First published online October 15, 2002; 10.1104/pp.010363
Plant Physiol, November 2002, Vol. 130, pp. 1464-1475
Characterization of the Genes Encoding the Cytosolic and
Plastidial Forms of ADP-Glucose Pyrophosphorylase in Wheat
Endosperm1
Rachel A.
Burton,2
Philip E.
Johnson,2
Diane M.
Beckles,
Geoffrey B.
Fincher,
Helen L.
Jenner,
Mike J.
Naldrett, and
Kay
Denyer*
John Innes Centre, Norwich Research Park, Colney, Norfolk NR4 7UH,
United Kingdom (P.E.J., H.L.J., M.J.N., K.D.); Department of Plant
Science, Waite Campus, University of Adelaide, Glen Osmond South
Australia 5064, Australia (R.B., G.B.F.); and DuPont Agricultural
Products, Newark, Delaware 19711-6104 (D.M.B.)
 |
ABSTRACT |
In most species, the synthesis of ADP-glucose (Glc) by the
enzyme ADP-Glc pyrophosphorylase (AGPase) occurs entirely within the
plastids in all tissues so far examined. However, in the endosperm of
many, if not all grasses, a second form of AGPase synthesizes ADP-Glc
outside the plastid, presumably in the cytosol. In this paper, we show
that in the endosperm of wheat (Triticum aestivum), the
cytosolic form accounts for most of the AGPase activity. Using a
combination of molecular and biochemical approaches to identify the
cytosolic and plastidial protein components of wheat endosperm AGPase
we show that the large and small subunits of the cytosolic enzyme are
encoded by genes previously thought to encode plastidial subunits, and
that a gene, Ta.AGP.S.1, which encodes the small subunit of the
cytosolic form of AGPase, also gives rise to a second transcript by the
use of an alternate first exon. This second transcript encodes an
AGPase small subunit with a transit peptide. However, we could not find
a plastidial small subunit protein corresponding to this transcript.
The protein sequence of the purified plastidial small subunit does not
match precisely to that encoded by Ta.AGP.S.1 or to the predicted
sequences of any other known gene from wheat or barley (Hordeum
vulgare). Instead, the protein sequence is most similar
to those of the plastidial small subunits from chickpea (Cicer
arietinum) and maize (Zea mays) and rice
(Oryza sativa) seeds. These data suggest that the gene encoding the major plastidial small subunit of AGPase in wheat
endosperm has yet to be identified.
 |
INTRODUCTION |
The synthesis of starch takes place
inside plastids (the chloroplasts of leaves and the amyloplasts of
nonphotosynthetic starch-storing organs such as seeds). The substrate
for starch synthesis, ADP-Glc is synthesized by the enzyme ADP-Glc
pyrophosphorylase (AGPase). AGPase catalyzes the conversion of Glc-1-P
and ATP to ADP-Glc and pyrophosphate and is a heterotetrameric protein
composed of two sorts of subunits referred to as the small (SSU) and
large subunits (LSU; for review, see Preiss, 1991 ). There is evidence for the existence of multiple, tissue-specific forms of the SSU and LSU
of AGPase in plants. In maize (Zea mays), for
example, the SSUs of the endosperm, embryo, and leaf are encoded by
three separate genes (Hannah et al., 2001 ). However, there is also
evidence that transcripts encoding particular AGPase subunits may be
expressed in more than one tissue. For, example, the transcript
encoding the LSU of AGPase in barley (Hordeum
vulgare) leaves is also present in the endosperm (Doan et
al., 1999 ). At present, we do not have a complete description for any
species of the nature and patterns of expression of all of the genes
encoding AGPase subunits.
In most species, the synthesis of ADP-Glc occurs entirely within the
plastids in all tissues so far examined. However, in the endosperm of
barley (Thorbjørnsen et al., 1996a ), maize (Denyer et al., 1996 ), and
rice (Oryza sativa; Sikka et al., 2001 ), and probably
all grasses (Beckles et al., 2001 ), a second form of AGPase
synthesizes ADP-Glc outside the plastid, presumably in the cytosol. In
barley (Thorbjørnsen et al., 1996a ), maize (Denyer et al., 1996 ), and
rice (Sikka et al., 2001 ), cytosolic AGPase accounts for most
(85%-95%) of the total AGPase activity in the endosperm. The
phenotypes of the maize mutants shrunken2,
brittle2, and brittle1 (sh2,
bt2, and bt1) show that the synthesis of ADP-Glc in the cytosol and its import into plastids by a specific transporter (encoded at the Brittle1 locus) is necessary for starch synthesis to
occur at the wild-type rate. Mutations that abolish the LSU (Shrunken2)
or the SSU (Brittle2) of the cytosolic form of AGPase in maize abolish
the major AGPase activity and substantially reduce the starch content
of the endosperm (Tsai and Nelson, 1966 ; Dickinson and Preiss, 1969 ).
Mutations that eliminate or inactivate the ADP-Glc transporter
(brittle1 mutants) also reduce starch content and cause the
accumulation of ADP-Glc in the cytosol (Shannon et al., 1996 ).
In maize endosperm, the phenotypes of the bt2 and
sh2 mutants show that the cytosolic and plastidial subunits
of AGPase are encoded by four separate genes, two encoding SSUs and two
encoding LSUs (Giroux and Hannah, 1994 ). However, this may not be the
case in all cereal endosperms. In barley, cytosolic and plastidial SSU
mRNAs are produced from a single gene by the use of two alternate first
exons (Thorbjørnsen et al., 1996b ). These transcripts predict plastidial and cytosolic SSU proteins that are identical over 90% of
their length and differ only at their N termini. The predicted N-terminal domain unique to the putative plastidial SSU in barley contains a transit peptide, whereas the predicted N-terminal domain of
the cytosolic protein is shorter than a typical transit peptide and
lacks a consensus transit peptide cleavage site.
In wheat (Triticum aestivum), there is a limited
amount of information relating gene sequences to the plastidial and
cytosolic forms of AGPase. As much of this work was done before it was
known that the major form of AGPase in cereal endosperms is cytosolic,
it was assumed that the cDNAs isolated from wheat endosperm encoded
plastidial proteins. The following is a summary of information about
the subunits of AGPase in wheat and the genes encoding them. A
full-length cDNA clone encoding an AGPase SSU was isolated from a wheat
endosperm library (Ainsworth et al., 1993 ). A putative transit peptide
of 22 amino acids was identified based on the alignment of the wheat
SSU sequence with the N terminus of the mature AGPase SSU purified from
spinach (Spinacia oleracea) leaf. However, it was
noted that at 22 amino acids, this putative transit peptide is short
compared with known chloroplast transit peptides. The similarity of
this wheat cDNA sequence to the barley cytosolic SSU (Thorbjørnsen et
al., 1996b ) makes it very likely that it encodes a cytosolic rather
than a plastidial AGPase SSU. No cDNA clones encoding obvious
plastidial AGPase SSUs for wheat have been identified.
Partial cDNAs (Olive et al., 1989 ) and, later, a full-length cDNA
(Ainsworth et al., 1995 ) encoding a LSU of AGPase were cloned from
wheat endosperm. This cDNA encoded a small, putative transit peptide of
22 amino acids. A partial cDNA encoding a different LSU of AGPase was
also cloned from wheat leaves (Olive et al., 1989 ). With the limited
sequence data available at the time, Olive et al. (1989) could not
conclude whether it encoded an LSU or an SSU. However, later
comparisons suggested that it did encode an LSU (Smith-White and
Preiss, 1992 ). Thus, two different cDNAs encoding LSUs have been
described for wheat.
In summary, some but not all, of the cDNAs encoding subunits of wheat
AGPase have been identified. The patterns of expression of the
identified genes and their relationships to plastidial and cytosolic
AGPase proteins are unknown. Comparison of information thus far
available for barley and maize indicates that within the grasses, there
may be considerable variation in the way in which AGPase subunits in
the endosperm are encoded, but there is insufficient detailed
information to allow general conclusions to be drawn. The aim of our
work was to shed further light on this problem by providing a complete
picture of AGPase transcripts and proteins in wheat endosperm. We
wished to establish the identity of the genes encoding the large and
small subunits of AGPase in wheat endosperm by purifying the cytosolic
and plastidial forms of AGPase from this tissue; whether the cytosolic
and plastidial SSUs are encoded by separate genes, as in maize, or by a
single gene encoding two alternative N-termini, as in barley; the
subcellular distribution of AGPase activity in wheat endosperm; and the
tissue-specific pattern of expression and, for the endosperm, the
temporal pattern of expression of the AGPase transcripts and proteins.
 |
RESULTS |
Sequence Analysis
The predicted amino acid sequences of subunits of plant AGPase
(Smith-White and Preiss, 1992 and Fig. 1)
can be divided into two groups corresponding to the LSUs and SSUs.
