| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
|
Plant Physiol, November 2002, Vol. 130, pp. 1506-1515
Arabidopsis Brassinosteroid-Insensitive dwarf12
Mutants Are Semidominant and Defective in a Glycogen Synthase Kinase
3
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
ABSTRACT |
|---|
 TOP
 ABSTRACT
 INTRODUCTION
RESULTS
DISCUSSION
MATERIALS AND METHODS
LITERATURE CITED
|
|---|
Mutants defective in the biosynthesis or signaling of
brassinosteroids (BRs), plant steroid hormones, display dwarfism.
Loss-of-function mutants for the gene encoding the plasma
membrane-located BR receptor BRI1 are resistant to exogenous
application of BRs, and characterization of this protein has
contributed significantly to the understanding of BR signaling. We have
isolated two new BR-insensitive mutants (dwarf12-1D and dwf12-2D) after
screening Arabidopsis ethyl methanesulfonate mutant populations.
dwf12 mutants displayed the characteristic morphology of
previously reported BR dwarfs including short stature, short round
leaves, infertility, and abnormal de-etiolation. In addition,
dwf12 mutants exhibited several unique phenotypes,
including severe downward curling of the leaves. Genetic analysis
indicates that the two mutations are semidominant in that heterozygous
plants show a semidwarf phenotype whose height is intermediate between wild-type and homozygous mutant plants. Unlike BR biosynthetic mutants,
dwf12 plants were not rescued by high doses of
exogenously applied BRs. Like bri1 mutants,
dwf12 plants accumulated castasterone and brassinolide,
43- and 15-fold higher, respectively, providing further evidence that
DWF12 is a component of the BR signaling pathway that includes BRI1.
Map-based cloning of the DWF12 gene revealed that
DWF12 belongs to a member of the glycogen synthase kinase 3
family. Unlike human glycogen synthase kinase 3, DWF12 lacks the conserved serine-9 residue in the auto-inhibitory N terminus.
In addition, dwf12-1D and dwf12-2D encode
changes in consecutive glutamate residues in a highly conserved TREE
domain. Together with previous reports that both bin2
and ucu1 mutants contain mutations in this TREE domain,
this provides evidence that the TREE domain is of critical importance
for proper function of DWF12/BIN2/UCU1 in BR signal transduction pathways.
| |
INTRODUCTION |
|---|
|
TOP
ABSTRACT
INTRODUCTION
RESULTS
DISCUSSION
MATERIALS AND METHODS
LITERATURE CITED
|
|---|
Brassinosteroids (BRs) are
poly-hydroxylated plant steroids structurally similar to animal steroid
hormones such as ecdysone. Essential roles for BRs in plant growth and
development have been demonstrated by the dwarf phenotype displayed in
mutants defective in BR biosynthetic or signaling pathways in
Arabidopsis, rice (Oryza sativa), tomato
(Lycopersicon esculentum), and pea (Pisum sativum). Phenotypes of the light-grown BR dwarf mutants include short stature, dark-green and round leaves, reduced fertility, and a
prolonged life cycle, as well as altered skotomorphogenesis in
dark-grown plants. Arabidopsis dwarf mutants defective in six genes
encoding BR biosynthetic enzymes are rescued by exogenous application
of BRs (Li et al., 1996
; Szekeres et al., 1996; Choe et al., 1998,
1999a, 1999b, 2000), whereas mutants in signaling components are
morphologically similar but insensitive to applied BRs. BR-insensitive
mutants in a gene known as bri1 (brassinosteroid insensitive1) were previously isolated based on the phenotype of
derepressed root-growth inhibition on media containing BRs (Clouse et
al., 1996). Thus far, all BR-insensitive recessive mutants where the
affected gene is known are BRI1 alleles (Li and Chory, 1997; Noguchi et
al., 1999; Friedrichsen et al., 2000). The BRI1 gene was
isolated and shown to encode a Leu-rich repeat receptor protein kinase
(Li and Chory, 1997). Evidence from kinase domain swapping experiments
with a similar Leu-rich repeat receptor protein kinase encoded by the
rice Xa21 gene (He et al., 2000), the cellular localization
of BRI1::GFP translational fusion protein to the plasma
membrane (Friedrichsen et al., 2000), and in vitro BR-binding assays
using an epitope-tagged BRI1 protein (Wang et al., 2001) have shown
that BRI1 is a component of a BR receptor located in the plasma membrane.
