|
Plant Physiol, December 2002, Vol. 130, pp. 1883-1893
Genetic Complexity of Cellulose Synthase A Gene Function in
Arabidopsis Embryogenesis1
Tom
Beeckman,2
Gerhard K.H.
Przemeck,2 3
George
Stamatiou,2
Rachel
Lau,4
Nancy
Terryn,
Riet
De Rycke,
Dirk
Inzé, and
Thomas
Berleth*
Department of Plant Systems Biology, Flanders Interuniversity
Institute for Biotechnology, Ghent University, B-9000 Gent, Belgium
(T. Beeckman, N.T., R.D.R., D.I.); Institut für Genetik,
Ludwig-Maximilians-Universität, D-80638 München, Germany
(G.K.H.P.); and Department of Botany, University of Toronto, 25 Willcocks St., Toronto, Ontario, Canada M5S 3B2 (G.S., R.L., T. Berleth)
 |
ABSTRACT |
The products of the cellulose synthase A (CESA)
gene family are thought to function as isoforms of the cellulose
synthase catalytic subunit, but for most CESA genes, the
exact role in plant growth is still unknown. Assessing the function of
individual CESA genes will require the identification of
the null-mutant phenotypes and of the gene expression profiles for each
gene. Here, we report that only four of 10 CESA genes,
CESA1, CESA2, CESA3, and
CESA9 are significantly expressed in the Arabidopsis embryo. We further identified two new mutations in the RADIALLY SWOLLEN1 (RSW1/CESA1) gene of
Arabidopsis that obstruct organized growth in both shoot and root and
interfere with cell division and cell expansion already in
embryogenesis. One mutation is expected to completely abolish the
enzymatic activity of RSW1(CESA1) because it eliminated one of three conserved Asp residues, which are considered essential for -glycosyltransferase activity. In this presumed null
mutant, primary cell walls are still being formed, but are thin, highly
undulated, and frequently interrupted. From the heart-stage onward,
cell elongation in the embryo axis is severely impaired, and cell width
is disproportionally increased. In the embryo, CESA1,
CESA2, CESA3, and CESA9
are expressed in largely overlapping domains and may act cooperatively
in higher order complexes. The embryonic phenotype of the presumed
rsw1 null mutant indicates that the RSW1(CESA1) product
has a critical, nonredundant function, but is nevertheless not strictly
required for primary cell wall formation.
 |
INTRODUCTION |
Plant cell shape is a key
determinant in plant morphogenesis and is in turn strongly influenced
by the organization of the cell wall. Within the cell wall, cellulose
microfibrils constitute the major load-bearing structures, and their
oriented deposition confers differential extensibility to the wall
(Carpita and Gibeaut, 1993 ; McCann and Roberts,
1994 ). Presumably under the influence of the microtubular
cytoskeleton, microfibrils in the primary wall of growing cells are
deposited perpendicularly to the prospective elongation axis
(Wyatt and Carpita, 1993 ; Wymer and Lloyd,
1996 ). Once wrapped around a cell in parallel hoops, the
largely inelastic microfibrils are thought to efficiently restrict cell
expansion to a single dimension. In organs along the apical-basal axis, such as stems and roots, oriented microfibrils allow cells to expand
anisotropically, and in young meristematic tissues, they may even play
a role in establishing new growth directions and forming new organs
(Green, 1994 ). Because of the central role of cellulose
microfibrils in shaping plant morphology at the cellular and at the
organismal level, their formation is probably subject to complex
developmental controls.
Cellulose, a paracrystalline form of H-bonded -(1,4)-Glc chains
(McCann and Roberts, 1991 ; Carpita and Gibeaut,
1993 ), is thought to be synthesized by membrane-bound
complexes. Although these complexes can readily be visualized as
rosette-terminal complexes, cellulose synthesis activity is difficult
to assay in vitro. This problem has hampered biochemical approaches to identify cellulose-synthesizing enzymes (Delmer, 1999 ).
Cellulose synthase genes have been eventually discovered genetically in bacteria, and divergent homologs in plants have been identified (for
review, see Cutler and Somerville, 1997 ; Saxena and Brown, 2000 ).
Members of the cellulose synthase A (CESA) gene family in
higher plants are believed to encode isoforms of the cellulose synthase
catalytic subunit, but for most of these genes, the precise role in
developing plants remains to be characterized (Delmer, 1999 ).
Knowledge of the functions of individual CESA genes in
specific tissues or cell types will probably provide invaluable
analytical and biotechnological tools for a better understanding and
control of parameters underlying plant morphogenesis and physiology.
However, no loss-of-function mutants are presently available for most
CESA genes, and for some of the available mutants, it is not
clear to what extent they reduce the gene function. For example, two mutations have been reported for RADIALLY SWOLLEN1,
RSW1(CESA1), one of two CESA genes
implicated by mutation in primary cell wall formation (Arioli et
al., 1998 ; Gillmor et al., 2002 ). One of these
mutations is temperature sensitive and, at high temperatures, is
associated with reduced cellulose synthesis, disassembly of cellulose
synthase complexes, and radial expansions in young shoot and root
organs (Arioli et al., 1998 ; Williamson et al.,
2001 ). A presumably stronger mutation has very recently been
reported to affect embryo shape at room temperature, but in this mutant as well, it is not clear whether the RSW1(CESA1)
gene function is completely eliminated (Gillmor et al.,
2002 ). A second CESA gene in primary cell wall
formation, PROCUSTE1, PRC1(CESA6), is required specifically in roots and dark-grown hypocotyls (Desnos et al., 1996 ; Fagard et al., 2000 ).
