When constructs
I3[T31N]II3III1IV1
(Fig. 9C, e) and
I3[T31N]II3III3IV1 (Fig. 9C, g) were introduced into protoplasts, they did not inhibit trafficking, indicating that domain II of Arf1 is critical for inhibition. Next, we examined the effect of the domain III on the
inhibition using I3[T31N]II1III3IV1 (Fig. 9C, f1 and f2). When
I3[T31N]II1III3IV1 was
introduced together with
H+-ATPase:GFP, green fluorescent
signals of H+-ATPase:GFP were present at the
plasma membrane (Fig. 9C, f1) and in the cytosol as punctate stains
(Fig. 9C, f2), indicating that the trafficking of
H+-ATPase:GFP was partially inhibited.
These results suggest that domain III is necessary for complete
inhibition. Finally, we examined the effect of domain IV on the
trafficking using mutants
I3[T31N]II1III3IV3 (Fig. 9C, h1 and h2) and
I3[T31N]II1III1IV3
(Fig. 9C, i1 and i2). When these mutants were expressed in protoplasts,
green fluorescent signals were present at the plasma membrane (Fig. 9C,
h1 and i1) and in the cytosol as punctate stains (Fig. 9C, h2 and i2),
indicating a partial inhibition by these mutants. These results
indicate that domain IV is also necessary for complete inhibition.
Therefore, it is likely that protein-binding motifs in domains II, III,
and IV may interact with Arf1-specific effector proteins.
Arf1[T31N] Affects Morphology of the ER
Throughout this study, we noticed that red fluorescent signals of
BiP:RFP were present as diffuse patterns around the nucleus in
protoplasts when Arf1[T31N] was co-expressed. One possibility is that
the morphology of the ER might have been changed due to expression of
Arf1[T31N]. To address this question, we compared the morphology of
the ER in the presence of Arf1 and Arf1[T31N] in protoplasts using
BiP:GFP as a reporter for the ER. As described previously, the red
fluorescent signals of BiP:GFP were present as numerous networks with
blobs throughout the protoplast in the presence of co-expressed Arf1
(Fig. 10). In contrast, protoplasts expressing Arf1[T31N] gave diffuse patterns of BiP:GFP, clearly indicating that this pattern was caused by Arf1[T31N]. Boevink et al.
(1999) has reported a similar observation; namely, the ER network is
transformed into large lamellae or sheets in the presence of BFA in
tobacco (Nicotiana tabacum) cells. In yeast, mutations at
Arf1 also caused exaggeration of the ER membrane (Yahara et al., 2001 ).
Thus, one possible explanation is that in the presence of Arf1[T31N],
fusion of the Golgi membranes to the ER and inhibition of anterograde
trafficking may cause expansion of the ER networks, which results in
profound changes in the ER morphology as shown here.

View larger version (43K):
[in this window]
[in a new window]
|
Figure 10.
The effect of Arf1[T31N] and BFA on morphology
of the ER. Protoplasts were transformed with either Arf1
plus BiP:RFP or Arf1[T31N] plus
BiP:RFP and examined between 12 and 36 h after
transformation. a and c are representative fluorescent images of
protoplasts, and b and d are bright-field images of a and c,
respectively. Red images are RFP signals of BiP:RFP. Autofluorescence
of chlorophyll is depicted in blue. N and CH indicate the nucleus and
chloroplast, respectively.
|
|
 |
DISCUSSION |
In animal and yeast cells, involvement of Arf in retrograde
trafficking from the Golgi apparatus to the ER has been extensively characterized (Balch et al., 1992 ; Haun et al., 1993 ; Kahn et al.,
1994 ; Moss and Vaughan, 1998 ; Spang et al., 1998 ; Lanoix et al., 1999 ;
Poon et al., 1999 ; Zhao et al., 1999 ). Use of the dominant negative
mutant of Arf1 and BFA, an inhibitor of Arf1, has been instrumental in
elucidating the role of Arf1. In the presence of the dominant negative
mutant or BFA, the Golgi structure is disassembled and fused to the ER,
thereby resulting in relocation of the Golgi-resident proteins to the
ER and eventually inhibiting anterograde trafficking. In this study, we
used similar approaches using a dominant negative mutant of Arf1,
Arf1[T31N], and examined the effect of Arf1[T31N] on trafficking of
ST:GFP and H+-ATPase:GFP to their final
destinations. In the presence of Arf1[T31N], ST:GFP was present at
the ER as a diffuse pattern. In addition, Arf1[T31N] caused
relocation of ST:GFP from the Golgi apparatus to the ER, suggesting
that Arf1[T31N] may cause disassembly of the Golgi apparatus in
plant cells as in animal cells. The behavior of ST:GFP is very similar
to the known effect of the dominant negative mutant of Arf1 in animal
and yeast cells. However, interestingly, the inhibition pattern of
H+-ATPase:GFP by Arf1[T31N] was quite different
from that of ST:GFP. In the presence of Arf1[T31N],
H+-ATPase:GFP was not targeted to the plasma
membrane, indicating that Arf1[T31N] inhibits trafficking of
H+-ATPase:GFP to the plasma membrane. However, in
contrast to ST:GFP, it was not present in the ER but instead present at
an unidentified organelle as punctate stains.