The isolation and characterization of mutants insensitive or resistant
to plant hormones has greatly enhanced our understanding of their
signaling pathways (Gray and Estelle, 2000). However, the scarcity of
BR-insensitive mutants has delayed unraveling BR-mediated signaling
pathways. It has been hypothesized that loss-of-function mutations in
additional BR signaling genes may result in lethality because of their
essential roles or they may have unnoticeable physiological or
morphological phenotypes because of gene redundancy. We have
extensively screened both ethyl methanesulfonate (EMS)-induced and
T-DNA mutant populations to obtain additional mutants, and recovered
two semidominant mutants in a gene we call dwf12
(dwarf12). The semidominant dwf12 mutants are
insensitive to exogenously applied BRs and display an extreme dwarf
phenotype both in the light and dark. We also show that
dwf12-1D plants, like bri1, accumulate
significant amounts of BRs. The phenotypic similarity among
dwf12 and previously reported BR mutants, the brassinolide
(BL) insensitivity of dwf12-1D and dwf12-2D, and the mapping of dwf12 to a chromosomal location distinct from
BRI1 indicate that dwf12 mutants define a new
gene in the BR signal transduction pathway. Recently, two different
groups have independently reported new BR-insensitive mutants. Li et
al. (2001) identified two alleles of bin2
(brassinosteroid insensitive 2), and Perez-Perez et al.
(2002) found three alleles of ucu1 (ultracurvata
1). The bin2 and ucu1 mutants were shown to
have mutations in an Arabidopsis glycogen synthase kinase (GSK)
3-like kinase gene (Li and Nam, 2002; Perez-Perez et al., 2002), the
same gene that is mutant in our dwf12 alleles.
GSKs are a family of cytoplasmic kinases that belong to the
mitogen-activated protein kinase superfamily and are found in animals, fungi, and plants. Diverse roles for GSK3s include
dorsal/ventral polarity determination in Wnt/Wg signaling in
Drosophila melanogaster and Xenopus
laevis, endoderm/mesoderm formation in Caenorhabditis elegans, and prespore/prestalk fate determination in
Dictyostelium discoideum (Kim and Kimmel, 2000). In mammals,
they are involved in insulin-dependent Glc homeostasis,
-catenin-mediated cell signaling, and development of tau-associated
Alzheimer's disease (Bienz and Clevers, 2000; Harwood, 2000). In the
animal model systems studied thus far, differentially spliced
transcripts arise from only one or two GSK3 genes, whereas in plants,
GSK3 genes consist of multigene families; currently, the GenBank
database contains three genes for alfalfa
(Medicago sativa; Pay et al., 1993), five for tobacco
(Nicotiana tabacum), three for rice, four for petunia
(Petunia hybrida; Decroocq-Ferrant et al., 1995), and 10 for Arabidopsis (Bianchi et al., 1994). Dornelas et al. (1999)
reported that the Arabidopsis genes show different temporal and spatial
expression patterns. More recently, Dornelas et al. (2000) also showed
that antisense down-regulation of the two GSK3-like genes, AtSK11 and
AtSK12, results in altered floral development, including increased
number of perianth organs and abnormal apical-basal patterning in the
gynoecium. Here, we present additional evidence demonstrating that one
of the Arabidopsis GSK3-like kinases, previously named ASK
(etha),
plays a crucial role in BR signaling.
| |
RESULTS |
|---|
|
TOP
ABSTRACT
INTRODUCTION
RESULTS
DISCUSSION
MATERIALS AND METHODS
LITERATURE CITED
|
|---|
dwf12-1D and dwf12-2D Are New BR-Insensitive Dwarf Mutants
To identify additional players in the BR signaling pathway, we have screened EMS-induced mutant populations (>50,000) for characteristic BR dwarfs (Fig. 1), and identified 43 new dwarf mutants. Most of these 43 new dwarf mutants were rescued to a wild-type phenotype when BRs were topically applied. However, two mutants, wm1-1 and wm5-1, were insensitive to BRs, and phenotypically and genetically distinct from the other mutants. The phenotypes of the two mutants were typical of BR dwarfs, but with slightly twisted inflorescences, and leaves that are severely curled and rolled downward (Fig. 1). Interestingly, the progeny of the two dwarf mutants segregated for discrete groups of wild-type, severe, and weak dwarf plants (Fig. 1), suggesting that the parental dwarf mutants were heterozygous for a semidominant mutation that causes dwarfism. To determine whether dwf12 is allelic to bri1, we chose to map the mutations rather than doing genetic complementation tests because the semidominance of dwf12 may preclude reliable results in a complementation test. We mapped both dwf12 mutations to the middle of chromosome 4 to a position distinct from BRI1, which is linked to the DHS1 marker located on the bottom of chromosome 4 (see "Materials and Methods"). Thus, we designated the two novel BR-insensitive mutants, wm1-1 and wm5-1, dwarf12-1 dominant (dwf12-1D) and dwf12-2D, respectively: The demonstration of allelism comes from sequencing, which is discussed below.