Comparison of the N- terminal portions of the SSU sequences allows this
group to be further divided into two subgroups (Thorbjørnsen et al.,
1996b ; Hannah et al., 2001 ). One group contains the plastidial AGPase SSUs from cereals and noncereals. The other group contains cereal sequences that are proven or putative cytosolic AGPase SSU
sequences.

View larger version (73K):
[in this window]
[in a new window]
|
Figure 1.
Comparison of the derived amino acid sequences of
subunits of ADP-Glc pyrophosphorylase (AGPase). The dendrogram was
generated using the PileUp program of the Wisconsin Package Version
10.1 (Genetics Computer Group, Madison, WI), which creates a multiple
sequence alignment from a group of related sequences using progressive,
pair-wise alignments. The tree shows the clustering relationships for
subunits of AGPase. With one exception (AAD31613), the plant subunits
of AGPase divide into two major groups, representing the LSU (pale
gray) and SSU (dark gray). Presence of a transit peptide (TP) was
predicted using the ChloroP server (Emanuelsson et al.,
1999 ). y, Yes; n, no; ?, not determined due to incomplete
sequence; Tissue, tissue from which transcript was isolated.
|
|
Comparison of the LSU sequences (Fig. 1) shows that these can also be
divided into two major subgroups. One contains only cereal LSUs (cereal
group), and the other mainly noncereal LSUs. The cereal group contains
proteins expressed only in nonphotosynthetic parts of the plant such as
the endosperm and embryo. None are expressed in leaves. Unlike the
SSUs, comparison of the entire LSU sequences or just the N-terminal
regions does not show a clear division of these sequences into ones
that are proven or probable cytosolic sequences (e.g. maize endosperm
Sh2, accession no. AAB24191; Bhave et al., 1990 ) and ones that are
probably plastidial (e.g. maize embryo LSU, accession no. P55234;
Giroux et al., 1995 ). Almost all of the sequences in this cereal group
do not have clearly defined transit peptides identified by the ChloroP
1.1 Prediction Server. Thus, we cannot determine with certainty from
the predicted amino acid sequence whether a LSU sequence
from a cereal seed, such as that from wheat endosperm (accession no.
P12299; Ainsworth et al., 1995 ; Olive et al., 1989 ), encodes a
cytosolic or plastidial protein. Therefore, this must be determined experimentally.
Within the second major group of LSU sequences, which are mainly from
dicots, there is one cereal sequence encoding a barley leaf LSU
(accession no. T06194; Eimert et al., 1997 ). Unlike the LSU sequences
in the cereal group, this sequence does have a clearly recognizable
transit peptide of 55 amino acids (ChloroP 1.1 Prediction Server). The
partial sequence of a transcript from wheat leaves (Olive et al., 1989 ;
accession no. P12298) also falls within this group. These cereal
sequences are most closely related to the dicot leaf LSU sequences.
Thus LSUs expressed in cereal leaves show more similarity at the amino
acid level to those of dicot leaves than to those of cereal seeds.
Identification of Transcripts in the Endosperm Encoding Cytosolic
and Plastidial Forms of AGPase SSU
In wheat endosperm, the previously identified transcript encoding
AGPase SSU (Ainsworth et al., 1993 ) is very similar to that encoding
the putative cytosolic SSU in barley endosperm (Thorbjørnsen et al.,
1996b ) (Fig. 2a). The gene encoding this
cytosolic SSU in barley also encodes a putative plastidial SSU that is
produced by the use of an alternate first exon (Fig. 2b). To
investigate whether a similar plastidial transcript is present in wheat
endosperm, we designed primers based on the wheat and barley sequences
to amplify the 5' regions unique to the putative cytosolic and
plastidial forms.

View larger version (61K):
[in this window]
[in a new window]
|
Figure 2.
Partial sequences of the 5' ends of cDNAs encoding
the AGPase SSUs of barley and wheat. The PCR products shown (AGP.S.1a
and AGP.S.1b) were isolated from wheat cDNA (cv Frame) and are compared
with the previously identified wheat cDNA (cv Chinese Spring; Ainsworth
et al., 1993 ) and the barley cDNA encoding the putative cytosolic SSU
(Thorbjørnsen et al., 1996b ). The sequences of PCR products from two
separate PCR reactions were identical. The sequences used to design the
5' and the 3' primers are indicated. The transcription start codon
(ATG) is shown in bold and is underlined. Identical bases are shown in
white on black. a, Comparison of partial cDNAs encoding the cytosolic
SSU of AGPase from wheat and barley. b, Comparison of partial cDNAs
encoding the putative plastidial SSU of AGPase from wheat and barley.
c, Comparison of partial cDNAs encoding the cytosolic and putative
plastidial SSU of AGPase from wheat. The start of the sequence common
to both cDNAs (encoded by exon 2) is indicated by a star.
|
|
Fragments of the predicted sizes were amplified from RNA from isolated
endosperms (Fig. 3a), indicating that
there are two transcripts encoding SSUs in wheat endosperm. We called
the transcript that gave rise to the smaller 260-bp fragment, AGP.S.1a
(encoding a putative cytosolic SSU), and the transcript that gave rise
to the larger 353-bp fragment, AGP.S.1b (encoding a putative plastidial SSU). The AGP.S.1a sequence was identical to that previously isolated by Ainsworth et al. (1993) (Fig. 2a). The AGP.S.1b sequence was almost
identical to the barley plastidial AGPase SSU (Fig. 2b) and clearly
different from AGP.S.1a (Fig. 2c) and the previously identified wheat
transcript (Ainsworth et al., 1993 ) at the 5' end.

View larger version (56K):
[in this window]
[in a new window]
|
Figure 3.
Analysis of AGPase transcripts. Details of the
primers and PCR conditions are given in "Materials and Methods." M,
Molecular mass standards; C, control reactions (contained primers but
no cDNA). Estimated sizes of the products are indicated. a, Reverse
transcriptase (RT)-PCR analysis of transcripts in developing
wheat endosperm using specific primer pairs for AGP.S.1a (1a) and
AGP.S.1b (1b). Endosperms were dissected from grains of approximately
15 to 30 mg fresh weight. b, RT-PCR analysis of transcripts in
developing wheat endosperm from grains of various developmental stages
using specific primer pairs for AGP.S.1a and AGP.S.1b. The average
fresh weights of the grains in each sample were 1, 4.8 mg; 2, 8.5 mg;
3, 17.5 mg; 4, 26.1 mg; 5, 42.9 mg; and 6, 64.4 mg. c, RT-PCR analysis
of transcripts in leaves (L), embryos (Em), roots (R), and developing
endosperms of different ages (mass of grains [mg] used is indicated).
Specific primer pairs for AGP.L.1 (endosperm LSU; left, 25 ng of total
RNA per reaction) and AGP.S.2 (leaf LSU; right, 400 ng of total RNA per
reaction) were used. Each reaction was repeated three or four times and
the results of a typical experiment are shown. To test for DNA
contamination of the RT-PCR reactions, control RNA samples were first
treated with DNase-free RNase before the cDNA was synthesized
(Promega). In all of these control reactions, no PCR products were
amplified.
|
|
Identification of a Wheat Genomic Clone Encoding AGPase SSU
The fact that AGP.S.1a and AGP.S.1b differed at their 5' ends but
were identical at their 3' ends (Fig. 2c) suggested that in wheat, as
in barley, these two transcripts are probably encoded by a single gene.
To identify this gene in wheat, we used primers designed to amplify the
DNA encoding the 5' region in three overlapping fragments (Fig.
4). We called this partial wheat AGPase
gene Ta.AGP.S.1 (GenBank accession no. AF536819). It encodes two exons,
1a and 1b, corresponding to the 5' sequences of AGP.S.1a and AGP.S.1b respectively, and the first part of exon 2, which is common to both
transcripts. The arrangement of the exons is identical to those
described for the barley AGPase SSU gene (Thorbjørnsen et al., 1996b ),
and the sequence of exons and introns in these genes are very similar
(88% identity).

