|
|
||||||||
First published online October 15, 2002; 10.1104/pp.011890
Plant Physiol, November 2002, Vol. 130, pp. 1254-1262
Variation in Its C-Terminal Amino Acids Determines Whether
Endo-
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| |
ABSTRACT |
|---|
|
|
|---|
Endo-
-mannanase cDNAs were cloned and characterized from
ripening tomato (Lycopersicon esculentum Mill. cv Trust)
fruit, which produces an active enzyme, and from the tomato cv Walter, which produces an inactive enzyme. There is a two-nucleotide deletion in the gene from tomato cv Walter, which results in a frame shift and
the deletion of four amino acids at the C terminus of the full-length
protein. Other cultivars that produce either active or inactive enzyme
show the same absence or presence of the two-nucleotide deletion. The
endo-
-mannanase enzyme protein was purified and characterized from
ripe fruit to ensure that cDNA codes for the enzyme from fruit.
Immunoblot analysis demonstrated that non-ripening mutants, which also
fail to exhibit endo-
-mannanase activity, do so because they fail to
express the protein. In a two-way genetic cross between tomato cvs
Walter and Trust, all F1 progeny from both crosses produced
fruit with active enzyme, suggesting that this form is dominant and
homozygous in tomato cv Trust. Self-pollination of a plant from the
heterozygous F1 generation yielded F2 plants that bear fruit with and without active enzyme at a ratio appropriate to Mendelian genetic segregation of alleles. Heterologous expression of
the two endo-
-mannanase genes in Escherichia coli
resulted in active enzyme being produced from cultures containing the
tomato cv Trust gene and inactive enzyme being produced from those
containing the tomato cv Walter gene. Site-directed mutagenesis was
used to establish key elements in the C terminus of the
endo-
-mannanase protein that are essential for full enzyme activity.
| |
INTRODUCTION |
|---|
|
|
|---|
In addition to helping produce a
fruit suitable for consumption, ripening-associated softening in tomato
(Lycopersicon esculentum Mill.) fruit leads to an increased
susceptibility to physical damage during harvest and/or pathogen attack
during shipping and storage. This results in crop losses that are
costly to producers and consumers alike. Hence, there has been a great
deal of research conducted to elucidate the mechanisms involved in
ripening-associated softening. Softening in fleshy fruits is caused by
the dissolution of pectin in the middle lamella, which reduces cell
adhesion (Wakabayashi, 2000
), and also by the breakdown
of the cell walls themselves. Cell wall breakdown is caused by the
concerted action of a number of proteins/enzymes including, but not
limited to, expansins, which dissociate the xyloglucan/cellulose
network (Brummell et al., 1999
); pectin methylesterase,
which cleaves methylester groups from pectic polysaccharides;
polygalacturonase, which hydrolyzes pectin; and
-galactosidase,
which removes the galactan side-chains from rhamnogalacturonan I
(Brummell and Harpster, 2001
).
Glucomannans, galactoglucomannans, and galactomannans are
polysaccharides present in type I cell walls, which are thought to
cross-link cellulose microfibrils in the same manner as xyloglucans, although to a lesser degree (Carpita and Gibeaut, 1993
).
Of these three types of mannans, the cell walls of tomato are known to contain glucomannans (Tong and Gross, 1988
;
Seymour et al., 1990
). Endo-
-mannanase is capable of
hydrolyzing these polysaccharides, and the activity of this enzyme
increases in the outer tissues of tomato fruits during ripening
(Bewley et al., 2000
). The enzyme is also active in ripe
fruits of a number of other species such as watermelon (Citrullis
vulgaris), cantaloupe (Cucumis melo), and peach and
nectarine (Prunus persica) (Bourgault et al.,
2001
). It has been suggested that endo-
-mannanase plays a
role in ripening-associated softening (Pressey, 1989
;
Bewley et al., 2000
), a hypothesis supported to some
degree by the fact that the fruits of several non-ripening tomato
mutants that fail to soften exhibit very low or no enzyme activity.
However, fruit of the tomato cv Walter, which exhibit no
endo-
-mannanase activity during ripening, appear to ripen normally,
with only a minor difference in texture in fully ripened fruit
(Bewley et al., 2000
).
The gene for endo-
-mannanase is present in tomato cv Walter, it is
transcribed in the fruit, the message is translated, and the resultant
full-length protein is localized in the cell wall, as in cultivars
producing active enzyme (Banik et al., 2001
). There are
no previous reports of permanently inactive hydrolases being produced
in plant tissues; the fact that this occurs in tomato cv Walter fruit
is intriguing. There are several examples where there is temporary
inactivity of enzymes after their synthesis, for example the
Suc-cleaving enzyme invertase is present in the vacuole and cell wall
during tomato fruit development and ripening but is only active during
the latter process. The increase in activity during ripening is
attributable to posttranslational regulation, which increases the
activation state of invertase rather than the amount of enzyme present.
Activation appears to be achieved by alterations in the amount of a
protein inhibitor thought to control this enzyme (Husain et al.,
2001
). By mixing fruit extracts from cultivars producing active
and inactive endo-
-mannanase, it is clear that an inhibitor is not
the cause of enzyme inactivity in tomato cv Walter (Banik et
al., 2001
). The purpose of this study was to determine why the
enzyme produced in the fruit of tomato cv Walter is never active.
To our knowledge, there are no previous reports of the purification,
cloning, and characterization of endo-
-mannanase from tomato fruit.