|
The phenotypes of the two alleles were further characterized by morphometric analysis. The total height of aerial parts and the length of pedicels and siliques were all measured and found to be greatly decreased (Table I). Interestingly, the length of these plant organs was noticeably shorter in dwf12-2D mutants, suggesting that dwf12-2D is a more severe allele compared with dwf12-1D. Apical dominance, judging by the number of inflorescences, is increased at 4 weeks of age, but during its prolonged development, dwf12 mutants produced additional inflorescences as a result of decreased apical dominance.
|
To rule out the possibility that the lack of rescue of dwf12
mutants in our initial BR application experiment was because of a lower
BL dose than required, we tested three different concentrations of
epi-BL. The wild-type seedlings responded dramatically to
both 10
8 and 107
M epi-BL in that the hypocotyls and
petioles elongate, whereas root growth was stunted (Fig.
2A). Similarly, seedlings of the BR-deficient mutant dwf4-1 were rescued to wild-type
phenotype with 108 and
107 M epi-BL.
In contrast, both dwf12-1D and bri1-5 (a weak
bri1 allele) failed to show noticeable responses to
epi-BL, even at the highest concentration of
107 M. These results
indicate that the dwf12 mutants are defective in a step of
the BR signal transduction pathway.
|
To quantitatively understand the responsiveness of dwf12
mutants to epi-BL and other phytohormones, we measured
the root growth after treating the seedlings with epi-BL,
ABA, and auxin (2,4-dichlorophenoxyacetic acid
[2,4-D]). As shown in Figure 2B, the root growth inhibition in wild
type was decreased linearly and proportionally to the epi-BL
concentration. In contrast, both dwf12-1D and
bri1-5 mutants are significantly less sensitive to different
epi-BL concentrations. In response to all the concentrations
tested, root growth inhibition in bri1-5 was not noticeable
(Fig. 2). However, dwf12-1D was sensitive to this treatment
in that root growth was inhibited about 10% in response to
108 and 107
M epi-BL, and the root length was
approximately one-half of the control size at 1 µM. By definition, the control size is the
length of roots grown on media that contain the same amount of 95%
(v/v) ethyl alcohol used to dilute BL from a 4 mM
stock solution. It has been shown previously that root growth of BR
mutants is hypersensitive to inhibition by exogenous application of ABA
(Ephritikhine et al., 1999). Similarly, the root growth of wild type,
bri1-5, and dwf12-1D was unchanged, 23%
decreased, and 57% decreased, respectively, compared with their
controls in response to 0.5 µM ABA. The
inhibition by ABA was more pronounced in bri1-5 than in
dwf12-1D. When the two insensitive mutants were treated with
a synthetic auxin 2,4-D (0.5 µM), their root
growth was greatly inhibited like wild-type seedlings (Fig. 2B);
however, it is noteworthy that dwf12-1D and bri1-5 are slightly resistant to the auxin treatment as
compared with wild type.
dwf12 Is Defective in Feedback Regulation of BR Biosynthesis
Previously, we have shown that BRs accumulate relative to wild
type in direct correlation with the severity of the bri1
allele (Noguchi et al., 1999). The inability to perceive BRs in
bri1 mutants also results in increased steady-state levels
of BR biosynthetic gene transcripts (Noguchi et al., 1999). These and
other data (Mathur et al., 1998) led us to propose a model in which a
transcriptional feedback loop downstream of BRI1 regulates BR levels.