View larger version (12K):
[in this window]
[in a new window]
|
Figure 4.
Analysis of AGPase genes. A diagrammatic
representation of a genomic clone of Ta.AGP.S.1. Introns are shown in
white, and exons are shaded. Primers (P1-P16) and their orientation
are indicated by arrowheads. The clone was isolated as three
overlapping fragments (F1-F3).
|
|
Developmental Pattern of Expression of AGP.S.1a and
AGP.S.1b
We investigated the patterns of expression of AGP.S.1a and
AGP.S.1b during wheat grain development (Fig. 3b) using the specific primers shown in Figure 2 and reverse transcriptase-PCR. The RT-PCR products corresponding to AGP.S.1a and AGP.S.1b differed in their developmental pattern of expression (two experiments with mRNA from
different batches of grain). The product corresponding to AGP.S.1a was
detected in endosperms undergoing rapid starch synthesis, but not in
very young endosperms when starch synthesis was minimal. The product
corresponding to AGP.S.1b was detected only in young endosperms at the
beginning of their starch-synthesizing period. The RT-PCR product
corresponding to the constitutively expressed cytosolic isoform of
glyceraldehyde 3-P dehydrogenase was present at all developmental
stages tested, showing that the cDNA was intact (data not shown).
Pattern of Expression of Transcripts Encoding AGPase
LSUs
Two wheat cDNAs encoding AGPase LSUs were identified previously
(accession nos. Z21969 and X14348). These transcripts will be referred
to as AGP.L.1 and AGP.L.2, respectively. The tissue-specific and, in
the endosperm, temporal patterns of expression of the genes encoding
AGP.L.1 and AGP.L.2 were examined using specific primers and RT-PCR
(Fig. 3c). In all reactions, the RT-PCR products were of the predicted
length and sequencing of the product amplified from endosperm at 16 d
postanthesis and for leaf confirmed that these were amplified fragments
of the AGPase cDNAs to which the primers were designed (data not
shown). AGP.L.1 was expressed in endosperms at each developmental stage
tested (Fig. 3c) and could also be detected in embryos and to a lesser
extent roots when higher concentrations of RNA were used (100 ng, data
not shown). No AGP.L.1 transcript could be detected in leaves. AGP.L.2 was expressed in leaves, endosperms, and embryos. No AGP.L.2
transcripts were detected in roots at the concentration of RNA used in
these experiments.
The Relative Amounts of Plastidial and Cytosolic AGPase in the
Endosperm
To examine the subcellular location of AGPase activity and
proteins, we used a mechanical method to isolate plastids from developing wheat endosperm. A pellet fraction was obtained that was
enriched in plastidial marker enzymes (soluble starch synthase and
alkaline pyrophosphatase) relative to cytosolic marker enzymes (alcohol
dehydrogenase and Suc synthase [SuSy]). The distribution of AGPase
between pellet and supernatant was very similar to that of the
cytosolic marker enzymes. This suggested that most of the activity of AGPase in wheat endosperm is extraplastidial. The activities in the plastid-enriched pellets as a percentage of the total
activity recovered in the supernatant plus pellet (means ± SE from measurements of six separately prepared batches of
plastids) were 1.6 ± 0.2 (AGPase), 1.1 ± 0.2 (alcohol
dehydrogenase), 1.3 ± 0.1 (SuSy), 14.6 ± 0.8 (soluble
starch synthase), and 14.3 ± 1.1 (alkaline pyrophosphatase).
To determine how much of the total AGPase activity was plastidial, we
compared the activities of AGPase and marker enzymes in aliquots of
the plastid preparations that were deliberately contaminated with
differing amounts of cytosolic enzymes (using a method described in
Denyer and Smith, 1988 ). The subcellular distribution of AGPase
activity calculated from these data showed that the plastidial AGPase
activity was much less than the cytosolic AGPase activity. Endosperms
from a range of developmental stages (grains of 4-30 mg fresh weight)
were tested, and in no experiments was the activity in the plastids
more than 7% of the total activity.
Identification of AGPase SSU Using Specific Antisera
Using specific antiserum to the Bt2 SSU of maize AGPase (Giroux
and Hannah, 1994 ), we examined the relative amounts of the plastidial
and cytosolic SSU proteins present in developing wheat endosperm at
three developmental stages (Fig. 5). As
with barley (Thorbjørnsen et al., 1996a ; Beckles et al., 2001 ), the
cytosolic and plastidial SSUs are of different molecular mass
(approximately 54 and 51 kD, respectively). The plastidial and
cytosolic proteins were present at all three developmental stages.
Although there was some variation between samples, in general, the
amount of the cytosolic SSU per endosperm (and possibly the amount of
plastidial SSU also) increased with developmental age.

View larger version (21K):
[in this window]
[in a new window]
|
Figure 5.
The abundance of AGPase SSUs in endosperms of
different ages. Three replicate extracts of endosperms from grains 12, 17, or 21 d after anthesis (DAA) were subjected to SDS-PAGE on
7.5% (w/v) gels and were then immunoblotted and probed with Bt2
antiserum at a concentration of 1/5,000 as described in "Materials
and Methods." The average grain weights were 10.8 mg (12 DAA), 18.9 mg (17 DAA), and 43.3 mg (21 DAA). Each track contains proteins from an
equivalent proportion of an endosperm. C, Cytosolic small subunit; P,
plastidial small subunit. Proteins of unknown identity that were
smaller than the SSUs also cross-reacted with the antiserum (not
shown).
|
|
Separation of Cytosolic and Plastidial Forms Using Anion-Exchange
Chromatography
In addition to the estimation of the subcellular distribution of
AGPase activity by fractionation (above), we used ion-exchange chromatography to separate and quantify the plastidial and cytosolic AGPase activities. In extracts of developing wheat endosperm, we
observed two peaks of activity (Fig. 6).
In western blots probed with the Bt2 antiserum, the cytosolic SSU could
be detected in fractions from the major peak and the plastidial SSU
could be detected in fractions from the minor peak. This suggested that the two peaks represented the separated cytosolic and plastidial forms
of AGPase. The relative activities of the two peaks of AGPase were used
to estimate the relative abundance of these forms in the endosperm. In
a typical experiment (Fig. 6), the plastidial AGPase (second peak)
accounted for approximately 6% of the total AGPase activity.

View larger version (32K):
[in this window]
[in a new window]
|
Figure 6.
Separation of isoforms of AGPase by ion-exchange
chromatography. Wheat endosperms were extracted and the homogenate
applied to a Q-Sepharose column as described in "Materials and
Methods." a, The activity of AGPase in each fraction is expressed as
a percentage of the total AGPase activity recovered in all fractions
from the column. b, Samples of fractions 21 through 33 (containing
AGPase activity) were subjected to SDS-PAGE, blotted onto
nitrocellulose, and probed with Bt2 antiserum at a dilution of 1/5,000.
c, Cytosolic SSU; P, plastidial SSU.
|
|
Purification of Cytosolic and Plastidial AGPase from Developing
Wheat Endosperm
The cytosolic and plastidial activities of AGPase in extracts
of developing wheat endosperms were separated using ion-exchange chromatography (as shown in Fig. 6). Gel-filtration chromatography of
each form of AGPase on Superose 200 gave a single peak of activity with
an estimated mass of between 250 and 300 kD. This mass is consistent
with the idea that the cytosolic and plastidial enzymes are
heterotetramers of two small and two large subunits, as suggested by Fu
et al. (1998) for the potato (Solanum tuberosum)
tuber AGPase. The purification scheme we devised (Table
I) is rapid and recovers approximately
45% of the initial AGPase activity. Therefore, it is unlikely that any
major forms of AGPase were lost during purification.
View this table:
[in this window]
[in a new window]
|
Table I.