We have characterized the genes for endo-
-mannanase from cultivars
producing active and inactive enzyme and have demonstrated that there
is a two-nucleotide deletion in the gene from cultivars producing
inactive enzyme. This mutation causes a frame-shift, which results in
an altered, truncated C terminus of the enzyme in comparison with the
active form. We show, by crossing two cultivars that carry either the
active or inactive form of the gene and by heterologous expression,
that this mutation is the only cause for the inactivity of the enzyme.
| |
RESULTS |
|---|
|
|
|---|
Immunoblot Analysis of Non-Ripening Mutants of Tomato
The fruits of several non-ripening mutants of tomato do not
exhibit endo-
-mannanase activity during ripening, whereas their corresponding wild-type cultivars produce active enzyme (Bewley et al., 2000
). Immunoblot analysis (Fig.
1) shows that whereas endo-
-mannanase
protein is produced in the fruits of tomato cvs Trust, Ailsa Craig wild
type (wt), and Rutgers wt, which exhibit enzyme activity, the tomato cv
Ailsa Craig ripening inhibitor (rin),
non-ripening (nor) and tomato cv Rutgers
alcobaca (alc), Never ripe
(Nr) non-ripening mutants, which lack activity, do not
express the protein. Thus, the lack of activity in the non-ripening mutants is attributable to a lack of enzyme production. However, fruits
of the tomato cv Walter also do not produce active endo-
-mannanase but nevertheless produce the appropriate mRNA transcripts (Banik et al., 2001
) and endo-
-mannanase protein during ripening
(Fig. 1). Why the fruits of this cultivar produce an enzyme that is inactive is investigated here.
|
Purification, Cloning, and Characterization of
Endo-
-Mannanase from Tomato Fruit
Endo-
-mannanase was purified to homogeneity from the outer
regions of ripe fruit of the tomato cv Trust. The apparent molecular mass of the enzyme, 40 kD, is in agreement with the size of the protein
detected on western blots (Fig. 1). The first 13 N-terminal amino acid
residues of the mature, active enzyme were determined to be FSNNNFVYTDGTH.
The cDNAs encoding endo-
-mannanase from tomato fruits of the tomato
cvs Trust and Walter were obtained by reverse transcriptase-PCR and
named L. esculentum endo-
-mannanase 4 (LeMAN4a), active enzyme from tomato cv Trust fruit (GenBank
accession no. AY046588) and L. esculentum endo-
-mannanase
4 (LeMAN4i), inactive enzyme from tomato cv Walter fruit
(GenBank accession no. AY046589).
The 1,420-bp cDNA from the tomato cv Trust contains an open reading
frame of 399 amino acids including a signal peptide of 26 amino acids
(Fig. 2, underlined). The 13 amino acid
N-terminal sequence determined by peptide sequencing begins at amino
acid 27. Therefore, the mature enzyme from the tomato cv Trust contains 373 amino acids, which results in a protein with an estimated molecular
mass of 42,398 D and a predicted pI of 8.75. These data are in close
agreement with experimentally determined values reported earlier
(Bewley et al., 2000
; Bourgault et al.,
2001
). The potential N-glycosylation site (Fig. 2,
double underlined) in both LeMAN1 (Bewley et al.,
1997
) and LeMAN2 (Nonogaki et al.,
2000
) is absent from LeMAN4a, but the putative
catalytic sites Glu-204 and Glu-318 (Fig. 2, asterisks) are conserved
(Nonogaki et al., 2000
; Hogg et al.,
2001
). The Trp at position 360 is also conserved and is thought
to play a critical role in substrate binding (Hogg et al.,
2001
). There is a 46% identity and 67% similarity in amino acid sequence of the mature protein between LeMAN4a and
LeMAN1. A comparison of LeMAN4a with
LeMAN2 shows that the identity is 51% whereas the
similarity is 70%. This increased similarity can be attributed largely
to a 28 amino acid segment, starting at residue 124, which is present
in both LeMAN4a and LeMAN2 but not in
LeMAN1. It is interesting that within this 28 amino acid
segment, the homology between LeMAN4a and LeMAN2
is quite high (61% identity and 75% similarity) particularly because
LeMAN2 is specifically expressed in seeds and
LeMAN4 in fruit. As noted by Nonogaki et al.
(2000)
this region also shows a relatively high homology
with that in fungal mannanases. In a simple protein-protein BLAST
search of the GenBank database, the closest existing match (62%
identity and 78% similarity) to LeMAN4a is an
endo-
-mannanase cloned from germinated coffee (Coffea
arabica) seeds (GenBank accession no. AJ278996; Marraccini
et al., 2001
).
|
The cDNA sequence for endo-
-mannanase from tomato cv Walter is
identical to that of the tomato cv Trust enzyme except for a
two-nucleotide deletion starting at bp 1,209 of the full-length transcript (Fig. 3). This deletion causes
a frame shift and an altered C-terminal amino acid sequence compared
with that of the tomato cv Trust enzyme. We then sought to determine
whether this alteration is responsible for the lack of activity in
tomato cv Walter.
|
The tomato cvs Manalucie, Manapal, Indian River, and Homestead are
ancestral lines used in breeding to create the tomato cv Walter (Dr.
J.W. Scott, University of Florida, personal communication). Ripe fruit
tissue from each of these cultivars was extracted and assayed for
endo-
-mannanase, and none exhibits any activity. The genomic DNA for
endo-
-mannanase was cloned from tomato cv Indian River and sequence
data shows that it has the same two-nucleotide deletion in the gene
encoding LeMAN4 as that from tomato cv Walter. Another
unrelated cultivar, tomato cv Heinz 1439, which also produces inactive
enzyme (Banik et al., 2001
), has the same two-nucleotide deletion. In contrast, all cultivars that produce active
endo-
-mannanase
tomato cvs Rutgers wt, Ailsa Craig wt, and
Glamour
have the same LeMAN4 nucleotide sequence encoding
the C terminus as tomato cv Trust. These data led us to test whether
the two-nucleotide deletion at bp 1,209 in the gene for
endo-
-mannanase is responsible for the lack of activity in cultivars
containing this mutation.