If DWF12 is a component of the BR signaling pathway, dwf12
mutants might also be defective in feedback regulation and accumulate
BRs. We collected tissue from dwf12-1D and analyzed the BR
levels and found that dwf12-1D plants accumulate significant
quantities of BRs (Fig. 3). The degree of
accumulation is more pronounced in downstream compounds in the
biosynthetic pathway. The levels of the end product BL and the
penultimate compound CS were 15- and 43-fold higher as compared with
wild-type levels, respectively. The bri1-5 mutant, which
shows similar inflorescence height to dwf12, displayed an
18- and 27-fold increase of BL and CS levels, respectively (Noguchi et
al., 1999; Fig. 3).
|
DWF12 Encodes a Member of the GSK3 Gene Family
To understand the role of DWF12 in BR signaling, we isolated the DWF12 gene using conventional map-based cloning techniques. First, we found that dwf12 mutations are located between the AG and CH42 markers in the middle of chromosome 4 (Fig. 4, A-D). The Arabidopsis Genome Initiative has sequenced and annotated this region; thus, we took advantage of this information in selecting candidate genes for dwf12. The gene in which we found the G to A transition mutations, typical of EMS-induced changes, was a GSK/shaggy-like kinase (F28A21.120). Both dwf12-1D and dwf12-2D carried base changes in this gene (Fig. 4D). Interestingly, the two mutations were only 3 bp apart: dwf12-2D possessed a G to A transition at nucleotide position 986, whereas dwf12-1D had a G to A change at nucleotide position 989 (Fig. 4D). These two mutations resulted in substitution of an acidic Glu (GAA) to a basic Lys (AAA) residue in two adjacent amino acids (263 [dwf12-2D] and 264 [dwf12-1D], respectively; Fig. 4D).
|
To learn more about the role of DWF12 as well as the
importance of the changes in these two amino acids, we conducted
protein sequence analysis. First, we searched the GenBank and SwissProt databases, and found a group of kinases belonging to the GSK3 family as
the most similar sequences to DWF12. Multiple sequence alignments
revealed that the DWF12 protein sequence could be subdivided into three
discrete domains: (a) N-terminal variable domain (1-39), (b) conserved
kinase domain (40-324), and (c) C-terminal domain (325-380). When
these domains were individually compared with the corresponding domains
of human GSK3, the sequence identity was 44%, 71%, and 49%,
respectively. The lower sequence identity at the N-terminal domain was
attributable partly to the short length of this domain in DWF12,
only 39 amino acids, but 53 in the human GSK3 (Fig.
5). Arabidopsis has 10 copies of the
GSK3-like genes, named AtSKs (Arabidopsis shaggy-like
kinases) after their similarity to D. melanogaster
shaggy-like kinase (Dornelas et al., 1998). The Arabidopsis AtSK
sequences deviate substantially in the length of their N-terminal
domains. The total number of amino acids ranged from 380 (DWF12) to as
long as 472 (KGSQ_ARATH). The length of the DWF12 N-terminal domain is
the shortest when compared with GSK3 from other organisms including
human, D. melanogaster, and D. discoideum (Fig.
5).
|
| |
DISCUSSION |
|---|
|
TOP
ABSTRACT
INTRODUCTION
RESULTS
DISCUSSION
MATERIALS AND METHODS
LITERATURE CITED
|
|---|
The phenotypes of the dwf12 mutants can be summarized
by the statement that all organs are reduced in size. The specific
characteristics examined in this research, such as plant height and the
length of pedicels, siliques, petioles, hypocotyls, and roots, all are significantly shorter than wild type (Table I; Figs. 1 and 2). These
morphological alterations are typical of BR biosynthetic or signaling
mutants (Figs. 1 and 2). Thus, it is likely that the dwf12
mutants are defective in BR biosynthesis or signaling. One interesting
exception in dwf12 is a typical leaf curling in the abaxial
direction. Downward curling leaves are often found in mutants that are
defective in auxin signaling, such as axr1 and
axr2 (Lincoln et al., 1990; Timpte et al., 1992). These
shared phenotypes between dwf12 and auxin mutants suggest
that DWF12 also plays a role in auxin signaling in specific cell types.
Two lines of evidence strongly suggest that the dwf12
mutants are BR insensitive. First, a BR biosynthetic mutant
dwf4-1 was rescued to wild-type phenotype at
108 and 107
M epi-BL (Fig. 2A), but these
concentrations did not induce noticeable responses such as elongating
hypocotyls and petioles from dwf12-1D and bri1-5.