It has been shown that certain cargo molecules can take alternative
pathways and be transported to other organelles when the normal
trafficking pathway is inhibited. In Bright-Yellow 2 cells, sporamin is
secreted into media when trafficking of sporamin to the central vacuole
was inhibited by wortmannin (Matsuoka et al., 1995 ). Also, in yeast
cells with mutations in both AP3-µ and VPS45 genes, vacuolar alkaline phosphatase is transported via an alternate intracellular route and present as punctate stains in the cell instead
of being transported to the vacuolar membrane (Stepp et al., 1997 ). At
the moment, the route for trafficking of
H+-ATPase:GFP to the plasma membrane is not known
in plant cells. One possible route for trafficking of
H+-ATPase:GFP is from the ER to the plasma
membrane through the Golgi apparatus, although we were not able to see
colocalization of H+-ATPase:GFP with the Golgi
marker, ST:RFP (data not shown). This could be because
H+-ATPase:GFP is present at the Golgi apparatus
only for short time and does not accumulate there in high enough level
to be detected. Thus, it is possible that
H+-ATPase:GFP may be mistargeted to other
organelles in the presence of Arf1[T31N] because of blocking of the
normal trafficking pathway through the Golgi apparatus. It has recently
been shown that BFA treatment resulted in accumulation of plasma
membrane H+-ATPase at the BFA-induced
intracellular compartment in Arabidopsis root cells (Geldner et al.,
2001 ). Thus, it is possible that in the presence of Arf1[T31N]
H+-ATPase:GFP accumulates at a compartment
similar to the BFA-induced intracellular compartment. In addition to
the inhibition of normal intracellular trafficking of ST:GFP and
H+-ATPase:GFP, Arf1[T31N] caused profound
changes in ER morphology, which is likely due to fusion of the Golgi
membranes to the ER and inhibition of anterograde trafficking.
BFA treatments had the same effect on trafficking of
these reporters as Arf1[T31N], indicating that Arf1[T31N] may play
a role in intracellular trafficking through a BFA-sensitive factor. BFA
has been shown to inhibit Arf1 function by stabilizing the transitory
complexes of Sec7 domain-Arf1-GDP (Sata et al., 1998 ; Morinaga et al.,
1999 ; Robineau et al., 2000 ). Thus, it is likely that similar GEF
proteins may also be present in plant cells. One possible role of Arf1
in intracellular trafficking is that Arf1 may also be involved in the
formation of COPI vesicles at the Golgi apparatus as proposed in animal
cells (Lanoix et al., 1999 ; Roth, 1999 ; Wieland and Harter, 1999 ). In
fact, Arf1 has recently been shown to be localized at the Golgi
apparatus in plant cells (Pimpl et al., 2000 ). Also, the presence of
coatomer subunits of COPI vesicles in plant cells has been reported
(Contreras et al., 2000 ).
To further investigate the role that Arf1 plays in intracellular
trafficking, we carried out inhibition studies using various mutants
with swapped domains between Arf1 and Arf3. These studies revealed that
the N-terminal regions of Arfs were interchangeable. However,
interestingly,
I3[T31N]II3III1IV1
and
I3[T31N]II3III3IV1 did not inhibit trafficking of H+-ATPase:GFP to
the plasma membrane at all. These results demonstrated the importance
of domain II for the function of Arf1 in intracellular trafficking. One
of the protein interaction domains of Arf1, named the switch 2 (amino
acid residues from 70-80), is located in the region designated as
domain II in this study and has been shown to be involved
in interaction with effector proteins, such as GEFs and
GTPase-activating proteins (Moss and Vaughan, 1998 ; Goldberg, 1999 ).
However, the fact that mutants I3[T31N]II1III3IV1,
I3[T31N]II1III3IV3, and
I3[T31N]II1III1IV3
gave only partial inhibition of trafficking of the
H+-ATPase:GFP to the plasma membrane suggests
that motifs in domains III and IV of Arf1 are also necessary for the
function of Arf1. Domain III of Arf1 defined in this study
contains the third GTP-binding motif. However, it is possible that
domain III may contain additional motifs involved in interaction with
effector protein for the function of Arf1. Domain IV contains the
C-terminal Arf consensus motif, TCAT (Kahn et al., 1994 ). Thus, the
inhibition experiments using various domain-swapped mutants clearly
demonstrated the functional difference between Arf1 and Arf3. The
difference probably resulted from the difference in the interaction of
Arf isoforms with effector proteins. The motif in each domain may be
involved in interaction with isoform-specific effector proteins.
However, it is also possible that the motif in domain II of Arf
isoforms may play a major role in interaction with an Arf
isoform-specific effector protein, and motifs in domains III and IV may
increase binding affinity of the Arf isoform-specific effector bound to
the motif of domain II. Thus, depletion of the Arf1-specific effector
protein by the dominant negative mutant of Arf1 may result in
inhibition of intracellular trafficking.
In conclusion, although Arf1 and Arf3 isoforms of Arabidopsis are
highly homologous to each other, only Arf1 but not Arf3 was shown to be
involved in the intracellular trafficking pathways we examined.