Endo-
-Mannanase Genes in Crosses of Tomato cvs Walter and
Trust
After a two-way cross of the tomato cvs Trust and Walter, all
F1 plants produced fruit that exhibit
endo-
-mannanase activity regardless of which was the maternal
parent. Thus, the gene for the active form of the enzyme is dominant.
Genomic DNA was extracted from leaves of the F1
plants and used in genetic screening tests to confirm the presence of
both LeMAN4a from tomato cv Trust and LeMAN4i
from tomato cv Walter. Using primers specific for each form of the
endo-
-mannanase gene, PCR was performed to confirm that plants in
the F1 generation are heterozygous (Fig.
4). Using primers specific for the active
enzyme gene, LeMAN4a (Fig. 4A, TP), plasmid DNA containing
this gene yielded a band of 351 bp as expected. There were no bands in
the absence of template, nor in the presence of tomato cv Walter
genomic DNA. A band was obtained when tomato cv Trust genomic DNA was
used as template, as expected. All of the F1
progeny derived from tomato cv Trust maternal plants (e.g. T3 and T4)
and tomato cv Walter maternal plants (e.g. W10 and W12) contain the
LeMAN4a gene. Using PCR with primers specific for the gene
for the inactive enzyme, LeMAN4i (Fig. 4B), no bands were
obtained using plasmid DNA including LeMAN4a, control
without template, nor tomato cv Trust genomic DNA as template. A band was obtained using tomato cv Walter genomic DNA as template. All of the
F1 progeny derived from tomato cv Trust maternal
plants (T3 and T4) and tomato cv Walter maternal plants (W10 and W12) contain the LeMAN4i gene. These results confirm that all of
the F1 progeny examined were heterozygous crosses
of the tomato cvs Trust and Walter and they all produced fruit with
active endo-
-mannanase.
|
After self-pollination of flowers on a heterozygous plant of the tomato
cv Walter maternal F1 group, seeds were collected from the mature fruit. These fruit were expected to exhibit segregation in a ratio of approximately 3:1 with respect to active:inactive endo-
-mannanase alleles. Of 28 F2 plants
tested, five did not exhibit activity because they were homozygous
recessive, carrying two copies of the inactive form of the gene.
Therefore, the resultant ratio of 23:5 or 4.6:1 is somewhat higher than
expected under ideal conditions but within statistical error for a
sample size of 28. Using PCR with the same two sets of primers that
were employed in screening of the F1 generation,
plants of the F2 generation were screened for the
presence of LeMAN4a and LeMAN4i (Fig.
5). Primers specific for
LeMAN4a detected at least one copy of the gene for the
active form of the enzyme in 23 of 28 plants (Fig. 5A), as in the
tomato cv Trust parent genomic DNA. Primers specific for
LeMAN4i detected at least one copy of the gene coding for the inactive form of the enzyme in 17 of the 28 F2 plants (Fig. 5B), but not in tomato cv Trust
parent genomic DNA. Therefore, it is evident that plants 9, 15 to 22, 27, and 28 are all homozygous with respect to the LeMAN4a
form of the gene; whereas plants 2, 10, 13, 24, and 25 are homozygous
with respect to the LeMAN4i form. Fruits from the latter set
of plants did not exhibit endo-
-mannanase activity, whereas all
others, whether heterozygous (plants 1, 3-8, 11, 12, 14, 23, and 26)
or homozygous with respect to LeMAN4a, did exhibit
activity.
|
Expression of Recombinant Proteins in Escherichia coli
Endo-
-mannanase cDNAs from both tomato cv Trust and tomato cv
Walter were cloned into the pMAL protein expression vector, expressed
in E. coli, induced with
isopropylthio-
-D-galactoside (IPTG) and the
protein products in crude cell lysates separated by SDS-PAGE (Fig.
6A). An intense band of approximately 80 kD was detectable in cultures expressing both LeMAN4a and
LeMAN4i. This is the approximate molecular mass expected of
the endo-
-mannanase/maltose-binding protein (MBP) fusion protein;
this band does not appear in the pMAL vector control lane.
|
Using an antibody raised against the M1 isoform of endo-
-mannanase
from tomato seed (Nonogaki et al., 1995
), the
MBP/endo-
-mannanase fusion protein was detected by western blotting
(Fig. 6B). The antibody bound to a single band in the lane containing
proteins from uninduced cells and in that of soluble proteins from
induced cells. The antibody bound to multiple bands in the lanes
containing proteins from crude cell lysates of induced cells, likely
because of the presence of partially synthesized and/or degraded
products. Thus, there was some expression of the fusion protein before
the addition of IPTG, but this increased greatly after induction. The
molecular mass of the single band observed in the western blot of the
uninduced and soluble proteins was the same as the intensely stained
fusion protein band in the Coomassie Blue-stained SDS-PAGE gel in
Figure 6A.
Soluble extracts from E. coli cultures containing only the
pMAL expression vector did not exhibit endo-
-mannanase activity when
subjected to the enzyme-specific gel-diffusion assay (Fig. 6C). Those
from the cultures containing the MBP-LeMAN4a fusion protein
did display activity, whereas those from cultures containing MBP-LeMAN4i did not.