Purification of cytosolic and plastidial AGPase from
developing wheat endosperm
The plastidial and cytosolic forms of AGPase were simultaneously
purified from 500 endosperms of 14 to 25 mg fresh wt. Values are means
(±SE) of measurements made in six (cytosolic) or four
(plastidial) separate experiments. The final specific activities of the
purified cytosolic and plastidial AGPase from wheat endosperm were
similar to the specific activities of AGPase partially purified from
rice endosperm (42.9 mmol min 1 mg protein 1;
Nakamura et al., 1992 ) and maize endosperm (33.6 mmol
min 1 mg protein 1; Plaxton and Preiss, 1987 )
and considerably greater than that of AGPase purified from wheat
endosperm (2.4 mmol min 1 mg protein 1) by
Gómez-Casati and Iglesias (2002) .
|
|
Analysis of the Purified Cytosolic AGPase Proteins
When analyzed by SDS-PAGE (Fig. 7A),
the final preparation of cytosolic AGPase contained major proteins of
approximately 50 kD (proteins a and b), the expected size for subunits
of AGPase, as well as major contaminating proteins of 90 kD (protein c)
and 105 kD (protein d) and other minor proteins (identity unknown). All
visible proteins of between 40 and 60 kD were excised from the gel and
were subjected to digestion with trypsin, and the masses of the
resulting fragments were analyzed using MALDI-ToF. Analysis of protein
b (Fig. 7A) showed that it was an SSU of AGPase. Nine fragments
(covering 30% of the protein) were identified that matched the
putative cytosolic SSU from wheat endosperm (accession no. P30523;
Ainsworth et al., 1993 ) encoded in part by AGP.S.1a. One fragment from
the purified protein was the same mass as a fragment expected from the
unique N terminus encoded by AGP.S.1a.

View larger version (18K):
[in this window]
[in a new window]
|
Figure 7.
SDS PAGE of purified cytosolic (A) and plastidial
(B) AGPase. AGPase was purified as described in "Materials and
Methods," and was subjected to SDS-PAGE on a 7.5% (w/v) acrylamide
gel (A) or a 4% to 12% (w/v) acrylamide gradient gel (B). Masses in
kilodaltons of Mr marker proteins are
indicated. Protein bands labeled a through d and a through c were
excised and subjected to matrix-assisted laser-desorption ionizing
time-of-flight mass spectrometry (MALDI-ToF) analysis. Proteins
identified by MALDI-ToF analysis are indicated.
|
|
Analysis of a group of four proteins ranging in size from 48 to 55 kD
(protein a) showed that they were fragments of the wheat endosperm LSU
encoded by AGP.L.1. For the largest of the four proteins, 13 fragments
(covering 39% of the protein) were identified.
MALDI-ToF analysis of the major contaminating proteins of 90 and 105 kD
(proteins c and d) in the AGPase showed that they were SuSy 1 (accession no. CAA04543) and SuSy 2 (accession no. CAA03935), respectively.
Analysis of the Purified Plastidial AGPase Proteins
When analyzed by SDS-PAGE (Fig. 7B), the final preparation of
plastidial AGPase contained major proteins of approximately 50 kD
(protein a), the expected size for subunits of AGPase, as well as major
contaminating proteins of approximately 110 and 150 kD (proteins b and
c) and other minor proteins (identity unknown). Proteins a, b, and c
(Fig. 7B) were excised from the gel, subjected to digestion with
trypsin, and the masses of the resulting protein fragments were
analyzed using MALDI-ToF. This analysis showed that the region of the
gel labeled a contained two types of protein. One was a SSU of AGPase
and the other was a LSU. Thirteen fragments (covering 30% of the
protein) were identified that matched an AGPase SSU from chickpea
(Cicer arietinum; accession no. AAK27720). The fragment
sizes did not match as closely to those predicted for the barley
homolog of AGP.S.1b, the putative plastidial SSU (accession no.
P55238).
For the LSU in protein a, the best matches of fragment masses in two
separate experiments were to those predicted for the cytosolic LSU from
wheat endosperm, AGP.L.1. The total number of fragments obtained from
the two experiments combined covered 46% of the protein. In both
experiments, a fragment corresponding to the predicted N terminus of
the LSU was obtained, showing that the protein had not been processed
to remove a transit peptide.
MALDI-ToF analysis of the major contaminating proteins showed that
protein b was a heat shock protein. The closest match of fragment sizes
was to HSP80-2 from wheat (accession no. X98582). Analysis of protein
c did not reveal its identity.
To obtain protein sequence information for the purified plastidial SSU
protein, we used a quadrupole time-of-flight (Q-ToF) mass spectrometer
(MS). The AGPase SSUs that matched most closely to the two fragments of
protein sequence obtained for the purified wheat protein were those
from rice seed, maize embryo, chickpea, and the predicted sequence of
wheat AGP.S.1b (Fig. 8). However, the
amino acid sequence obtained by Q-ToF did not exactly match any of
these sequences, including that of wheat AGP.S.1b. It differed from
these sequences in at least six out of the 26 residues.

View larger version (16K):
[in this window]
[in a new window]
|
Figure 8.
Comparison of the sequence of purified plastidial
AGPase SSU with the predicted sequences of other AGPase SSUs. The
purified plastidial SSU protein from wheat endosperm was subjected to
MALDI analysis, and the sequence of two fragments was obtained by Q-ToF
analysis. These sequences were compared with those of other SSUs
available in databases. The corresponding sequences of the four SSUs
that matched most closely to those of the purified plastidial SSU
protein from wheat are shown. The positions of the amino acids in the
wheat endosperm AGPase SSU are indicated. Leu (L) and Ile (I) have the
same mass and are therefore indistinguishable by Q-ToF. For L and I in
the Q-ToF sequence, the amino acid most likely to be present was
determined by comparison with other deduced sequences and is shown on
the top line with the alternative, less likely amino acid shown below
in parenthesis. Rice, Rice seed (AAK27313); Maize, maize embryo
(AAK39640); Chickpea, unknown source tissue (AAK27720); Wheat
(AGP.S.1b), wheat endosperm (P30523).
|
|
 |
DISCUSSION |
Identification of Genes Encoding the LSU and SSU of AGPase in Wheat
Endosperm
To identify the genes encoding the LSU and SSU of AGPase in wheat
endosperm, we purified the cytosolic and plastidial forms of the enzyme
and used MALDI-ToF and Q-ToF MS analysis to match the purified proteins
to previously characterized cDNAs. This analysis showed that the LSU of
the cytosolic form of AGPase is encoded by the cDNA identified by
Ainsworth et al. (1995) , and the SSU of the cytosolic AGPase is encoded
by the cDNA identified by Ainsworth et al. (1993) . Both cDNAs were
previously thought to encode plastidial AGPase subunits. However, our
results show that the proteins encoded by these transcripts are not
imported into the plastids and are therefore processing by removal of
part of their N-terminal sequences would not be expected.
Purification and sequencing of plastidial AGPase from wheat endosperm
suggested that some, or all, of the plastidial SSU is encoded by a gene
that has yet to be identified. The MALDI-ToF and Q-ToF analyses of
fragments of the purified protein showed that the wheat endosperm
plastidial SSU was more similar to AGPase SSUs from chickpea, maize
embryo, and rice seeds than to the cytosolic SSU of wheat or to the
putative plastidial SSU from barley endosperm (Thorbjørnsen et al.,
1996a ). The isolation of the gene in wheat encoding this protein is in progress.
Purification of the plastidial AGPase did not result in the
identification of the gene encoding the plastidial LSU from wheat endosperm. We obtained sequence information from the purified protein
that matched the cytosolic LSU. Possible explanations for this are
that the cytosolic and plastidial LSUs are encoded by the same
gene; that our plastidial AGPase preps were contaminated with some
cytosolic AGPase; or that there was some exchange of subunits between
the plastidial and cytosolic enzymes prior to their separation on
Q-Sepharose. We consider the first of these possibilities to be very
unlikely. A MALDI fragment matching the extreme N terminus of the
protein was found that would indicate that no processing of the protein
to remove a transit peptide had occurred. It is not likely that a
plastidial LSU protein would lack a transit peptide (Vothknecht and
Soll, 2000 ). Consistent with the second and/or third possibilities, we
saw a small amount of the plastidial SSU in the (mainly) cytosolic
AGPase peak after Q-Sepharose (Fig. 6, Peak 1), suggesting that a
limited amount of contamination or subunit exchange had occurred.
A Single SSU Gene Encodes Two Transcripts, But Neither Corresponds
to the Plastidial SSU Protein
Our experiments suggested that in wheat, as in barley, two
different mRNAs are produced from a single SSU gene. We identified two
transcripts, AGP.S.1a and AGP.S.1b, in developing wheat endosperm that
were almost identical to two previously identified barley endosperm
transcripts (bepsF1 and blps14; Thorbjørnsen et
al., 1996a ). The gene in wheat (Ta.AGP.S.1) encoding these transcripts was partially sequenced and it showed an arrangement of the exons encoding the N termini of the two alternative AGPase SSUs similar to
that of the AGPase SSU gene in barley (Thorbjørnsen et al., 1996b ).