Similarly, in yeast and animal cells, multiple isoforms of Arfs have
been found, but only certain isoforms have been shown to play roles in
intracellular trafficking (Jackson and Casanova, 2000 ). However,
we cannot rule out the possibility that Arf3 may also be involved in
other steps or other routes of intracellular trafficking that we did
not address in this study. In animal cells, Arf6 has been shown to be
involved in endocytosis and membrane recycling at the plasma membrane
(D'Souza-Schorey et al., 1998 ). Another possibility is that Arf3 may
be involved in other biological process, as in the case of Arf6 in
actin polymerization in animal cells (Al-Awar et al., 2000 ). Further
studies are necessary to define the biological role of the Arf3 isoform
in Arabidopsis.
 |
MATERIALS AND METHODS |
Growth of Plants
Arabidopsis (ecotype Columbia) was grown on soil at 20°C to
25°C in a greenhouse with a 16/8-h light/dark cycle. Leaf tissues were harvested from the plants and immediately used for protoplast isolation.
Generation of Various Constructs
Arf1 (accession no. M95166) and Arf3 (accession no.
X77385) cDNAs were PCR amplified from a lambda cDNA library using gene-specific primers (Arf1-5, TTGGACGACCATCGGCGTTAAG; Arf1-3; TCCATCTATGCCTTGCTTGCGA; Arf3-5, CCAATCGAAGAAGAAGATGGGA; and Arf3-3, CCTTATGGGGAATATTAAGTGA). The nucleotide sequences of both cDNAs were confirmed through DNA sequencing. Point mutants of Arf1 and Arf 3 were generated by PCR. The primers used were: Arf1[T31N], GGTAAGAACACTATCCTCTACAAGC and GATAGTGTTCTTACCAGCAGCATCG; Arf3[T31N], GGAAAAAACACAATCCTATATCGGC and GATTGTGTTTTTTCCAGCATTGTCG. To generate mutants with swapped domains, common restriction sites were introduced into the two Arf isoforms by PCR using primers that did not change the
amino acid sequence. The primer sequences used were: Arf1F62HindIII, CATAAGCTTCACCGTGTGGGA; Arf1R62HindIII, GCGAAGCTTATGTTCTTGTATTCAAC; Arf1F95XhoI, GACTCGAGTGATCGTGACCGTGTTG; Arf1R95XI,
GCCTCGAGTCCACAACAAAGATAAG; Arf3R62HIII, GCGAAGCTTATATTGTTGTATTGCAC;
Arf3F62HIII, CGCAAGCTTTCAGGTCTGGGATTT; Arf3F130BgII,
ATAGATCTTCCCGGTGCACT, and Arf3R130BHI, GCGGATCCTGCTTGTTTGCAA. The
sequence of all of the PCR products was confirmed through DNA
sequencing. These fragments were then fused using the common restriction sites after restriction digestion. Finally, these constructs were introduced into an expression vector that has the
cauliflower mosaic virus 35S promoter and the nopaline
synthetase terminator. To add the T7 epitope tag to the N
termini of wild types and dominant negative mutants of Arf1 and Arf3,
BamHI and XhoI fragments encoding Arf1,
Arf1[T31N], Arf3, and Arf3[T31N] were ligated into the
BamHI and XhoI sites of pET21a (+)
(Novagen, Madison, WI). XbaI and XhoI
fragments encoding the T7-Arf clones were subsequently isolated and
placed downstream of the cauliflower mosaic virus 35S promoter.
Generation of Transgenic Plants
A binary vector, pST:GFP, was constructed by replacing the
-glucuronidase coding region of pBI121 with ST:GFP and transformed into Agrobacterium tumefaciens by electroporation.
Arabidopsis was then transformed according to the vacuum-infiltration
method (Clough and Bent, 1998 ). Transgenic plants were selected on
Murashige-Skoog plates containing 50 mg L 1 kanamycin.
Transient Expression of Arf Constructs and in Vivo
Targeting of Reporter Proteins
For expression in protoplasts, all of the chimeric GFP fusion
constructs were placed under the control of the 35S promoter in a pUC
vector. Plasmids were purified using Qiagen (Valencia, CA) columns
according to the manufacturer's protocol. The plasmids were introduced
into Arabidopsis protoplasts that had been prepared from leaf tissues
by polyethylene glycol-mediated transformation (Jin et al., 2001 ; Kim
et al., 2001 ; Lee et al., 2001 ). Expression of the fusion
constructs was monitored at various time points after transformation
and images were captured with a cooled CCD camera and a Zeiss (Jena,
Germany) Axioplan fluorescence microscope. The filter sets used were
XF116 (exciter, 474AF20; dichroic, 500DRLP; and emitter, 510AF23),
XF33/E (exciter, 535DF35; dichroic, 570DRLP; and emitter, 605DF50), and
XF137 (exciter, 540AF30; dichroic, 570DRLP; and emitter, 585ALP; Omega,
Inc., Brattleboro, VT) for GFP, RFP, and auto-fluorescence of
chlorophyll, respectively. Data were then processed using Adobe
Photoshop software (Adobe Systems, Mountain View, CA) and presented in
pseudo-color format.
 |
ACKNOWLEDGMENT |
We thank Dr. John Rogers (University of Washington, Pullman) for
the suggestions and helpful discussion for the work.
 |
FOOTNOTES |
Received February 3, 2002; returned for revision April 4, 2002; accepted April 22, 2002.