In addition, root growth inhibition by concentrated epi-BL
in the dwf12-1D mutants was significantly less sensitive compared with wild type. Second, previously we have shown that bri1 mutants accumulate significant amounts of BRs (Noguchi
et al., 1999). Similarly, here we reported that BRs also accumulate in
dwf12-1D plants. Because increased BR signaling often
accompanies decreased levels of BL through negative feedback regulation
(Choe et al., 2001), it is likely that the mechanisms controlling
endogenous BR levels act downstream of the two signaling components
BRI1 and DWF12.
Recent structural determination of the human GSK3 revealed that the
N-terminal domain (55 amino acids) plays a key role as an
intramolecular inhibitory domain: Once Ser at position 9 from the N
terminus (Ser-9) is phosphorylated, this domain occupies the active
site and prevents access to substrates (Dajani et al., 2001; ter Haar
et al., 2001). However, in DWF12, the first 15 amino acids,
corresponding to the self-inhibitory domain of human GSK3, are
missing, suggesting that the auto-inhibitory role of the N-terminal
region may be lacking in DWF12. Protein kinase B, which inactivates
GSK3 by phosphorylation at Ser-9, has also not been found in plants. In
addition, human GSK3 was found to be in an active kinase
conformation if Ser-9 is not phosphorylated: The structure of the human
GSK3 activation segment is completely superimposed with that of the
activated kinase ERK2-P2 (Dajani et al., 2001),
and the active site is buried when two monomers form a dimer. Thus,
dissociation into a monomer is required for activity of this protein.
We found that the residues participating in dimerization are well
conserved in DWF12 (white squares in Fig. 5). Based on these findings,
we postulate that DWF12, which is lacking the inhibitory N-terminal
domain, is a permanently active kinase that does not require prior
activation, and dimerization and dissociation may affect the activity
of this protein.
A search for possible protein modification sites in DWF12 using
ScanProsite utility (http://www.expasy.ch/prosite/) revealed that
the two acidic Glu residues at 263 and 264 could help the phosphorylation of the adjacent Thr residue at 261 (Thr-261), possibly
by casein kinase II, because these amino acids are most similar to the
CKII consensus phosphorylation site
(http://www.expasy.org/cgi-bin/get-prodoc-entry?PDOC00006). Because
this region, including Thr-261 to Glu-264 (TREE domain), is highly
conserved in GSK3s, it likely plays a critical role. Interestingly,
structural determination of the human GSK3 protein revealed that the
TREE domain is exposed at dimerization, implying that access by another
modifier like CKII is possible. Assuming that phosphorylation of
Thr-261 is essential in the regulation of DWF12, the dwf12
alleles may have negative effects on phosphorylation at Thr-261,
leading to the dominant nature of DWF12 mutant protein. Thus,
phosphorylation of the TREE domain in DWF12 could replace the protein
kinase B phosphorylation at Ser-9 as a negative regulatory event.
Alternatively, the TREE domain may define an interaction domain with
itself or with another protein, with the dwf12 mutations causing either stronger or reduced binding, resulting in a dominant phenotype. Our mapping and sequence data indicate that our
dwf12 mutants are allelic with the recently identified
BR-insensitive mutants bin2 (Li and Nam, 2002) and
ucu1 (Perez-Perez et al., 2002). Remarkably, the six
semidominant alleles are all missense mutations in the TREE domain
(Table II), further emphasizing the importance of this domain in the regulation of BIN2/UCU1/DWF12.
|
To address the role of BIN2/UCU1/DWF12 in BR signaling, Li and Nam
(2002) purified both a wild-type kinase and a kinase with the
bin2-1 mutation, and found that the mutant kinase
phosphorylated a substrate approximately 30% more than the wild-type
kinase. These authors provide further support for the model that the BR insensitivity of the bin2/ucu1/dwf12 mutants is caused by an
overly active kinase by generating plants expressing the
bin2-1 mutant kinase under the control of its own promoter
in addition to the two endogenous BIN2(+) copies. In these plants,
there was a good correlation between RNA levels and the severity of the
dwarf phenotype (Li and Nam, 2002). Reducing the levels of the
BIN2/UCU1/DWF12 RNA can suppress the phenotype of a weak
bri1 allele, providing further evidence that this gene
encodes a negative regulator that acts downstream of BRI1 (Li and Nam,
2002).