The existence of such a gene in wheat was predicted by Thorbjørnsen et
al. (1996b) based on the similarity between the deduced N-terminal
sequences of the wheat and barley SSU proteins.
The smaller of the two transcripts (AGP.S.1a) produced from gene
Ta.AGP.S.1 corresponds to the cDNA identified by Ainsworth et al.
(1993) and encodes the cytosolic SSU of AGPase. The larger of the
two transcripts (AGP.S.1b) produced from gene Ta.AGP.S.1 encodes a
putative protein predicted to have a transit peptide. However, as no
plastidial protein was found that matched the predicted sequence of
this transcript, its significance is unknown.
As no proof in the form of protein sequence from purified plastidial
AGPase is available to support the idea that the barley equivalent of
AGP.S.1b, blps14 encodes some or all of the plastidial SSU
in barley endosperm, we cannot exclude the possibility that another,
yet to be discovered, gene may encode at least some of the plastidial
AGPase SSU in barley as well as in wheat. This question will be
addressed in a future publication from our group.
Most of the AGPase Activity in Wheat Endosperm Is
Cytosolic
Two different approaches were used to assess the subcellular
distribution of AGPase activity in wheat endosperm: preparation of
fractions enriched in plastids and separation of cytosolic and
plastidial forms of AGPase using ion-exchange chromatography. Both
approaches showed that that the cytosolic form accounts for most of the
total AGPase activity in the endosperm during the phase of rapid
accumulation of starch. There is a second, minor form of AGPase in
developing endosperm that is plastidial. The activity of the plastidial
AGPase was variable. In our experiments, it was generally very low
(<2%-7% of the total AGPase activity in the endosperm).
AGPase Subunits Have Different Temporal and Spatial Patterns of
Expression
We investigated the tissue-specific pattern of expression of the
endosperm cytosolic LSU (AGP.L.1) and the major leaf LSU (AGP.L.2) and,
for the endosperm, the temporal pattern of expression of these LSUs and
the two SSU transcripts (AGP.S.1a and AGP.S.1b) encoded by gene
Ta.AGP.S.1. We also compared the pattern of expression of AGP.S.1a and
AGP.S.1b with changes in the relative amounts of protein and activities
of the plastidial and cytosolic forms of AGPase during endosperm development.
The AGP.L.1 transcript was expressed strongly only in the endosperm.
This confirms the results of others for wheat (Ainsworth et al., 1995 )
and for the corresponding transcript in barley (Villand et al., 1992 ;
Thorbjørnsen et al., 1996b ; Eimert et al., 1997 ; Doan et al., 1999 ).
The gene may also be expressed in tissues other than the endosperm. In
general agreement with others, we found a low level of expression of
the AGP.L.1 transcript in embryos and roots, but none in leaves. This
may indicate that the cytosolic form of AGPase is not confined to the
endosperm. However, it is more likely that the probes used in these
experiments were not gene specific and may have crosshybridized with
transcripts encoding other forms of LSU or that, as suggested by Doan
et al. (1999) , very low levels of these largely endosperm-specific
transcripts may be present in other tissues due to promoter leakage,
but are unlikely to encode the bulk of the LSU protein in those
tissues. Purification and sequencing of the AGPase proteins from other tissues, as well as the endosperm, may be necessary to resolve these controversies.
The AGP.L.2 transcript was expressed in leaves, endosperms, and
embryos, but not in roots. This suggests that the LSU protein encoded
by this transcript may be present, presumably in the plastids, of
leaves, endosperms, and embryos. Similar patterns of expression of the
leaf LSU, blpl, were observed in barley (Doan et al., 1999 ). However, as we were unable to identify the plastidial LSU protein in
this study, we do not know whether the AGP.L.2 transcript or another,
as yet unidentified, transcript is responsible for the plastidial LSU
in wheat endosperm.
The transcripts encoding the LSU and SSU of cytosolic AGPase increase
in abundance during the early to middle grain-filling period. Similar
results were obtained for barley transcripts encoding cytosolic
subunits of AGPase (Doan et al., 1999 ). This expression pattern
correlates with the increase in total (mainly cytosolic) AGPase
activity (reaching a peak at approximately 20 DAA; Pilling 2001 ) and
the abundance of the cytosolic SSU protein (our results and Reeves et
al., 1986 ).
The putative plastidial SSU transcript AGP.S.1b and the plastidial SSU
protein did not show a coordinate pattern of expression through
endosperm development. The transcript AGP.S.1b was most abundant in
very young endosperms, whereas the abundance of the plastidial SSU
protein differed very little in endosperms of all stages examined. This
is consistent with the idea that the transcript AGP.S.1b encoded by
gene Ta.AGP.S.1 may not be responsible for the major plastidial SSU of
AGPase in wheat endosperm.
 |
MATERIALS AND METHODS |
Plant Material
Grains of wheat (Triticum aestivum) were from the
John Innes Germplasm Collection (cv Bobwhite), the Waite Institute
(Adelaide, Australia; cv Frame), or from the Montana Agricultural
Experimental Station (Bozeman; cv HiLine). Plants were grown in
individual pots in a greenhouse at a minimum temperature of 12°C,
with supplementary lighting in winter to give a 16-h day. In an
alternate manner, plants were grown in a controlled
environment room at 15°C/12°C day/night and with 16 h of light
per day. Leaves and roots were harvested from 14-d-old plants grown in
vermiculite, endosperm was dissected from grains at various stages of
development, and embryos were dissected from grains at 20 to 25 DAA.
Tissues were used immediately or were harvested directly into liquid
nitrogen and stored at 80°C prior to use.
Isolation of Total RNA and cDNA Synthesis
Total RNA was extracted from developing grain using a
commercially available phenol/guanidine isothiocyanate procedure
(Trizol reagent; Invitrogen, Paisley, UK). For experiments using the
cultivar Frame, cDNA was prepared from 2 µg of total RNA with
Thermoscript RT (Invitrogen, Paisley, UK) and an oligo-dT20
primer at a temperature of 55°C according to the manufacturer's
instructions. For experiments using the cultivar HiLine, cDNA was
prepared from 0.025 or 0.4 µg of total RNA with Moloney-murine
leukemia virus RT (Applied Biosystems, Foster City, CA) and 1 or 2 µM of the respective antisense oligonucleotide at a
temperature of 42°C according the manufacturer's instructions.
PCR Amplification of cDNAs
For experiments using primers designed to AGPase SSUs, a 2-µL
aliquot of single-stranded cDNA from the cultivar Frame was used as a
template for the PCR amplification of each product using standard PCR
procedures. Control PCR reactions with GAPDH primers were carried out
as described in Burton et al. (1999) . PCR reactions were performed in a
total volume of 50 µL with 0.2 µL of primers at 2 µM.
Cycling parameters were 35 cycles of 94°C for 40 s,
50°C for 40 s, and 72°C for 60 s. The cDNA fragment
encoding part of the cytosolic AGPase SSU was amplified with the sense
primer 5'-CGGCAATGGATGTGCCTTTGG-3' and the antisense primer
5'-CAGACAATTACTGACAGG-3'. The cDNA fragment encoding part of the
plastidial AGPase SSU was amplified with the sense primer
5'-CATCCACCTCAATGGCGATGGC-3' and the antisense primer
5'-CAATAAGCCTGTAGTTGGCACCCAATGGCA-3'. Single PCR products were isolated
from gels and purified using Geneclean (Geneworks, Adelaide, Australia)
and were cloned into the pGEM TEASY vector (Promega, Madison, WI). Each
product was completely sequenced using the Applied Biosystems 373 DNA sequencer.
For experiments using primers designed to AGPase LSUs, PCR was primed
with 0.2 µM (LSU.L.1) or 0.4 µM
(LSU.L.2) primers using an RNA PCR kit (Roche Molecular
Biochemicals, Summerville, NJ) following the manufacturer's
instructions, except that PCR was done using GC-Advantage Polymerase 2 PCR system (CLONTECH, Palo Alto, CA). Cycling parameters were 95°C
for 5 min, 25 cycles of 95°C for 1 min, 55°C for 2 min, 72°C for
3 min, and an extension time of 72°C for 7 min. AGPase LSU.1 was
amplified with primers 5'-GTGACGGGTTCTGCGACA-3'and
5'-GTTTGTTTGCTCGCTGCC-3'. AGPase LSU.2 was amplified with primers
5'-TCTGTTGCTTGCCTATTGATGG-3' and the 5'-CTGTTCAGCAAGGGC AAGATTT-3'.