1
This work was supported by a grant from National
Creative Research Initiatives from the Ministry of Science and Technology.
2
These authors contributed equally to the paper.
*
Corresponding author; e-mail ihhwang{at}postech.ac.kr; fax
82-54-279-8159.
Article, publication date, and citation information can be found at
www.plantphysiol.org/cgi/doi/10.1104/pp.003624.
 |
LITERATURE CITED |
-
Al-Awar O, Radhakrishna H, Powell NN, Donaldson JG
(2000)
Separation of membrane trafficking and actin remodeling functions of ARF6 with an effector domain mutant.
Mol Cell Biol
20: 5998-6007[Abstract/Free Full Text]
-
Balch WE, Kahn RA, Schwaninger R
(1992)
ADP-ribosylation factor is required for vesicular trafficking between the endoplasmic reticulum and the cis-Golgi compartment.
J Biol Chem
267: 13053-13061[Abstract/Free Full Text]
-
Bassham DC, Gal S, da Silva Conceicao A, Raikhel NV
(1995)
An Arabidopsis syntaxin homologue isolated by functional complementation of a yeast pep12 mutant.
Proc Natl Acad Sci USA
92: 7262-7266[Abstract/Free Full Text]
-
Bassham DC, Raikhel NV
(2000)
Unique features of the plant vacuolar sorting machinery.
Curr Opin Cell Biol
12: 491-495[CrossRef][Web of Science][Medline]
-
Bednarek SY, Raikhel NV
(1991)
The barley lectin carboxyl-terminal propeptide is a vacuolar protein sorting determinant in plants.
Plant Cell
3: 1195-1206[Abstract/Free Full Text]
-
Blackbourn HD, Jackson AP
(1996)
Plant clathrin heavy chain: sequence analysis and restricted localisation in growing pollen tubes.
J Cell Sci
109: 777-786[Abstract]
-
Boevink P, Martin B, Oparka K, Santa Cruz S, Hawes C
(1999)
Transport of virally expressed green fluorescent protein through the secretory pathway in tobacco leaves is inhibited by cold shock and brefeldin A.
Planta
208: 392-400[CrossRef]
-
Chrispeels MJ, Raikhel NV
(1992)
Short peptide domains target proteins to plant vacuoles.
Cell
68: 613-616[CrossRef][Web of Science][Medline]
-
Clough SJ, Bent AF
(1998)
Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana.
Plant J
16: 735-743[CrossRef][Web of Science][Medline]
-
Contreras I, Ortiz-Zapater E, Castilho LM, Aniento F
(2000)
Characterization of COPI coat proteins in plant cells.
Biochem Biophys Res Commun
273: 176-182[CrossRef][Web of Science][Medline]
-
Dascher C, Balch WE
(1994)
Dominant inhibitory mutants of ARF1 block endoplasmic reticulum to Golgi transport and trigger disassembly of the Golgi apparatus.
J Biol Chem
269: 1437-1448[Abstract/Free Full Text]
-
Davis SJ, Vierstra RD
(1998)
Soluble, highly fluorescent variants of green fluorescent protein (GFP) for use in higher plants.
Plant Mol Biol
36: 521-528[CrossRef][Web of Science][Medline]
-
D'Souza-Schorey C, van Donselaar E, Hsu VW, Yang C, Stahl PD, Peters PJ
(1998)
ARF6 targets recycling vesicles to the plasma membrane: insights from an ultrastructural investigation.
J Cell Biol
140: 603-616[Abstract/Free Full Text]
-
Frigerio L, de Virgilio M, Prada A, Faoro F, Vitale A
(1998)
Sorting of phaseolin to the vacuole is saturable and requires a short C-terminal peptide.
Plant Cell
10: 1031-1042[Abstract/Free Full Text]
-
Gaynor EC, Chen CY, Emr SD, Graham TR
(1998)
ARF is required for maintenance of yeast Golgi and endosome structure and function.
Mol Biol Cell
9: 653-670[Abstract/Free Full Text]
-
Geldner N, Friml J, Stierhof YD, Jurgens G, Palme K
(2001)
Auxin transport inhibitors block PIN1 cycling and vesicle trafficking.
Nature
413: 425-428[CrossRef][Medline]
-
Goldberg J
(1998)
Structural basis for activation of ARF GTPase: mechanisms of guanine nucleotide exchange and GTP-myristoyl switching.
Cell
95: 237-248[CrossRef][Web of Science][Medline]
-
Goldberg J
(1999)
Structural and functional analysis of the ARF1-ARFGAP complex reveals a role for coatomer in GTP hydrolysis.
Cell
96: 893-902[CrossRef][Web of Science][Medline]
-
Goldberg J
(2000)
Decoding of sorting signals by coatomer through a GTPase switch in the COPI coat complex.
Cell
100: 671-679[CrossRef][Web of Science][Medline]
-
Gomez L, Chrispeels MJ
(1993)
Tonoplast and soluble vacuolar proteins are targeted by different mechanisms.