These results indicate that BIN2/UCU1/DWF12 is a kinase of the GSK3
family with a role in BR signaling. Our evidence includes the observations that dwf12 mutants share characteristic BR
dwarf phenotypes, including short stature, insensitivity to BRs, and the accumulation of BRs. Characterization of the DWF12 gene
indicates that the encoded protein shows >70% sequence identity to
the human GSK3 protein, except that DWF12 lacks the N-terminal
auto-inhibitory domain containing the Ser-9 that is phosphorylated in
GSK3. Our model is that DWF12 is a naturally active kinase that
functions as a repressor of BR signaling pathways. Because
BIN2/UCU1/DWF12 has no targeting sequences, it is most
likely located in the cytoplasm. This location predicts that
BIN2/UCU1/DWF12 operates downstream of BRI1, but there is no evidence
yet that BRI1 interacts with or phosphorylates BIN2/UCU1/DWF12. The
TREE domain does not match a phosphorylation site consensus derived
from in vitro studies of BRI1 (Oh et al., 2000).
Recently, Yin et al. (2002) provided evidence that BIN2 physically
interacts with a novel type of nuclear protein named BES1 (bri1-EMS-suppressor). Furthermore, Wang et al. (2002) also
showed that a BES1-like nuclear protein BZR1 (brassinazole resistant) acts downstream of BIN2 and plays a role as a transcriptional inhibitor
of BR biosynthetic genes. In the future, it will be important to
elucidate the signaling components that regulate BIN2, and to identify
additional components downstream of BIN2 that lead to the transcription
of BR biosynthetic and BR response genes.
| |
MATERIALS AND METHODS |
|---|
|
TOP
ABSTRACT
INTRODUCTION
RESULTS
DISCUSSION
MATERIALS AND METHODS
LITERATURE CITED
|
|---|
Plant Materials and Endogenous BR Analysis
More than 50,000 M2 seeds of Arabidopsis ecotype Ws-2 ecotype
were planted on presoaked Metromix (350, Grace Sierra, Milpitas, CA).
The seeds were cold treated (4°C) for 3 d and transferred to a
16-:8-h-light (200 µmol m2 s1):dark cycle
(22°C and 21°C, and 70%-90% humidity) until the plants reached
maturity. Forty-three mutants were selected based on their characteristic dwarf phenotype. BR treatment and genetic mapping of
these dwarfs showed that most of these were found to be alleles of
existing loci, and have been reported previously (Choe et al., 1999a).
However, among these mutants, five were not rescued to the wild-type
phenotype after topical application of BR, and were designated as
insensitive mutants. Three of the five were alleles of
bri1 (Noguchi et al., 1999). Two additional mutants were
out-crossed to Ws-2 wild type several times to dilute out background
mutations, and also crossed to the Col-0 ecotype to obtain a mapping
population. The mapping population consisted of 280 homozygous
F2 dwarf mutants.
BR dose response tests were performed according to the method described
in Choe et al. (1998). In brief, cold-treated seeds (3 d) of Ws-2 wild
type, dwf4-1, bri1-5, and
dwf12-1D were cocultured in 1× liquid Murashige and
Skoog media supplemented with designated concentrations of
epi-BL:0 (control), 109,
108, and 107 M. After
incubation for 3 d, the seedlings were recovered from the culture
media, their root and hypocotyl lengths were measured, and photographs
were taken using representative seedlings for each concentration.
In the analysis of root growth inhibition in response to
epi-BL, ABA (Gibco-BRL, Cleveland), and
2.4-D, seeds of wild type, dwf12-1D, and
bri1-5 were germinated on Murashige and Skoog solid media for 4 d, and transferred to plates supplemented with
109, 108, 107, and
106 molar concentrations of epi-BL, 0.5 µM ABA, and 2,4-D. Seedlings on the agar plates were
grown vertically for 7 more d in the light and their root length was measured.
Endogenous levels of BRs in 4-week-old dwf12-1D mutant
plants were determined using gas chromatography/mass spectrometry. Procedures for gas chromatography/mass spectrometry were described previously (Choe et al., 1999b), and the endogenous BR levels of
bri1-5 were taken for comparison from Noguchi et al.
(1999).