Single PCR products were isolated from gels and were purified using a
QIAquick kit (Qiagen) and sequenced directly with each oligonucleotide
primer using the Applied Biosystems ABI 3700 capillary Sequencer with
the ABI BigDye terminator chemistry (PE Applied Biosystems, Foster
City, CA).
The Cloning and Sequencing of a Gene Encoding AGPase SSU
(Ta.AGP.S.1)
To clone Ta.AGP.S.1, we used nested PCR on DNA prepared from
developing grains harvested 10 to 13 d after fertilization. The PCR reactions were carried out using the high-fidelity
Taq polymerase Elongase (Invitrogen, Paisley, UK) and
10% (v/v) dimethyl sulfoxide. The conditions were 4 min at
94°C, followed by 35 cycles of 1 min at 94°C, 1 min at 50°C, 1 min at 72°C, and a final extension time of 10 min at 72°C. For the
first-round amplification of fragment 1, the primer sequences were
CGGCAATGGATGTGCCTTTGG (P4) and GAGACAGGTCTGGGAGCTCTTC (P11) and for the
second, nested round, they were AGCGTGAACAATGCAACATTG (P10) and
GCGGAGGGATCAGGATCTTGG (P9). For the first-round amplification of
fragment 2, the primer sequences were CATCCACCTCAATGGCGATGGC (P3) and
CAGACAATTACTGACAGG (P1) and for the second, nested round, they were
ACGTGCCGTGTCAGACTCCAAGA (P12) and CAATAAGCCTGTAGTTGGCACCCAATGGCA (P2).
For the first-round amplification of fragment 3, the primer sequences
were GTTAAGTTACTCAGCCACACTG (P13) and GATGTCTCAATCCAGCAATTCC (P16) and
for the second, nested round, they were CAGTGGGTGTCAGGCGTATCTC (P14)
and TGCAGCTGAGACATGATCCAAG (P15). PCR products to be analyzed were
cloned into the pGEM-T Easy vector (Promega) and were sequenced using
an ABI 3700 capillary sequencer.
Purification of Cytosolic and Plastidial AGPase from Developing
Wheat Endosperm
All steps were performed at 4°C or on ice. Five hundred wheat
endosperms (each of 14-25 mg fresh weight) from cv Bobwhite plants
grown in a controlled environment room were excised into 20 mL of
homogenization medium (50 mM HEPES, pH 7.4, 2 mM MgCl2, 2 mM EDTA, 5 mM NaCl, 5% [v/v] ethanediol, and 0.1 µg
mL 1 protease inhibitors [Sigma Complete; Sigma, St.
Louis]). The endosperms were homogenized using a mortar and pestle,
and were then centrifuged for 20 min at 10,000g. The
pellet was discarded and the supernatant was loaded onto a HiLoad 16/60
FPLC column containing Q-Sepharose (Amersham Pharmacia Biotech,
Buckinghamshire, UK) pre-equilibrated with 50 mM BisTris
propane, pH 7.4, 10 mM NaCl, and 5% (v/v) ethanediol.
Protein was eluted from the column by applying a linear gradient of 10 to 500 mM NaCl at a flow rate of 2.5 mL min 1.
Fractions were assayed and those containing cytosolic AGPase activity
(peaks 1) were pooled separately from those containing plastidial
AGPase activity (peak 2). Both fractions were concentrated to 200 µL
using a Centriplus YM-100 (Millipore, Bedford, MA) concentrator (100 kD
cut-off). Each of the concentrated samples was then applied to a
Sephadex-200 16/60 gel-filtration column and eluted with 50 mM HEPES, pH 7.2, and 100 mM NaCl at a flow
rate of 0.5 mL min 1. Fractions containing AGPase activity
were pooled and concentrated as above to a volume of 30 to 150 µL
prior to SDS-PAGE.
Isolation of Plastids from Developing Wheat Endosperm
Plastids were isolated from wheat endosperm at approximately 10 to 12 DAA essentially according to the method of Tetlow et al. (1993) .
Approximately 2 g of wheat endosperm was excised into a glass
petri dish containing 10 mL of amyloplast isolation medium (AIM; 50 mM HEPES, pH 7.4, and 0.8 M sorbitol) on ice.
All subsequent steps were performed at 4°C. The AIM was removed and
10 mL of plasmolysis buffer (50 mM HEPES, pH 7.4, 0.8 M sorbitol, 1 mM EDTA, 1 mM KCl,
and 2 mM MgCl2) was added to the endosperms
that were left on ice for 90 min. Plasmolysis buffer was removed and replaced by 10 mL of 50 mM HEPES, pH 7.4, 0.8 M
sorbitol, 1 mM EDTA, 1 mM KCl, 2 mM
MgCl2, and 1% (w/v) bovine serum albumin. Endosperms were
gently chopped using a new razor blade, and the resultant homogenate
was filtered through two layers of Miracloth (Calbiochem, San Diego).
The filtrate was centrifuged at 50g for 5 min and the
pellet enriched in plastids was resuspended in a suitable volume of AIM
(typically 1 mL). To break the plastids and recover stromal enzymes,
the suspension of organelles was mixed vigorously, squirted 10 times
through a fine-bore syringe needle, and then centrifuged at
12,000g for 5 min. The supernatant was assayed for
enzyme activity.
Identification of AGPase Subunits by MALDI-ToF and
Q-ToF
Fractions containing AGPase activity were subjected to SDS-PAGE
and the separated proteins were stained with Coomassie Brilliant Blue
R-250. Protein bands were excised and subjected to tryptic digestion
according to Speicher (2000) followed by analysis by MALDI-ToF MS. Mass
fragment sizes were used to query the National Center for biotechnology
Information (NCBI; http://www.ncbi.nlm.nih.gov) nonredundant database
using the MASCOT search tool (http://www.matrixscience.com). All
matched sequences showed mass errors of <50 µL
L 1.
For Q-ToF analysis, tryptic peptides for each sample were separated
using C18 reverse-phase HPLC (75 µm i.d. × 150 mm column, with 3 µm C18 100Å PepMap packing, LC Packings, Amsterdam) and were eluted
directly into the nanoelectrospray ion source of a Q-ToF 2 MS
(Micromass, Manchester, UK) at a flow rate of 300 nL min 1
using a CapLC (Waters, Milford, MA). After an initial wash for 3 min at
5% (w/v) B (100% [w/v] acetonitrile and 0.1% [w/v] formic acid),
a binary gradient consisting of 5% to 80% (w/v) solvent B (100%
[w/v] acetonitrile and 0.1% [w/v] formic acid) was developed (t = 0 min, 5% [w/v] B; t = 3, 5% [w/v] B; t = 3.5, 15% [w/v] B; t = 15, 40% [w/v] B; t = 22, 60%
[w/v] B; and t = 25, 80% [w/v] B). Spectra were acquired in
the data-dependent mode throughout the HPLC gradient, switching between
a full survey mass spectrum (m/z range 400-1,600;
1.2 s scan time; MS to MS/MS switch above threshold intensity of 5 counts/s) and two MS/MS spectra (m/z range 50-3,000;
1.2 s scan time; charge-state recognition for 2+, 3+, and 4+ ions;
argon collision gas; switch back to MS survey after 6 s or below
threshold of 2 counts/s; dynamic exclusion time of 25 s) recorded
sequentially on the two most abundant ions present in the survey mass
spectrum. All of the MS/MS spectra recorded for each sample were
searched against the NCBI nonredundant database using the MASCOT search
tool. MS/MS spectra that were not identified by searching against the
database were analyzed using the PepSeq de novo sequencing tool (Micromass).
SDS-PAGE and Immunoblotting
SDS-PAGE was on 7.5% (w/v) acrylamide gels according to Beckles
et al. (2001) or on Novex (San Diego) preprepared 4% to 12% (w/v) acrylamide gradient gels run in the MOPS buffer system according to the manufacturer's instructions (Invitrogen, Groningen, The Netherlands). Gels were stained with Coomassie Brilliant Blue R-250.
Immunoblotting was according to Denyer et al. (1997) .