Plant Cell
5: 1113-1124[Abstract/Free Full Text]
-
Hara-Nishimura I, Shimada T, Hatano K, Takeuchi Y, Nishimura M
(1998)
Transport of storage proteins to protein storage vacuoles is mediated by large precursor-accumulating vesicles.
Plant Cell
10: 825-836[Abstract/Free Full Text]
-
Haun RS, Tsai SC, Adamik R, Moss J, Vaughan M
(1993)
Effect of myristoylation on GTP-dependent binding of ADP-ribosylation factor to Golgi.
J Biol Chem
268: 7064-7068[Abstract/Free Full Text]
-
Heikal AA, Hess ST, Baird GS, Tsien RY, Webb WW
(2000)
Molecular spectroscopy and dynamics of intrinsically fluorescent proteins: coral red (dsRed) and yellow (Citrine).
Proc Natl Acad Sci USA
97: 11996-12001[Abstract/Free Full Text]
-
Hillmer S, Movafeghi A, Robinson DG, Hinz G
(2001)
Vacuolar storage proteins are sorted in the cis-cisternae of the pea cotyledon Golgi apparatus.
J Cell Biol
152: 41-50[Abstract/Free Full Text]
-
Jackson CL, Casanova JE
(2000)
Turning on ARF: the sec7 family of guanine-nucleotide exchange factors.
Trends Cell Biol
10: 60-67[CrossRef][Web of Science][Medline]
-
Jahn R, Südhof TC
(1999)
Membrane fusion and exocytosis.
Annu Rev Biochem
68: 863-911[CrossRef][Web of Science][Medline]
-
Jauh GY, Phillips TE, Rogers JC
(1999)
Tonoplast intrinsic protein isoforms as markers for vacuolar functions.
Plant Cell
11: 1867-1882[Abstract/Free Full Text]
-
Jin JB, Kim YA, Kim SJ, Lee SH, Kim DH, Cheong GW, Hwang I
(2001)
A new dynamin-like protein, ADL6, is involved in trafficking from the trans-Golgi network to the central vacuole in Arabidopsis.
Plant Cell
13: 1511-1526[Abstract/Free Full Text]
-
Kahn RA, Clark J, Rulka C, Stearns T, Zhang C, Randazzo PA, Terui T, Cavenagh M
(1994)
Mutational analysis of Saccharomyces cerevisiae ARF1.
J Biol Chem
270: 143-150[Abstract/Free Full Text]
-
Kim DH, Eu YJ, Yoo CM, Kim YW, Pih KT, Jin JB, Kim SJ, Stenmark H, Hwang I
(2001)
Trafficking of phosphatidylinositol 3-phosphate from the trans-Golgi network to the lumen of the central vacuole in plant cells.
Plant Cell
13: 287-301[Abstract/Free Full Text]
-
Lanoix J, Ouwendijk J, Lin CC, Stark A, Love HD, Ostermann J, Nilsson T
(1999)
GTP hydrolysis by arf-1 mediates sorting and concentration of Golgi resident enzymes into functional COP I vesicles.
EMBO J
18: 4935-4948[CrossRef][Web of Science][Medline]
-
Lebas M, Axelos M
(1994)
A cDNA encoding a new GTP-binding protein of the ADP-ribosylation factor family from Arabidopsis.
Plant Physiol
106: 809-810[CrossRef][Web of Science][Medline]
-
Lee YJ, Kim DH, Kim YW, Hwang I
(2001)
Identification of a signal that distinguishes between the chloroplast outer envelope membrane and the endomembrane system in vivo.
Plant Cell
13: 2175-2190[Abstract/Free Full Text]
-
Matsuoka K, Bassham DC, Raikhel NV, Nakamura K
(1995)
Different sensitivity to wortmannin of two vacuolar sorting signals indicates the presence of distinct sorting machineries in tobacco cells.
J Cell Biol
130: 1307-1318[Abstract/Free Full Text]
-
Matsuoka K, Matsumoto S, Hattori T, Machida Y, Nakamura K
(1990)
Vacuolar targeting and post-translational processing of the precursor to the sweet potato tuberous root storage protein in heterologous plant cells.
J Biol Chem
265: 19750-19757[Abstract/Free Full Text]
-
Memon AR, Clark GB, Thompson GA Jr
(1993)
Identification of an ARF type low molecular mass GTP-binding protein in pea (Pisum sativum).
Biochem Biophys Res Commun
193: 809-813[Medline]
-
Morinaga N, Adamik R, Moss J, Vaughan M
(1999)
Brefeldin A inhibited activity of the sec7 domain of p200, a mammalian guanine nucleotide-exchange protein for ADP-ribosylation factors.
J Biol Chem
274: 17417-17423[Abstract/Free Full Text]
-
Moss J, Vaughan M
(1998)
Molecules in the ARF orbit.
J Biol Chem
273: 21431-21434[Free Full Text]
-
Neuhaus JM, Rogers JC
(1998)
Sorting of proteins to vacuoles in plant cells.
Plant Mol Biol
38: 127-144[CrossRef][Web of Science][Medline]
-
Neuhaus JM, Sticher L, Meins F Jr, Boller T
(1991)
A short C-terminal sequence is necessary and sufficient for the targeting of chitinases to the plant vacuole.