Map-Based Cloning
The approximate location of dwf12 in the
Arabidopsis genome was determined by testing genomic DNAs from 24 F2 homozygous dwf12 plants from a mapping
population with SSLP markers distributed on the five Arabidopsis
chromosomes. Markers included nga59, nga280, and nga111 from chromosome
1, nga1145 and nga168 from chromosome 2, nga172, nga162, and nga6 from
chromosome 3, nga8, nga1139, and nga1107 from chromosome 4, and nga151,
nga76, and nga129 from chromosome 5. PCR was performed as described by
Bell and Ecker (1994). In the course of fine mapping
dwf12, we developed new sets of SSLP markers. The novel
SSLP markers were developed based on the prediction available from the
Arabidopsis sequence table (http://www.Arabidopsis.org/cgi-bin/maps/Seqtable.pl?chr=4). The new SSLP markers are shown in Table III.
The names of the markers, orientation, sequences, corresponding
bacterial artificial chromosome clones, and the size of the PCR
products amplified using Col-0 DNA are included in the table. PCR
products were run on 4% (w/v) agarose gels for >2 h for
maximum separation of the polymorphic fragments.
|
The mutations in the two dwf12 alleles were detected and confirmed by sequencing genomic DNA from dwf12 homozygous mutants amplified using PCR. Primers used in the amplification of the genomic DNA and sequencing are, from 5' to 3', D12F2, gagggttttgagttctgagc; D12F3, gccaacatttcttacatctgct; D12F4, tttttcttgcctttgtttct; D12F5, tggctacaaaatcctcactg; D12R2, ggaagatctaacataacaaaggaagtaa; D12R3, gttacatggcggagcgagtt; D12R4, caagatagaagatacaagaaccgagaact; D12-OVF1, gtcgaattcgccatggctgatgataag; and D12-OVR1, gtctctagacccttttaagttccagattgattc.
The structure of the DWF12 gene was confirmed by
comparing the cDNA sequence with that of the genomic DNA. cDNA was
synthesized using D12-OVR1 as a primer for reverse transcriptase-PCR.
Ten exons and nine introns were delimited by local alignment of the two
sequences, and the schematic diagrams shown in Figure 4 were prepared
using BestFit (Genetics Computer Group, Madison, WI), Vector NTI
(InforMax, Bethesda, MD), and Photoshop (Adobe, San Jose, CA) software.
Multiple sequence alignment was performed using the protein sequences
available in Swiss-Prot protein knowledge bases. The His at 350 of the
KG3B_HUMAN sequence was corrected to Leu according to Dajani et al.
(2001) before comparison. The KGSQ_ARATH was chosen from 10 Arabidopsis
GSK-like sequences because it has the longest total amino acid
sequence. The five sequences were subjected to multiple sequence
alignment using the PileUp program of GCG package. The conserved
sequences were shaded using the BOXSHADE program
(http://www.ch.embnet.org/software/BOX_form.html), and further
annotation was carried out using Photoshop.
| |
ACKNOWLEDGMENTS |
|---|
We thank Amanda Ross, Brian Gregory, and Masayo Sekimoto for technical assistance, Laurence H. Pearl for comments on the structural importance of dwf12 mutations, and the sequencing facilities in the Arizona Research Laboratory at the University of Arizona (Tucson).
| |
FOOTNOTES |
|---|
Received June 25, 2002; returned for revision July 11, 2002; accepted July 19, 2002.
1 This work was supported by Ceres, Inc. (to S.C.), by the U.S. Department of Agriculture (grant no. 97-35304-4708), and by the Honors Undergraduate Research Grant Program and the Undergraduate Biology Research Program at the University of Arizona (grant to R.J.S.).
2 These authors contributed equally to the paper.
* Corresponding author; e-mail shchoe{at}snu.ac.kr; fax 82-2-872-1993
Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.010496.
| |
LITERATURE CITED |
|---|
|
TOP
ABSTRACT
INTRODUCTION
RESULTS
DISCUSSION
MATERIALS AND METHODS
LITERATURE CITED
|
|---|
-hydroxylation steps in brassinosteroid biosynthesis.
Plant Cell
10: 231-243
7 sterol C-5 desaturation step leading to brassinosteroid biosynthesis.
Plant Cell
11: 207-2217 reductase gene of Arabidopsis cause dwarfism due to a block in brassinosteroid biosynthesis.
Plant J
21: 431-443[CrossRef][Web of Science][Medline] reveals a primed phosphorylation mechanism.