Site-Directed Mutagenesis at the C Terminus of LeMAN4: Effects on Enzyme Activity
The Quik Change Site-Directed Mutagenesis System (Stratagene, La
Jolla, CA) was used to create mutations at the carboxy terminus of the
E. coli-expressed MBP/endo-
-mannanase fusion protein as detailed in Table I. These changes were
made to determine specifically which amino acid or amino acids are key
for full enzyme activity in the LeMAN4a form of the protein.
The relative changes in activity in the various constructs show that
there are a number of amino acids in the C terminus that are essential
for full enzyme function (Fig. 7). The
activities of the non-mutated tomato cv Trust and tomato cv Walter
clones are also included on the graph for comparison.
|
|
Construct 1 (Fig. 7), MBP-LeMAN4i, which has the same C
terminus as endo-
-mannanase from tomato cv Walter, exhibits no
enzyme activity as expected, whereas construct 7, MBP-LeMAN4a, which has the same C terminus as
endo-
-mannanase from tomato cv Trust, has very high activity.
Construct 2 is identical to LeMAN4i except that Ala-394 was
changed to Arg, which is present at this position in
LeMAN4a; this change resulted in a small increase in
activity compared with construct 1. This construct can also be
considered to be LeMAN4a (construct 7) with the four
C-terminal amino acids (SKLS) removed. From this viewpoint, activity
was reduced to less than 10% of full activity of LeMAN4a.
Construct 3 is identical to LeMAN4i, construct 1, except
that Ser-396, which is present in the LeMAN4a form of the
protein, has been added. This change also resulted in an increase in
activity in comparison with LeMAN4i. When both of these
changes were made together (construct 4), an increase in activity was
observed that was approximately additive of those for the individual
changes (constructs 2 and 3). Construct 4 can be considered as
LeMAN4a (construct 7) with the three C-terminal amino acids
(KLS) removed, in which activity was reduced to about 30% of full
activity. Construct 5 is equivalent to LeMAN4a (construct 7)
with the two C-terminal amino acids (LS) removed; the resultant enzyme
had only 17% of the activity of LeMAN4a. When the Leu at position 398 was restored, as in construct 6, full-enzyme activity was
reestablished. Thus, removing the C-terminal Ser had no effect on
enzyme activity. To investigate the importance of Arg-394, which is
changed to an Ala in LeMAN4i, this same change was made in
the otherwise full-length LeMAN4a enzyme. This resulted in only a small reduction in activity (construct 8) in comparison with
LeMAN4a (construct 7).
| |
DISCUSSION |
|---|
|
|
|---|
The activity of the enzyme endo-
-mannanase increases in the
outer tissues of tomato fruits during ripening (Bewley et al., 2000
). The pI of the enzyme expressed in fruit (Pressey,
1989
; Bourgault et al., 2001
) is much higher
than that of isozymes expressed in the seed before (LeMAN2;
Nonogaki et al., 2000
) and after (LeMAN1; Bewley et al., 1997
) germination. Furthermore, the
enzyme expressed in the fruit is tightly associated with the cell walls
(Bewley et al., 2000
; Bourgault et al.,
2001
), whereas the seed isozymes are readily soluble in
low-salt buffer. Therefore, the enzyme expressed in the fruit is
distinct from other characterized endo-
-mannanases in tomato, and as
demonstrated here by N-terminal sequence analysis of the purified
protein and by cDNA cloning, there is a specific gene for the enzyme
expressed in the fruit.
Endo-
-mannanase may play a role in cell wall breakdown that leads to
ripening-associated softening of fruit tissue (Pressey, 1989
; Fischer and Bennett, 1991
; Bewley
et al., 2000
). Although this relationship has not been
established, a number of non-ripening mutants that exhibit reduced
softening are also lacking in, or contain very low endo-
-mannanase
activity (Bewley et al., 2000
). Western-blot analysis
shows that the enzyme protein for endo-
-mannanase is not expressed
in the fruit of the non-ripening mutants tomato cvs Ailsa Craig
rin, nor, Rutgers Nr, and
alc, which are deficient in endo-
-mannanase activity. The
reason for the lack of expression is likely to be different for each of
these non-ripening mutants because the maturing process of each is
defective in a unique way. For example, non-ripening in the
Nr mutant is caused by a defect in a receptor for ethylene
(Wilkinson et al., 1995
), which results in an
interruption in the signal transduction pathway that normally leads to
the synthesis of transcription factors, which initiate the expression
of ripening-associated genes. The rin mutant contains a
defect in the expression of a MADS box protein, which is a
transcription factor involved in the nonhormonal or developmental
regulation of ripening-associated genes (Vrebalov et al.,
2002
). In each case, the mutation results in a lack of expression of the endo-
-mannanase protein. This is not so in tomato
cv Walter, because the inactive enzyme protein is present in extracts
from the fruit of this cultivar. In tomato cv Walter, the gene encoding
endo-
-mannanase is present, it is transcribed in the fruit, the mRNA
is translated, and the protein is properly localized to the cell wall
as in cultivars expressing active enzyme (Banik et al.,
2001
). Therefore, the lack of endo-
-mannanase activity in
tomato cv Walter is likely attributable to a defect, or mutation in the
enzyme itself. To examine this possibility, the active enzyme was
purified from the outer tissues of tomato cv Trust fruit and
characterized, and the cDNA (LeMAN4) was cloned from the
fruit of cultivars producing active and inactive forms of the enzyme.