Proc Natl Acad Sci USA
88: 10362-10366[Abstract/Free Full Text]
-
Ooi CE, Dell'Angelica EC, Bonifacino JS
(1998)
ADP-ribosylation factor 1 (ARF1) regulates recruitment of the AP-3 adaptor complex to membranes.
J Cell Biol
142: 391-402[Abstract/Free Full Text]
-
Pacheco-Rodriguez G, Meacci E, Vitale N, Moss J, Vaughan M
(1998)
Guanine nucleotide exchange on ADP-ribosylation factors catalyzed by cytohesin-1 and its Sec7 domain.
J Biol Chem
273: 26543-26548[Abstract/Free Full Text]
-
Paris N, Stanley CM, Jones RL, Rogers JC
(1996)
Plant cells contain two functionally distinct vacuolar compartments.
Cell
85: 563-572[CrossRef][Web of Science][Medline]
-
Peters PJ, Hsu VW, Ooi CE, Finazzi D, Teal SB, Oorschot V, Donaldson JG, Klausner RD
(1995)
Overexpression of wild-type and mutant ARF1 and ARF6: distinct perturbations of nonoverlapping membrane compartments.
J Cell Biol
128: 1003-1017[Abstract/Free Full Text]
-
Pih KT, Yi MJ, Liang YS, Shin BJ, Cho MJ, Hwang I, Son D
(2000)
Molecular cloning and targeting of a fibrillarin homolog from Arabidopsis.
Plant Physiol
123: 51-58[Abstract/Free Full Text]
-
Pimpl P, Movafeghi A, Coughlan S, Denecke J, Hillmer S, Robinson DG
(2000)
In situ localization and in vitro induction of plant COP1-coated vesicles.
Plant Cell
12: 2219-2235[Abstract/Free Full Text]
-
Poon PP, Cassel D, Spang A, Rotman M, Pick E, Singer RA, Johnston GC
(1999)
Retrograde transport from the yeast Golgi is mediated by two ARF GAP proteins with overlapping function.
EMBO J
18: 555-564[CrossRef][Web of Science][Medline]
-
Regad F, Bardet C, Tremousaygue D, Moisan A, Lescure B, Axelos M
(1993)
cDNA cloning and expression of an Arabidopsis GTP-binding protein of the ARF family.
FEBS Lett
316: 133-136[CrossRef][Web of Science][Medline]
-
Robineau S, Chabre M, Antonny B
(2000)
Binding site of brefeldin A at the interface between the small G protein ADP-ribosylation factor 1 (ARF1) and the nucleotide-exchange factor Sec7 domain.
Proc Natl Acad Sci USA
97: 9913-9918[Abstract/Free Full Text]
-
Roth MG
(1999)
Snapshots of ARF1: implications for mechanisms of activation and inactivation.
Cell
97: 149-152[CrossRef][Web of Science][Medline]
-
Rothman JE
(1994)
Mechanisms of intracellular protein import.
Nature
372: 55-63[CrossRef][Medline]
-
Saalbach G, Rosso M, Schumann U
(1996)
The vacuolar targeting signal of the 2S albumin from Brazil nut resides at the C terminus and involves the C-terminal propeptide as an essential element.
Plant Physiol
112: 975-985[Abstract]
-
Sata M, Donaldson JG, Moss J, Vaughan M
(1998)
Brefeldin A-inhibited guanine nucleotide-exchange activity of Sec7 domain from yeast Sec7 with yeast and mammalian ADP ribosylation factors.
Proc Natl Acad Sci USA
95: 4204-4208[Abstract/Free Full Text]
-
Schroeder MR, Borkhsenious ON, Matsuoka K, Nakamura K, Raikhel NV
(1993)
Colocalization of barley lectin and sporamin in vacuoles of transgenic tobacco plants.
Plant Physiol
101: 451-458[Abstract]
-
Spang A, Matsuoka K, Hamamoto S, Schekman R, Orci L
(1998)
Coatomer, Arf1p, and nucleotide are required to bud coat protein complex I-coated vesicles from large synthetic liposomes.
Proc Natl Acad Sci USA
95: 11199-11204[Abstract/Free Full Text]
-
Stepp JD, Huang K, Lemmon SK
(1997)
The yeast adaptor protein complex, AP-3, is essential for the efficient delivery of alkaline phosphatase by the alternate pathway to the vacuole.
J Cell Biol
139: 1761-1774[Abstract/Free Full Text]
-
Takeuchi M, Tada M, Saito C, Yashiroda H, Nakano A
(1998)
Isolation of a tobacco cDNA encoding Sar1 GTPase and analysis of its dominant mutations in vesicular traffic using a yeast complementation system.
Plant Cell Physiol
39: 590-599[Abstract/Free Full Text]
-
Wee EG-T, Sherrier DJ, Prime TA, Dupree P
(1998)
Targeting of active sialyltransferase to the plant Golgi apparatus.
Plant Cell
10: 1759-1768[Abstract/Free Full Text]
-
Wieland F, Harter C
(1999)
Mechanisms of vesicle formation: insights from the COP system.