Localization of Wheat Endosperm AGPase Activity
The AGPase activity of wheat endosperm was localized to the
plastid or extraplastidial compartments essentially according to the
method of Denyer and Smith (1988) except that the extraplastidial compartment was the cytosol rather than the mitochondria.
Enzyme Activities
For AGPase, the activity reported was dependent upon the
presence in the assay of all of the appropriate substrates and
cofactors and also upon extract concentration within the range used to
make the measurements. The concentrations of components of each of the
assays and their pH values were optimized to give the maximum rate. The
rate of the reaction was linear with respect to time for at least 4 min. Reaction mixtures were as follows: AGPase: as in Smith et al.
(1989 , assay 2b), except that 100 mM HEPES, pH 7.9, 0.4 mM NAD, 1 mM ADP-Glc, 1.5 mM
NaPPi, and 5 U phosphoglucomutase were used; SuSy: As in Craig et al.
(1999) , except that the buffer was 82 mM AMPSO
{(3-[1, 1-dimethyl-2-hydroxyethyl] amino)-2-hydroxy-propanesulfonic acid}, pH 9.0; soluble starch synthase: As in Jenner et al.
(1994) , the resin method, except that 0.5 mg of potato
amylopectin, 2 mM ADP[U-14C] Glc at 2.3 GBq
mol 1, and 10 µL of extract were used; Alkaline
inorganic pyrophosphatase: As in Gross and ap Rees (1986) ,
except that 50 mM Bicine, pH 8.9, 20 mM
MgCl2, and 1.25 mM NaPPi were used; and Alcohol
dehydrogenase: as in Cossins et al. (1968) , except that the buffer was
85 mM glycyl-Gly (pH 8.6), and 1.3 mM NAD and
100 mM ethanol were used.
 |
ACKNOWLEDGMENTS |
We thank Dr. Alison M. Smith and Dr. David Laurie for support,
encouragement, and useful discussions throughout the course of this
work and for constructive criticism of the manuscript, and Dr. Anne
Edwards for advice and help with sequence comparisons.
 |
FOOTNOTES |
Received June 20, 2002; returned for revision July 12, 2002; accepted August 15, 2002.
1
This work was supported by the Biotechnology and
Biological Sciences Research Council (UK; competitive strategic grant
to the John Innes Centre), by DuPont Agricultural Products, and by the
Australian Grains Research and Development Corporation.
2
These authors contributed equally to the paper.
*
Corresponding author; e-mail kay.denyer{at}bbsrc.ac.uk; fax
44-1603-450045.
Article, publication date, and citation information can be found at
www.plantphysiol.org/cgi/doi/10.1104/pp.010363.
 |
LITERATURE CITED |
-
Ainsworth C, Hosein F, Tarvis M, Weir F, Burrell M, Devos KM, Gale MD
(1995)
Adenosine diphosphate glucose pyrophosphorylase genes in wheat: differential expression and gene mapping.
Planta
197: 1-10[Web of Science][Medline]
-
Ainsworth C, Tarvis M, Clark J
(1993)
Isolation and analysis of a cDNA clone encoding the small subunit of ADP-glucose pyrophosphorylase from wheat.
Plant Mol Biol
23: 23-33[CrossRef][Web of Science][Medline]
-
Beckles DM, Smith AM, ap Rees T
(2001)
A cytosolic ADP-glucose pyrophosphorylase is a feature of Graminaceous endosperms, but not of other starch-storing organs.
Plant Physiol
125: 818-827[Abstract/Free Full Text]
-
Bhave MR, Lawrence S, Barton C, Hannah LC
(1990)
Identification and molecular characterization of Shrunken-2 cDNA clones of maize.
Plant Cell
2: 581-588[Abstract/Free Full Text]
-
Burton RA, Zhang X-Q, Hrmova M, Fincher GB
(1999)
A single limit dextrinase gene is expressed both in the developing endosperm and in germinated grains of barley.
Plant Physiol
119: 859-872[Abstract/Free Full Text]
-
Cossins EA, Kopala LC, Blawacky B, Spronk AM
(1968)
Some properties of higher plant alcohol dehydrogenase.
Phytochemistry
7: 1125-1134[CrossRef]
-
Craig J, Barratt P, Tatge H, Déjardin A, Handley L, Gardner C, Barber L, Wang TL, Hedley C, Martin C, et al
(1999)
Mutations at the rug4 locus alter the carbon and nitrogen metabolism of pea plants through an effect on sucrose synthase.
Plant J
17: 101-110
-
Denyer K, Barber LM, Edwards EA, Smith AM, Wang TL
(1997)
Two isoforms of the GBSSI class of granule-bound starch synthase are differentially expressed in the pea plant (Pisum sativum L).
Plant Cell Environ
20: 1566-1572
-
Denyer K, Dunlap F, Thorbjørnsen T, Keeling P, Smith AM
(1996)
The major form of ADP-glucose pyrophosphorylase in maize endosperm is extraplastidial.
Plant Physiol
112: 779-785[Abstract]
-
Denyer K, Smith AM
(1988)
The capacity of plastids from developing pea cotyledons to synthesize acetyl CoA.
Planta
173: 172-182[CrossRef]
-
Dickinson DB, Preiss J
(1969)
Presence of ADP-glucose pyrophosphorylase in Shrunken-2 and Brittle-2 mutants of maize endosperm.
Plant Physiol
44: 1058-1062[Abstract/Free Full Text]
-
Doan DNP, Rudi H, Olsen O-A
(1999)
The allosterically unregulated isoform of ADP-glucose pyrophosphorylase from barley endosperm is the most likely source of ADP-glucose incorporated into endosperm starch.
Plant Physiol
121: 965-975[Abstract/Free Full Text]
-
Eimert K, Luo C, Déjardin A, Villand P, Thorbjørnsen T, Kleczkowski LA
(1997)
Molecular cloning and expression of the large subunit of ADP-glucose pyrophosphorylase from barley (Hordeum vulgare) leaves.
Gene
189: 79-82[CrossRef][Web of Science][Medline]
-
Emanuelsson O, Nielsen H, von Heijne G
(1999)
ChloroP, a neural network-based method for predicting chloroplast transit peptides and their cleavage sites.
Protein Sci
8: 978-984[Web of Science][Medline]
-
Fu YB, Ballicora MA, Leykam JF, Preiss J
(1998)
Mechanism of reductive activation of potato tuber ADP-glucose pyrophosphorylase.
J Biol Chem
273: 25045-25052[Abstract/Free Full Text]
-
Giroux MJ, Hannah LC
(1994)
ADP-glucose pyrophosphorylase in shrunken-2 and brittle-2 mutants of maize.
Mol Gen Genet
243: 400-408[Web of Science][Medline]
-
Giroux MJ, Smith-White B, Gilmore V, Hannah LC, Preiss J
(1995)
The large subunit of the embryo isoform of ADP glucose pyrophosphorylase from maize.
Plant Physiol
108: 1333-1334[CrossRef][Web of Science][Medline]
-
Gómez-Casati DF, Iglesias AA
(2002)
ADP-glucose pyrophosphorylase from wheat endosperm: purification and characterization of an enzyme with novel regulatory properties.
Planta
214: 428-434[CrossRef][Web of Science][Medline]
-
Gross P, ap Rees T
(1986)
Alkaline inorganic pyrophosphatase and starch synthesis in amyloplasts.
Planta
167: 140-145[CrossRef][Web of Science]
-
Hannah LC, Shaw JR, Giroux MJ, Reyss A, Prioul J-L, Bae J-M, Lee J-Y
(2001)
Maize genes encoding the small subunit of ADP-glucose pyrophosphorylase.
Plant Physiol
127: 173-183[Abstract/Free Full Text]
-
Jenner CF, Denyer K, Hawker JS
(1994)
Caution on the use of the generally accepted methanol precipitation technique for the assay of soluble starch synthase in crude extracts of plant tissues.
Aust J Plant Physiol
21: 17-22
-
Nakamura Y, Kawaguchi K
(1992)
Multiple forms of ADPglucose pyrophosphorylase of rice endosperm.
Physiol Plant
84: 336-342[CrossRef]
-
Olive MR, Ellis RJ, Schuch WW
(1989)
Isolation and nucleotide sequences of cDNA clones encoding ADP-glucose pyrophosphorylase polypeptides from wheat leaf and endosperm.