The deduced amino acid sequence of the protein encoded by
LeMAN4 has a high homology with other endo-
-mannanases
from tomato seed, LeMAN1 (Bewley et al.,
1997
) and LeMAN2 (Nonogaki et al., 2000
) and an even higher homology with the enzyme expressed in germinated coffee seeds (Marraccini et al., 2001
). The
nucleotide sequences of the LeMAN4 cDNAs from tomato cv
Trust and tomato cv Walter are identical with the exception of a
two-nucleotide deletion starting at bp 1,209 in the gene from tomato cv
Walter, which causes a frame-shift resulting in a truncated C terminus in the enzyme. Thus, the LeMAN4a active endo-
-mannanase
is longer by four amino acids, Ser-Lys-Leu-Ser, and the Arg at position 394 is an Ala in LeMAN4i, the inactive form of the enzyme.
Two other cultivars of tomato, cvs Indian River and Heinz 1439, which do not exhibit endo-
-mannanase activity in their fruit, contain the LeMAN4i form of the gene, whereas all cultivars tested
that produce active enzyme contain the LeMAN4a form of the
gene. To determine whether the two-nucleotide deletion is the sole
cause of the lack of activity in LeMAN4i, two strategies
were employed. The first strategy was to cross the tomato cvs Trust and
Walter, to test the fruit from the F1 and
F2 generations for endo-
-mannanase activity,
and to determine which form of the gene the progeny carry. The second
strategy was to express the two cDNAs as fusion proteins in E. coli and to observe differences in activity.
Analysis of the genotypes and endo-
-mannanase activity in the fruits
of the F1 and F2 progeny of
the crosses between the tomato cv Trust and tomato cv Walter confirmed
that the two-base deletion in LeMAN4i was solely responsible
for the lack of activity in fruits from plants carrying only that form
of the gene. In addition, when LeMAN4a and
LeMAN4i were cloned into the pMAL fusion protein vector and
expressed in E. coli, both constructs produced a fusion
protein that was recognized by the antibody specific for
endo-
-mannanase in western-blot analysis. However, only the construct containing LeMAN4a produced a protein that
exhibited enzyme activity when analyzed by the gel-diffusion assay.
This not only confirms that the cDNA is the gene for
endo-
-mannanase, but also that the difference in the C termini
encoded by LeMAN4a and LeMAN4i is the reason for
the lack of activity in the LeMAN4i form of the enzyme.
Mutations in the C-terminal region of the MBP-LeMAN4 fusion
protein resulted in products with varying amounts of endo-
-mannanase activity. When sequentially replacing in LeMAN4i (in which
Ala-394 has been changed to Arg-394 as in LeMAN4a) the four
amino acids present at the C terminus of LeMAN4a, it is
obvious that Leu-398 is very important for full enzyme activity. Upon
examination of the amino acid alignment of other endo-
-mannanase
sequences from tomato, it is notable that Leu also appears in this
location in LeMAN1 (Bewley et al., 1997
) and
LeMAN2 (Nonogaki et al., 2000
). In these
seed-specific isozymes, Leu is not the penultimate amino acid as in
LeMAN4a, but it is in ManB, from coffee seed
(Marraccini et al., 2001
), which shows higher overall
homology with LeMAN4a than do the tomato seed isozymes. This
Leu is also conserved in an endo-
-mannanase cDNA cloned from
germinated lettuce (Lactuca sativa) seed (J. Li and
J.D. Bewley, unpublished data). Thus, of the C-terminal four amino
acids in the enzyme, Leu-398 is key for full enzyme activity, perhaps
for proper protein folding to allow for substrate binding and/or
nucleophilic attack.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Plant Material
All tomato (Lycopersicon esculentum Mill.) plants
were pot-grown in soil in the greenhouse of the Department of Botany,
University of Guelph, under natural and artificial light conditions.
Plants were fertilized once a week with 20-20-20 fertilizer including micronutrients, at a concentration of 250 mg L
1. Flowers
were self-pollinated except where specified in genetic cross
experiments. Fruits were collected at the stages of ripening detailed
previously (Bewley et al., 2000
). Seeds of tomato cvs Ailsa Craig wt, rin, nor; tomato cvs
Rutgers wt, alc, Nr; and tomato cv Walter
wt were obtained from The C.M. Rick Tomato Genetics Resource Center,
University of California (Davis). Seeds of the tomato cv Trust were
obtained from The Greenhouse Country Market (Brampton, ON, Canada).
Seeds of tomato cv Heinz 1439 were kindly supplied by Dr. K. Peter
Pauls (Department of Plant Agriculture, University of Guelph), and
those of tomato cvs Manalucie, Indian River, Manapal and Homestead 24 by Dr. J.W. Scott (Institute of Food and Agricultural Sciences,
University of Florida, Bradenton).
Enzyme Extraction and Immunoblot Analysis
Combined exocarp and outer pericarp tissue was removed to a
depth of approximately 2 mm from ripe tomatoes of the following cultivars: Trust, Walter, Rutgers wt, Nr,
alc, and Ailsa Craig wt, rin,
nor. For the non-ripening mutants, "ripe" was
considered the maximum stage of ripening reached before any visible
signs of spoilage. Tissue was pulverized to a fine powder in the
presence of liquid nitrogen and washed sea sand. McIlvaine
(1921)
buffer, pH 5 (0.2 M Na2HPO4
and 0.1 M citric acid at a 1:1 ratio), plus 0.5 M NaCl was added in a ratio of five parts buffer to one
part tissue (v/w) and followed by more grinding, and centrifugation at
14,000g for 5 min at 4°C to obtain the supernatant.