Curr Opin Cell Biol
11: 440-446[CrossRef][Web of Science][Medline]
-
Yahara N, Ueda T, Sato K, Nakano A
(2001)
Multiple roles of Arf1 GTPase in the yeast exocytic and endocytic pathways.
Mol Biol Cell
12: 221-238[Abstract/Free Full Text]
-
Zhao L, Helms JB, Brunner J, Wieland FT
(1999)
GTP-dependent binding of ADP-ribosylation factor to coatomer in close proximity to the binding site for dilysine retrieval motifs and p23.
J Biol Chem
274: 14198-14203[Abstract/Free Full Text]
-
Zheng H, von Mollard GF, Kovaleva V, Stevens TH, Raikhel NV
(1999)
The plant vesicle-associated SNARE AtVTI1a likely mediates vesicle transport from the trans-Golgi network to the prevacuolar compartment.
Mol Biol Cell
10: 2251-2264[Abstract/Free Full Text]
© 2002 American Society of Plant Physiologists
This article has been cited by other articles:

|
 |

|
 |
 
A. Kosmala, A. Bocian, M. Rapacz, B. Jurczyk, and Z. Zwierzykowski
Identification of leaf proteins differentially accumulated during cold acclimation between Festuca pratensis plants with distinct levels of frost tolerance
J. Exp. Bot.,
August 1, 2009;
60(12):
3595 - 3609.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. K. Lee, S. K. Cho, O. Son, Z. Xu, I. Hwang, and W. T. Kim
Drought Stress-Induced Rma1H1, a RING Membrane-Anchor E3 Ubiquitin Ligase Homolog, Regulates Aquaporin Levels via Ubiquitination in Transgenic Arabidopsis Plants
PLANT CELL,
February 1, 2009;
21(2):
622 - 641.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Wei and A. Wang
Biogenesis of Cytoplasmic Membranous Vesicles for Plant Potyvirus Replication Occurs at Endoplasmic Reticulum Exit Sites in a COPI- and COPII-Dependent Manner
J. Virol.,
December 15, 2008;
82(24):
12252 - 12264.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Yuksel and A. R. Memon
Comparative phylogenetic analysis of small GTP-binding genes of model legume plants and assessment of their roles in root nodules
J. Exp. Bot.,
October 9, 2008;
(2008)
ern223v1.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Hwang
Sorting and Anterograde Trafficking at the Golgi Apparatus
Plant Physiology,
October 1, 2008;
148(2):
673 - 683.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Held, A. Boulaflous, and F. Brandizzi
Advances in Fluorescent Protein-Based Imaging for the Analysis of Plant Endomembranes
Plant Physiology,
August 1, 2008;
147(4):
1469 - 1481.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Nielsen, A. Y. Cheung, and T. Ueda
The Regulatory RAB and ARF GTPases for Vesicular Trafficking
Plant Physiology,
August 1, 2008;
147(4):
1516 - 1526.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Ma, M. Pooler, and R. Griesbach
Ratio of Myc and Myb Transcription Factors Regulates Anthocyanin Production in Orchid Flowers
J. Amer. Soc. Hort. Sci.,
January 1, 2008;
133(1):
133 - 138.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. J. Davis, Y. J. Im, J. S. Dubin, K. B. Tomer, and W. F. Boss
Arabidopsis Phosphatidylinositol Phosphate Kinase 1 Binds F-actin and Recruits Phosphatidylinositol 4-Kinase beta1 to the Actin Cytoskeleton
J. Biol. Chem.,
May 11, 2007;
282(19):
14121 - 14131.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G.-J. Lee, H. Kim, H. Kang, M. Jang, D. W. Lee, S. Lee, and I. Hwang
EpsinR2 Interacts with Clathrin, Adaptor Protein-3, AtVTI12, and Phosphatidylinositol-3-Phosphate. Implications for EpsinR2 Function in Protein Trafficking in Plant Cells
Plant Physiology,
April 1, 2007;
143(4):
1561 - 1575.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. K. Min, S. J. Kim, Y. Miao, J. Shin, L. Jiang, and I. Hwang
Overexpression of Arabidopsis AGD7 Causes Relocation of Golgi-Localized Proteins to the Endoplasmic Reticulum and Inhibits Protein Trafficking in Plant Cells
Plant Physiology,
April 1, 2007;
143(4):
1601 - 1614.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Moreau, F. Brandizzi, S. Hanton, L. Chatre, S. Melser, C. Hawes, and B. Satiat-Jeunemaitre
The plant ER-Golgi interface: a highly structured and dynamic membrane complex
J. Exp. Bot.,
January 1, 2007;
58(1):
49 - 64.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. P. Downes, S. A. Saracco, S. S. Lee, D. N. Crowell, and R. D. Vierstra
MUBs, a Family of Ubiquitin-fold Proteins That Are Plasma Membrane-anchored by Prenylation
J. Biol. Chem.,
September 15, 2006;
281(37):
27145 - 27157.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Song, M. H. Lee, G.-J. Lee, C. M. Yoo, and I. Hwang
Arabidopsis EPSIN1 Plays an Important Role in Vacuolar Trafficking of Soluble Cargo Proteins in Plant Cells via Interactions with Clathrin, AP-1, VTI11, and VSR1