CESA genes in secondary cell wall formation were identified
through mutations associated with xylem defects in inflorescence stems
and define the IRREGULAR XYLEM (IRX) genes
IRX1(CESA8) and IRX3(CESA7)
(Taylor et al., 1999 , 2000 ). Finally, mutations
conferring resistance to the herbicide isoxaben (ixr) were
found in the CESA3 and PRC1(CESA6)
genes (hence also referred to as IXR1 and IXR2
genes, respectively; Scheible et al., 2001 ;
Desprez et al., 2002 ).
Given the size of the gene family and the likely functional overlap
among its members, it will take considerable effort to sort out the
roles of individual genes. The complexity of this analysis can be
reduced through the isolation of null mutations in individual
CESA genes and through the identification of stages, in
which only a subset of the gene family is expressed. Here, we report
the isolation of new, strong mutations in the Arabidopsis RSW1(CESA1) gene, one of which seems to
completely abolish the enzymatic activity of the gene product and is
associated with extreme defects in primary cell wall and cell shape
already in embryos. In this presumed null mutant, residual cellulose
synthesis will probably reflect the activity of other CESA
genes. In this context, we show that only three other CESA
genes, CESA2, CESA3, and CESA9, are
significantly expressed in the embryo. These genes are expressed in
vastly overlapping domains, suggesting that none of them has a function
restricted to specific embryonic tissues or stages.
 |
RESULTS |
Identification of New Mutations in
RSW1(CESA1)
In a screen for embryo cell shape mutants, we isolated two allelic
mutations that were associated with dramatic distortions in seedling
morphology (Fig. 1A). Upon outcrossing to
wild type, abnormalities were observed in approximately 25% of the
F2 individuals (176 and 90 of 525 and 297, respectively) consistent with the recessive inheritance of the seedling
morphology trait. Phenotype and map position (flanking RFLP markers
g8300 and mi431) suggested that the mutations correspond to new
alleles of the RSW1(CESA1) gene, which was
confirmed in complementation tests with the temperature-sensitive allele rsw1-1 (Arioli et al., 1998 ). To
identify the molecular lesions in the two mutants (rsw1-20
and rsw1-45), we determined the genomic sequence of both
mutant alleles along with the Landsberg erecta
(Ler) wild-type strain in four independent DNA pools and localized single-point mutations in each of the two mutant alleles. Sequence analysis of the deduced mutant gene products revealed that the
mutation in the phenotypically stronger rsw1-20 mutation converted the third of three Asp residues within the conserved glycosyltransferase "D,D,D,QXXRW" motif to Asn (Fig.
2, A and C). Moreover, secondary
structure analysis predicted a disruption of the local -helix made
up of residue 779 to 785 in the rsw1-20 mutant (Fig. 2B).
These structural features strongly suggest complete loss of enzymatic
activity of the mutant gene product (Saxena and Brown,
1997 ; Saxena et al., 2001 ; see
"Discussion"). The mutation in allele rsw1-45 affected
an adjacent, yet less conserved, position and presumably did not
disrupt the local -helical structure (data not shown). The fact that
both mutants display similar phenotypic features at different levels of
severity provides genetic evidence that all features described below
are attributable to loss of RSW1(CESA1) function.

View larger version (118K):
[in this window]
[in a new window]
|
Figure 1.
Seedling phenotype of wild-type and
rsw1 mutants 5 d after germination. A and B, Seedlings
germinated in the light at 22°C (A) and 31°C (B). Genotypes from
left to right are Ler wild type, rsw1-45, and
rsw1-20. C, Ler wild-type and rsw1-20
mutant seedlings germinated at 22°C in the dark.
|
|

View larger version (19K):
[in this window]
[in a new window]
|
Figure 2.
Mutations in the RSW1(CESA1)
gene. A, Schematic diagram of RSW1(CESA1) protein indicating position
and identity of the predicted altered amino acid residues in the
rsw1-20 and rsw1-45 mutants. Gray, Conserved zinc
finger; black, transmembrane domains. Bottom, Conserved amino acids in
-glycosyltranserases. B, Predicted amino acid sequence and secondary
structure of rsw1-20 mutant and wild-type gene product.
Bold, Conserved residues or motifs; dashed, sheet; dotted, coil; waved,
helix. C, Nucleotide and amino acid sequence in mutant and wild-type
alleles. Deviations from wild-type sequence are in bold, and amino
acids are in one-letter code.
|
|
Seedling Phenotypes
Seedlings of light-germinated rsw1-20 and
rsw1-45 mutants appeared short and stout with an uneven
surface because of irregularly shaped and swollen cells in the
epidermis of both hypocotyl and cotyledons (Figs. 1A and 4F). In
rsw1-20 mutants, hypocotyl length was dramatically reduced
(27% of that of wild type; Table I), and
the diameter was increased by approximately one-third at the basal end.