This was analyzed for endo-
-mannanase activity using an enhanced
gel-diffusion assay (Bourgault and Bewley, 2002
).
Protein concentration was determined using the BCA Protein Assay
Reagent (Pierce, Rockford, IL), and for SDS-PAGE, 10 µg total protein
was loaded per lane onto a 12% (w/v) polyacrylamide gel.
Electrophoretically separated proteins were transferred to a
nitrocellulose membrane (Towbin et al., 1979
), which was
washed, blocked with 5% (w/v) skim milk, and challenged with a
104-fold dilution of an anti-endo-
-mannanase antibody
raised in rabbits against the M1 isoform of the enzyme from germinated
tomato seed (Nonogaki et al., 1995
). Bands were made
visible on x-ray film using a goat anti-rabbit HRP-conjugated antibody
and the enhanced chemiluminescence method (Amersham Biosciences AB, Uppsala).
Purification and Characterization of Endo-
- Mannanase from
Tomato Fruit Tissue
Fifty grams of combined exocarp and outer pericarp tissue (to a
depth of approximately 2 mm) from ripe tomatoes was ground to a fine
powder as above. The tissue was first extracted with 250 mL of ice-cold
0.1 M HEPES-NaOH, pH 8.0, with centrifugation at
10,000g for 10 min. This buffer does not extract
endo-
-mannanase from the tissue but does remove most of the soluble
protein (Bourgault et al., 2001
). The pellet was
resuspended in 100 mL of McIlvaine buffer, pH 5.0, plus 100 mM NaCl. After a 10-min incubation on ice with vigorous
agitation, the suspension was centrifuged at 10,000g for
10 min, the supernatant was decanted, and a 40-mL aliquot was
precipitated successively on ice with ammonium sulfate. After
dissolving each of the pellets in 1.5 mL of McIlvaine buffer, pH 5, most of the activity was present in the 40% to 60% fraction. The
entire 1.5 mL was concentrated to 200 µL using a 50-kD molecular mass
cut-off membrane (Amicon, Beverly, MA). The concentrate was applied
to the acidic end of an 8 to 10 pH isoelectric focusing horizontal slab
gel (Multiphor 2117, LKB, Uppsala) for separation at 2,000 V for 90 min, and 1-cm strips spanning the length of the gel were excised and
extracted using water. All of the endo-
-mannanase activity was in
the strip at pH 9.1, and this ran as a single band on an SDS-PAGE gel.
A portion of the pure extract (80 µL) was subjected to 12%
(w/v) polyacrylamide SDS-PAGE and transferred to a polyvinylidene
difluoride membrane, and N-terminal peptide sequencing was conducted
(Protein Service Laboratory, University of British Columbia, Vancouver).
Preparation of RNA, Reverse Transcriptase-PCR, and Subcloning of LeMAN4 cDNAs
One gram of combined exocarp/outer pericarp tissue from stage 4 to 5 fruits of tomato cvs Walter and Trust was pulverized in liquid
nitrogen and extracted with 10 mL of Tri-Reagent
(Sigma-Aldrich, St. Louis). Poly(A+) RNA was obtained using
the PolyAT-Tract mRNA Isolation System IV (Promega, Madison, WI).
First-strand cDNA synthesis was carried out using Thermoscript RT
(Invitrogen, Carlsbad, CA) reverse transcriptase with an
oligo(dT)17-adaptor primer
(GATCCAGATCTCGAGAAGCT17). Using an aliquot of the cDNA mix
as template, PCR was then performed with the
oligo(dT)17-adaptor primer and an oligonucleotide (508-fwd, 5'-ATGGCATGGGAACTCATGAATGAGCCT) based on a highly conserved sequence in
other endo-
-mannanase genes from tomato (LeMAN1,
LeMAN2, and LeMAN3; GenBank accession
nos. AF017144, AF184238, and AF290893). Using Taq DNA
polymerase (MBI Fermentas, Burlington, ON, Canada) at 2.5 mM MgCl2, the thermal cycle conditions were
94°C for 5 min followed by 35 cycles of 94°C for 45 s, 42°C
for 1 min, and 72°C for 1 min 20 s. The final cycle was followed
by 5 min at 72°C. The PCR mix was separated on a 1% (w/v) agarose
gel, and a predominant band of approximately 800 bp was excised
and extracted using the GFX Gel-band Purification Kit (Pharmacia AB,
Uppsala). The 508-fwd primer was then used to sequence the purified PCR fragment. An open reading frame with a high (45%-55%) identity, at
the amino acid level, to the other mannanase genes from tomato was
obtained. Using this sequence, a BLAST search was conducted to find an
homologous expressed sequence tag clone. One (GenBank accession no.
AW221434) 5' of the 508-fwd primer region was used to design a primer
at the extreme 5' end of the gene (5prime1, 5'-GGCTAGCTCCTTTATGCATTATTA) with a NheI restriction
site at its 5' end to facilitate subsequent cloning into a vector.