Nat Struct Biol
8: 593-596[CrossRef][Web of Science][Medline]This article has been cited by other articles:
|
|
 |
|
  Z. Yan, J. Zhao, P. Peng, R. K. Chihara, and J. Li BIN2 Functions Redundantly with Other Arabidopsis GSK3-Like Kinases to Regulate Brassinosteroid Signaling Plant Physiology, June 1, 2009; 150(2): 710 - 721. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Peng, Z. Yan, Y. Zhu, and J. Li Regulation of the Arabidopsis GSK3-like Kinase BRASSINOSTEROID-INSENSITIVE 2 through Proteasome-Mediated Protein Degradation Mol Plant, March 1, 2008; 1(2): 338 - 346. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Ryu, K. Kim, H. Cho, J. Park, S. Choe, and I. Hwang Nucleocytoplasmic Shuttling of BZR1 Mediated by Phosphorylation Is Essential in Arabidopsis Brassinosteroid Signaling PLANT CELL, September 1, 2007; 19(9): 2749 - 2762. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Wrzaczek, W. Rozhon, and C. Jonak A Proteasome-regulated Glycogen Synthase Kinase-3 Modulates Disease Response in Plants J. Biol. Chem., February 23, 2007; 282(8): 5249 - 5255. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Belkhadir, X. Wang, and J. Chory Brassinosteroid Signaling Pathway Sci. Signal., December 5, 2006; 2006(364): cm4 - cm4. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Karlova and S. C. de Vries Advances in Understanding Brassinosteroid Signaling Sci. Signal., September 26, 2006; 2006(354): pe36 - pe36. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. B. Kim, M. Kwon, H. Ryu, S. Fujioka, S. Takatsuto, S. Yoshida, C. S. An, I. Lee, I. Hwang, and S. Choe The Regulation of DWARF4 Expression Is Likely a Critical Mechanism in Maintaining the Homeostasis of Bioactive Brassinosteroids in Arabidopsis Plant Physiology, February 1, 2006; 140(2): 548 - 557. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Tanaka, T. Asami, S. Yoshida, Y. Nakamura, T. Matsuo, and S. Okamoto Brassinosteroid Homeostasis in Arabidopsis Is Ensured by Feedback Expressions of Multiple Genes Involved in Its Metabolism Plant Physiology, June 1, 2005; 138(2): 1117 - 1125. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Cano-Delgado, Y. Yin, C. Yu, D. Vafeados, S. Mora-Garcia, J.-C. Cheng, K. H. Nam, J. Li, and J. Chory BRL1 and BRL3 are novel brassinosteroid receptors that function in vascular differentiation in Arabidopsis Development, November 1, 2004; 131(21): 5341 - 5351. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. H. Nam and J. Li The Arabidopsis Transthyretin-Like Protein Is a Potential Substrate of BRASSINOSTEROID-INSENSITIVE 1 PLANT CELL, September 1, 2004; 16(9): 2406 - 2417. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Nomura, C. E. Jager, Y. Kitasaka, K. Takeuchi, M. Fukami, K. Yoneyama, Y. Matsushita, H. Nyunoya, S. Takatsuto, S. Fujioka, et al. Brassinosteroid Deficiency Due to Truncated Steroid 5{alpha}-Reductase Causes Dwarfism in the lk Mutant of Pea Plant Physiology, August 1, 2004; 135(4): 2220 - 2229. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Goda, S. Sawa, T. Asami, S. Fujioka, Y. Shimada, and S. Yoshida Comprehensive Comparison of Auxin-Regulated and Brassinosteroid-Regulated Genes in Arabidopsis Plant Physiology, April 1, 2004; 134(4): 1555 - 1573. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Mora-Garcia, G. Vert, Y. Yin, A. Cano-Delgado, H. Cheong, and J. Chory Nuclear protein phosphatases with Kelch-repeat domains modulate the response to brassinosteroids in Arabidopsis Genes & Dev., February 15, 2004; 18(4): 448 - 460. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Chono, I. Honda, H. Zeniya, K. Yoneyama, D. Saisho, K. Takeda, S. Takatsuto, T. Hoshino, and Y. Watanabe A Semidwarf Phenotype of Barley uzu Results from a Nucleotide Substitution in the Gene Encoding a Putative Brassinosteroid Receptor Plant Physiology, November 1, 2003; 133(3): 1209 - 1219. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Shimada, H. Goda, A. Nakamura, S. Takatsuto, S. Fujioka, and S. Yoshida Organ-Specific Expression of Brassinosteroid-Biosynthetic Genes and Distribution of Endogenous Brassinosteroids in Arabidopsis Plant Physiology, January 1, 2003; 131(1): 287 - 297. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|
-Like Kinase
9,
10