PLANT CELL,
September 1, 2006;
18(9):
2258 - 2274.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X.-F. Song, C.-Y. Yang, J. Liu, and W.-C. Yang
RPA, a Class II ARFGAP Protein, Activates ARF1 and U5 and Plays a Role in Root Hair Development in Arabidopsis
Plant Physiology,
July 1, 2006;
141(3):
966 - 976.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. L. Hanton, L. Renna, L. E. Bortolotti, L. Chatre, G. Stefano, and F. Brandizzi
Diacidic Motifs Influence the Export of Transmembrane Proteins from the Endoplasmic Reticulum in Plant Cells
PLANT CELL,
November 1, 2005;
17(11):
3081 - 3093.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Chatre, F. Brandizzi, A. Hocquellet, C. Hawes, and P. Moreau
Sec22 and Memb11 Are v-SNAREs of the Anterograde Endoplasmic Reticulum-Golgi Pathway in Tobacco Leaf Epidermal Cells
Plant Physiology,
November 1, 2005;
139(3):
1244 - 1254.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Park, D. Lee, G.-J. Lee, and I. Hwang
AtRMR1 functions as a cargo receptor for protein trafficking to the protein storage vacuole
J. Cell Biol.,
August 29, 2005;
170(5):
757 - 767.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. K. Gebbie, J. E. Burn, C. H. Hocart, and R. E. Williamson
Genes encoding ADP-ribosylation factors in Arabidopsis thaliana L. Heyn.; genome analysis and antisense suppression
J. Exp. Bot.,
April 1, 2005;
56(414):
1079 - 1091.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Kim, M. Park, S. J. Kim, and I. Hwang
Actin Filaments Play a Critical Role in Vacuolar Trafficking at the Golgi Complex in Plant Cells
PLANT CELL,
March 1, 2005;
17(3):
888 - 902.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Xu and B. Scheres
Dissection of Arabidopsis ADP-RIBOSYLATION FACTOR 1 Function in Epidermal Cell Polarity
PLANT CELL,
February 1, 2005;
17(2):
525 - 536.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Alexandersson, G. Saalbach, C. Larsson, and P. Kjellbom
Arabidopsis Plasma Membrane Proteomics Identifies Components of Transport, Signal Transduction and Membrane Trafficking
Plant Cell Physiol.,
November 15, 2004;
45(11):
1543 - 1556.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G.-J. Lee, E. J. Sohn, M. H. Lee, and I. Hwang
The Arabidopsis Rab5 Homologs Rha1 and Ara7 Localize to the Prevacuolar Compartment
Plant Cell Physiol.,
September 15, 2004;
45(9):
1211 - 1220.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Marmagne, M.-A. Rouet, M. Ferro, N. Rolland, C. Alcon, J. Joyard, J. Garin, H. Barbier-Brygoo, and G. Ephritikhine
Identification of New Intrinsic Proteins in Arabidopsis Plasma Membrane Proteome
Mol. Cell. Proteomics,
July 1, 2004;
3(7):
675 - 691.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. L.P. daSilva, E. L. Snapp, J. Denecke, J. Lippincott-Schwartz, C. Hawes, and F. Brandizzi
Endoplasmic Reticulum Export Sites and Golgi Bodies Behave as Single Mobile Secretory Units in Plant Cells
PLANT CELL,
July 1, 2004;
16(7):
1753 - 1771.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Bolte, S. Brown, and B. Satiat-Jeunemaitre
The N-myristoylated Rab-GTPase m-Rabmc is involved in post-Golgi trafficking events to the lytic vacuole in plant cells
J. Cell Sci.,
February 22, 2004;
117(6):
943 - 954.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Park, S. J. Kim, A. Vitale, and I. Hwang
Identification of the Protein Storage Vacuole and Protein Targeting to the Vacuole in Leaf Cells of Three Plant Species
Plant Physiology,
February 1, 2004;
134(2):
625 - 639.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Boisson, C. Giglione, and T. Meinnel
Unexpected Protein Families Including Cell Defense Components Feature in the N-Myristoylome of a Higher Eukaryote
J. Biol. Chem.,
October 31, 2003;
278(44):
43418 - 43429.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. J. Sohn, E. S. Kim, M. Zhao, S. J. Kim, H. Kim, Y.-W. Kim, Y. J. Lee, S. Hillmer, U. Sohn, L. Jiang, et al.
Rha1, an Arabidopsis Rab5 Homolog, Plays a Critical Role in the Vacuolar Trafficking of Soluble Cargo Proteins
PLANT CELL,
May 1, 2003;
15(5):
1057 - 1070.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
P. Pimpl, S. L. Hanton, J. P. Taylor, L. L. Pinto-daSilva, and J. Denecke
The GTPase ARF1p Controls the Sequence-Specific Vacuolar Sorting Route to the Lytic Vacuole
PLANT CELL,
May 1, 2003;
15(5):
1242 - 1256.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
A. Nebenfuhr, C. Ritzenthaler, and D. G. Robinson
Brefeldin A: Deciphering an Enigmatic Inhibitor of Secretion
Plant Physiology,
November 1, 2002;
130(3):
1102 - 1108.
[Full Text]
[PDF]
|
 |
|
|
|