Using Platinum Pfx DNA Polymerase (Invitrogen) and an aliquot of the
aforementioned cDNA mixes prepared from tomato cv Trust and tomato cv
Walter mRNA, PCR was performed on both templates using 5prime1 and
oligo(dT) adaptor as forward and reverse primers respectively at a
MgSO4 concentration of 1.5 mM. The
thermal-cycle conditions were 94°C for 2 min 20 s, followed by
35 cycles of: 94°C for 30 s, 51°C for 30 s, and 68°C
for 1 min 20 s. The last cycle was followed by 5 min at 68°C to
complete polymerization. The PCR products were loaded onto a 1% (w/v)
agarose gel; and for each, a predominant band of approximately
1,400 bp was excised, and the DNA extracted using the GFX Gel-band
Purification Kit (Pharmacia AB). The purified PCR fragments were
digested with NheI and XhoI
(XhoI site present in the oligo(dT) adaptor primer
sequence) and ligated into pBluescript II KS vector (Stratagene), which
was cut with XbaI and XhoI. After agarose
gel purification and extraction of vector and PCR fragments, ligation
was performed using T4 DNA ligase (Invitrogen). Constructs were
transformed into JM109 competent cells using the heat shock method
(Sambrook et al., 2001
), plated onto
Luria-Bertani-ampicillin plates and incubated overnight at 37°C. Four
of five colonies screened contained the 1,400-bp insert for both the
tomato cv Trust and tomato cv Walter cDNA clones. For each clone,
mini-prep plasmid DNA was sequenced using an automated sequencer (ABI,
Foster City, CA) followed by interpretation using Gene Runner software (Hastings Software Inc., Hastings on Hudson, NY). The
LeMAN4 protein was aligned with the three other known
endo-
-mannanase amino acid sequences from tomato using the Boxshade
program (http://www.ch.embnet.org).
Genomic DNA was isolated from leaves of the following
tomato cultivars: Ailsa Craig wt, Rutgers wt, Glamour, Heinz 1439, and Indian River, using the DNeasy Plant Genomic DNA kit (Qiagen USA, Valencia, CA). To amplify the gene for endo-
-mannanase from each of
these cultivars, PCR was performed on 200-ng aliquots of the genomic
DNA preparations using Taq DNA polymerase (MBI
Fermentas) at 2 mM MgCl2. The forward primer
used was 5prime2 (5'-ATATTGATGAATAACTCAATCATC) and the reverse primer
was 3'-untranslated region (5'-CAATACTATAACTCAACCAGATG), which was
designed to anneal just upstream of the poly(A) tail on the cDNA clone.
Thermal cycle conditions were: 94°C for 3 min 30 s, followed by
35 cycles of: 94°C for 45 s, 55°C for 40 s, and 72°C
for 2 min 10 s. The last cycle was followed by 5 min at 72°C to
complete polymerization. The 2,700-bp fragments were gel-purified,
ligated into the pGEM T-Easy TA cloning vector (Invitrogen), and
transformed into Escherichia coli. Plasmid DNA from
positive clones for each cultivar was analyzed by DNA sequencing.
Genetic Cross of Tomato cvs Walter and Trust
Mature anthers from tomato cv Trust flowers were rubbed upon the
stigmas of emasculated tomato cv Walter flowers before anthesis, and
the reverse cross was conducted also. After fruit development and
ripening, seeds of tomato cv Trust-maternal, and tomato cv Walter-maternal fruits were collected, washed, and sown (eight plants
of tomato cv Trust-maternal and 12 plants of tomato cv Walter-maternal). Flowers of this F1 generation were
self-pollinated. Genomic DNA was extracted from the young leaves of the
F1 plants using the DNeasy Genomic DNA mini-prep kit
(Qiagen USA). Ripe fruit tissue was extracted and assayed for
endo-
-mannanase activity using the gel-diffusion assay described
earlier. Twenty-eight plants of the F2 generation were
established from the seeds of one of the tomato cv Walter-maternal
plants. Young leaves and ripe fruit tissue were collected from these
F2 plants and treated in the same manner as the
F1 generation.
To determine the endo-
-mannanase genotypes, genomic DNA preparations
were made from individual plants of the F1 and
F2 generations and screened by PCR using a common forward
primer (LPG fwd, 5'-TTGCCAGGTTTAACTCAAGAG) and one of two reverse
primers specific for each gene. By taking advantage of the
two-nucleotide deletion in the LeMAN4i gene, the
"Wr-rev" primer (5'-CTATGATAGCTTAGAGAGCCA) was designed, which was
only capable of extension in PCR reactions where the
LeMAN4i endo-
-mannanase gene was present. The
"Tr-rev" primer (5'-CTATGATAGCTTAGAGAGCCT) conversely would only
extend in PCR reactions where the LeMAN4a endo-
-mannanase gene was present. The two reverse primers contained 20 identical 5' nucleotides, but the final 3' nucleotides were specific
to each genotype. Diagnostic PCR reactions were carried out using 200 ng of genomic DNA and Taq DNA polymerase (MBI Fermentas) at 1 mM MgCl2 with the following thermal-cycle
conditions: 94°C for 5 min, followed by 35 cycles of 94°C for
30 s, 62°C for 30 s, and 72°C for 30 s. The final
cycle was followed by 5 min at 72°C to complete polymerization. For
both sets of primers, 10 ng pBluescript+LeMAN4a (tomato
cv Trust) plasmid DNA as template were included as a PCR control.
Genomic DNA from tomato cvs Trust and Walter plants were also included
as controls. A negative control including water in place of genomic DNA
was also included for both sets of primers. For each primer set,
successful PCR was expected to yield a band of 351 bp, which was made
visible by running aliquots of the reactions on agarose gels containing
ethidium bromide. For the F1 generation, plants 3 and 4 of
the tomato cv Trust-maternal cross and plants 10 and 12 of the tomato
cv Walter-maternal plants were tested in the manner described above.
All 28 of the F2 generation plants were tested in the same manner.