Plant Mol Biol
12: 525-538[CrossRef][Web of Science]
-
Pilling EM
(2001)
The origins of growth rings in starch granules. PhD thesis. University of East Anglia, East Anglia, UK
-
Plaxton WC, Preiss J
(1987)
Purification and properties of nonproteolytically degraded ADPglucose pyrophosphorylase from maize endosperm.
Plant Physiol
83: 105-112[Abstract/Free Full Text]
-
Preiss J
(1991)
Biology and molecular biology of starch synthesis and its regulation.
Oxford Surveys Plant Mol Cell Biol
7: 59-114
-
Reeves CD, Krishnan HB, Okita TW
(1986)
Gene expression in developing wheat endosperm.
Plant Physiol
82: 34-40[Abstract/Free Full Text]
-
Shannon JC, Pien F-M, Liu K-C
(1996)
Nucleotides and nucleotide sugars in developing maize endosperms.
Plant Physiol
110: 835-843[Abstract]
-
Sikka VK, Choi S-B, Kavakli H, Sakulsingharoj C, Gupta S, Ito H, Okita TW
(2001)
Subcellular compartmentation and allosteric regulation of the rice endosperm ADPglucose pyrophosphorylase.
Plant Sci
161: 461-468[CrossRef]
-
Smith AM, Bettey M, Bedford ID
(1989)
Evidence that the rb locus alters the starch content of developing pea embryos through an effect on ADP glucose pyrophosphorylase.
Plant Physiol
89: 1279-1284[Abstract/Free Full Text]
-
Smith-White BJ, Preiss J
(1992)
Comparison of proteins of ADP-glucose pyrophosphorylase from diverse sources.
J Mol Evol
34: 449-464[CrossRef][Web of Science][Medline]
-
Speicher KD
(2000)
Systematic analysis of peptide recoveries from in-gel digestions for protein identifications in proteome studies.
J Biomol Technol
11: 74-86
-
Tetlow IJ, Blissett KJ, Emes MJ
(1993)
A rapid method for the isolation of purified amyloplasts from wheat endosperm.
Planta
189: 597-600[Web of Science]
-
Thorbjørnsen T, Villand P, Denyer K, Olsen O-A, Smith AM
(1996a)
Distinct isoforms of ADPglucose pyrophosphorylase occur inside and outside the amyloplasts in barley endosperm.
Plant J
10: 243-250
-
Thorbjørnsen T, Villand P, Kleczkowski LA, Olsen OA
(1996b)
A single gene encodes two different transcripts for the ADP-glucose pyrophosphorylase small subunit from barley (Hordeum vulgare).
Biochem J
313: 149-154
-
Tsai CY, Nelson OE
(1966)
Starch-deficient maize mutants lacking adenosine diphosphate glucose pyrophosphorylase activity.
Science
151: 341-343[Abstract/Free Full Text]
-
Villand P, Aalen R, Olsen OA, Lüthi E, Lonneborg A, Kleczkowski LA
(1992)
PCR amplification and sequences of cDNA clones for the small and large subunits of ADP-glucose pyrophosphorylase from barley tissues.
Plant Mol Biol
19: 381-389[CrossRef][Web of Science][Medline]
-
Vothknecht UC, Soll J
(2000)
Protein import: the hitchhikers guide into chloroplasts.
Biol Chem
381: 887-897[CrossRef][Medline]
© 2002 American Society of Plant Biologists
This article has been cited by other articles:

|
 |

|
 |
 
S. Comparot-Moss and K. Denyer
The evolution of the starch biosynthetic pathway in cereals and other grasses
J. Exp. Bot.,
July 1, 2009;
60(9):
2481 - 2492.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. V. Radchuk, L. Borisjuk, N. Sreenivasulu, K. Merx, H.-P. Mock, H. Rolletschek, U. Wobus, and W. Weschke
Spatiotemporal Profiling of Starch Biosynthesis and Degradation in the Developing Barley Grain
Plant Physiology,
May 1, 2009;
150(1):
190 - 204.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Cossegal, P. Chambrier, S. Mbelo, S. Balzergue, M.-L. Martin-Magniette, A. Moing, C. Deborde, V. Guyon, P. Perez, and P. Rogowsky
Transcriptional and Metabolic Adjustments in ADP-Glucose Pyrophosphorylase-Deficient bt2 Maize Kernels
Plant Physiology,
April 1, 2008;
146(4):
1553 - 1570.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. T. Hamblin, M. G. Salas Fernandez, M. R. Tuinstra, W. L. Rooney, and S. Kresovich
Sequence Variation at Candidate Loci in the Starch Metabolism Pathway in Sorghum: Prospects for Linkage Disequilibrium Mapping
Crop Sci.,
July 16, 2007;
47(S2):
S-125 - S-134.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Rosti, H. Rudi, K. Rudi, H.-G. Opsahl-Sorteberg, B. Fahy, and K. Denyer
The gene encoding the cytosolic small subunit of ADP-glucose pyrophosphorylase in barley endosperm also encodes the major plastidial small subunit in the leaves
J. Exp. Bot.,
November 1, 2006;
57(14):
3619 - 3626.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Balmer, W. H. Vensel, N. Cai, W. Manieri, P. Schurmann, W. J. Hurkman, and B. B. Buchanan
A complete ferredoxin/thioredoxin system regulates fundamental processes in amyloplasts
PNAS,
February 21, 2006;
103(8):
2988 - 2993.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Ohdan, P. B. Francisco Jr, T. Sawada, T. Hirose, T. Terao, H. Satoh, and Y. Nakamura
Expression profiling of genes involved in starch synthesis in sink and source organs of rice
J. Exp. Bot.,
December 1, 2005;
56(422):
3229 - 3244.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Akihiro, K. Mizuno, and T. Fujimura
Gene Expression of ADP-glucose Pyrophosphorylase and Starch Contents in Rice Cultured Cells are Cooperatively Regulated by Sucrose and ABA
Plant Cell Physiol.,
June 1, 2005;
46(6):
937 - 946.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Leroch, S. Kirchberger, I. Haferkamp, M. Wahl, H. E. Neuhaus, and J. Tjaden
Identification and Characterization of a Novel Plastidic Adenine Nucleotide Uniporter from Solanum tuberosum
J. Biol. Chem.,
May 6, 2005;
280(18):
17992 - 18000.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Crevillen, T. Ventriglia, F. Pinto, A. Orea, A. Merida, and J. M. Romero
Differential Pattern of Expression and Sugar Regulation of Arabidopsis thaliana ADP-glucose Pyrophosphorylase-encoding Genes
J. Biol. Chem.,
March 4, 2005;
280(9):
8143 - 8149.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. J. Patron, B. Greber, B. F. Fahy, D. A. Laurie, M. L. Parker, and K. Denyer
The lys5 Mutations of Barley Reveal the Nature and Importance of Plastidial ADP-Glc Transporters for Starch Synthesis in Cereal Endosperm
Plant Physiology,
August 1, 2004;
135(4):
2088 - 2097.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Cross, M. Clancy, J. R. Shaw, T. W. Greene, R. R. Schmidt, T. W. Okita, and L. C. Hannah
Both Subunits of ADP-Glucose Pyrophosphorylase Are Regulatory
Plant Physiology,
May 1, 2004;
135(1):
137 - 144.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. H.M. Hendriks, A. Kolbe, Y. Gibon, M. Stitt, and P. Geigenberger
ADP-Glucose Pyrophosphorylase Is Activated by Posttranslational Redox-Modification in Response to Light and to Sugars in Leaves of Arabidopsis and Other Plant Species
Plant Physiology,
October 1, 2003;
133(2):
838 - 849.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Crevillen, M. A. Ballicora, A. Merida, J. Preiss, and J. M. Romero
The Different Large Subunit Isoforms of Arabidopsis thaliana ADP-glucose Pyrophosphorylase Confer Distinct Kinetic and Regulatory Properties to the Heterotetrameric Enzyme
J. Biol. Chem.,
August 1, 2003;
278(31):
28508 - 28515.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. E. Johnson, N. J. Patron, A. R. Bottrill, J. R. Dinges, B. F. Fahy, M. L. Parker, D. N. Waite, and K. Denyer
A Low-Starch Barley Mutant, Riso 16, Lacking the Cytosolic Small Subunit of ADP-Glucose Pyrophosphorylase, Reveals the Importance of the Cytosolic Isoform and the Identity of the Plastidial Small Subunit
Plant Physiology,
February 1, 2003;
131(2):
684 - 696.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|