Expression of Recombinant Proteins in E. coli and Site-Directed Mutagenesis
The coding regions (without the signal peptide) of the
LeMAN4 endo-
-mannanase cDNAs (bp 109-1,228) from
tomato cvs Walter and Trust were amplified by PCR using a blunt-ended
forward primer (pMAL-fwd, 5'-TTTTCAAATAATAATTTTGTTTATACA) and a
PstI site-linked reverse primer (pMAL-rev,
5'-CGCTGCAGCTATGATAGCTTAGAGAG). Platinum Pfx DNA Polymerase
(Invitrogen) was used at 1 mM MgSO4 with the following thermal-cycle conditions: 94°C for 2 min 20 s, 35 cycles of 94°C for 25 s, 56°C for 30 s, and 68°C for 1 min 20 s. The final cycle was followed by 5 min at 68°C to
complete polymerization. The products were digested with
PstI and ligated into the XmnI and
PstI sites of the MBP expression vector pMAL-c2X (New
England BioLabs Inc., Beverly, MA). The empty vector and vectors
containing the insert were transformed into competent E.
coli cells, strain DH5
, and plated onto Luria-Bertani + ampicillin solid media. Colonies were screened by restriction analysis
using purified plasmid DNA, and positives were sequenced to confirm PCR
fidelity. Overnight cultures were inoculated at a concentration of 1%
into Rich medium + Glc and ampicillin (pMAL kit protocol, New England BioLabs Inc.) and grown at 37°C with shaking at 250 rpm. When OD600 of the culture reached an absorbance approximately
0.5, expression was induced by the addition of IPTG to 0.3 mM and further incubation for 2 h at 37°C. A crude
sample of the culture was taken before the addition of IPTG (uninduced
cells) and after 2 h of incubation with IPTG (induced cells).
Cultures were harvested by centrifugation at 4,000g for
10 min; resuspended in 20 mM Tris-HCl, pH 7.4, 200 mM NaCl, and 1 mM EDTA; and frozen overnight at
20°C. Cells were thawed in ice-cold water and disrupted by
sonication with a microtip probe. Sonicated cell suspensions were
centrifuged at 9,000g for 20 min at 4°C, and the
supernatants were retained for further analysis. Aliquots of the crude
culture samples (uninduced and induced) including empty vector and
vector plus inserts were separated on a 10% (w/v)
polyacrylamide SDS-PAGE gel, which was stained with Coomassie Blue dye
to make visible the separated proteins. A second 10% (w/v)
polyacrylamide SDS-PAGE gel was run with the aforementioned samples,
plus samples of the soluble proteins obtained after sonication and
centrifugation. This gel was used for immunoblotting onto
nitrocellulose to detect the endo-
-mannanase fusion proteins,
employing the same anti-endo-
-mannanase antibody used earlier.
Site-directed mutagenesis was employed to make specific changes and/or
deletions to one or more amino acids located near the carboxy terminus
of the endo-
-mannanase fusion proteins. The Quik Change
Site-Directed Mutagenesis System (Stratagene) was used to create the
desired clones, and expression of the mutated fusion proteins was in
E. coli. Equal amounts of soluble E. coli cell fractions from each clone were assayed to monitor the resulting changes in enzyme activity. The clones created are listed in Table I.
| |
ACKNOWLEDGMENTS |
|---|
We thank Dr. Yukio Morohashi (Department of Regulatory Biology,
Saitama University, Japan) for kindly providing the antibody to
endo-
-mannanase, Beixin Mo (Department of Botany, University of
Guelph) for helpful discussions on purification of the enzyme, and Dr.
Robert T. Mullen (University of Guelph) for advice on site-directed mutagenesis.
| |
FOOTNOTES |
|---|
Received July 29, 2002; returned for revision August 8, 2002; accepted August 13, 2002.
1 This work was supported by the Natural Sciences and Engineering Research Council of Canada (grant no. A2210 to J.D.B.).
* Corresponding author; e-mail dbewley{at}uoguelph.ca; fax 519-767-1991.
Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.011890.
| |
LITERATURE CITED |
|---|
|
|
|---|
-mannanase is present in an inactive form in ripening tomato fruits of the cultivar Walter.
J Exp Bot
52: 105-111
-mannanase activity increases in the skin and outer pericarp of tomato fruits during ripening.
J Exp Bot
51: 529-538
4)-
-mannan endohydrolase from the seeds of germinated tomato (Lycopersicon esculentum).
Planta
203: 454-459[CrossRef][Web of Science][Medline]
-mannanase and pectin methylesterase can underestimate enzyme activity due to proteolytic degradation: a remedy.
Anal Biochem
300: 87-93[CrossRef][Web of Science][Medline]
-mannanase activity in tomato and other ripening fruits.
HortScience
36: 72-75
-mannanases from germinating coffee (Coffea arabica) grains.
Planta
213: 296-308[CrossRef][Web of Science][Medline]
-mannanase gene is expressed in the micropylar endosperm cap of tomato seeds.
Plant Physiol
123: 1235-1245
-mannanase in the endosperm of germinated tomato seeds.
Physiol Plant
94: 328-334[CrossRef]
-mannanase in tomato fruit.
Phytochemistry
28: 3277-3280[CrossRef]This article has been cited by other articles:
![]() |
R. Schroder, R. G. Atkinson, and R. J. Redgwell Re-interpreting the role of endo-{beta}-mannanases as mannan endotransglycosylase/hydrolases in the plant cell wall Ann. Bot., August 1, 2009; 104(2): 197 - 204. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Filichkin, J. M. Leonard, A. Monteros, P.-P. Liu, and H. Nonogaki A Novel Endo-{beta}-Mannanase Gene in Tomato LeMAN5 Is Associated with Anther and Pollen Development Plant Physiology, March 1, 2004; 134(3): 1080 - 1087. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|