In rsw1-45 mutants, the reduction in hypocotyl length was
somewhat less pronounced (42% of that of wild type; Table I).
Cotyledon size was also dramatically reduced, particularly in
rsw1-20 mutants. Barely any root growth was observed in
either mutant. All other analyzed defects, including internal cellular defects at various stages, were less severe in rsw1-45 than
in rsw1-20 mutants (data not shown), suggesting a
residual gene activity in rsw1-45 mutants. Unless otherwise
noted, we will restrict the description of mutant phenotypes to the
presumed null mutant rsw1-20.
We assessed hypocotyl elongation in rsw1-20 mutants
germinated in the dark. Hypocotyls of wild-type seedlings expand to a greater length when germinated in the dark than in the light. At least
one cellulose synthase isoform is selectively required in this
expansion process (Desnos et al., 1996 ; Fagard et
al., 2000 ). Hypocotyls of both light- and dark-germinated
mutant seedlings remained extremely short (Fig. 1C; Table I).
Therefore, RSW1(CESA1) gene function is stringently required under both
conditions, indicating that no gene activated specifically in the dark
can substitute for missing RSW1(CESA1) activity (see
"Discussion").
The two new mutations in the RSW1(CESA1) gene can
assist in classifying the previously identified rsw1-1
allele. This allele being temperature sensitive, the more severe
defects seen at high temperature (31°C) could be attributable to
temperature-sensitive properties of the mutant gene product. As an
alternative, however, it is possible that the increased demand for
cellulose synthesis at higher temperatures enhances abnormalities
whenever the RSW1(CESA1) function is reduced.
Additional alleles of the RSW1 gene allow us to distinguish
between these possibilities. At 31°C, rsw1-45 mutant
seedlings resemble rsw1-1 mutant seedlings
(Williamson et al., 2001 ), suggesting approximately
similar levels of residual gene activity in both mutants. However,
whereas rsw1-1 mutants become largely normalized and grow
long roots at room temperature (Williamson et al.,
2001 ), the morphology of rsw1-20 and
rsw1-45 was nearly identical at 22°C and 31°C (Fig. 1, A
and B; Table I). This result implies that the temperature sensitivity
of the rsw1-1 allele is largely, if not entirely,
attributable to a temperature-dependent activity of the
rsw1-1 mutant gene product.
Anatomy of rsw1-20 Mutants
Abnormal development in rsw1-20 mutant embryos occurred
often as early as at the first division of the embryo proper. However, abnormalities before the heart stage were observed only in a portion of
the mutants. For example, irregular horizontal divisions of apical
cells were observed in early embryos (13.3% embryos from heterozygous
parent, n = 90), but overall, the sequence of early cell divisions remained unchanged (Fig.
3, F-H). From the heart stage onward,
cell shape alterations and cell wall interruptions were observed in
approximately 25% of the progeny of heterozygous plants (21.2%
embryos from heterozygous parent, n = 151), suggesting that the RSW1(CESA1) function became crucial in
each mutant individual. A slight, but significant radial expansion of
cells in hypocotyls of mutant embryos was observed at heart stage (Fig.
3, H and I) and became more pronounced during torpedo and
bent-cotyledon stages (Fig. 3, K and M). At bent-cotyledon stage,
radial cell expansions in the stele were recognizable, but rather
subtle, whereas the radial expansion of the ground tissue and epidermal
layers was rather extreme (Fig. 3M). Moreover, cells in these layers
were often highly vacuolated and separated by incomplete cell walls. Interestingly, the overall cell arrangement in the hypocotyl and radicle, including the cell numbers in the apical-basal dimension, were
almost unchanged, resulting in the formation of very flat cells (Fig.
3M). In cotyledons, by contrast, primarily the length of the organ was
affected, and cotyledon cell numbers in the mutant were adjusted to the
altered organ size (Fig. 3M). Cell shapes in the cotyledons were far
less abnormal than in hypocotyls and radicles.

View larger version (167K):
[in this window]
[in a new window]
|
Figure 3.
Wild-type (A-E and L) and rsw1-20
mutant (F-K and M) embryogenesis. A and F, Octant stage; defects in
early embryos include abnormally oriented cell divisions. B through D
and G through I, Globular and heart stages; largely normal cell
arrangement, but mutant cells, particularly in the ground tissue of the
hypocotyl, are generally somewhat shorter and radially expanded. E and
K, Torpedo stage; pronounced length-to-width changes are evident in
cells along the length of the embryo, particularly in the outer layers.
L and M, Bent-cotyledon stage; short cotyledons with fewer cells along
the length (for example, in the palisade mesophyll layer), which are,
however, relatively normal in shape. In the hypocotyl and radicle, by
contrast, the number of cells in the longitudinal dimension is nearly
normal, whereas the length to width ratio of cells in nonvascular
tissues is extremely distorted (compare wild-type and mutant cell
number and cell shape in the outer cortex layer, enlarged in inlets).
Arrow in inlet points at one of many incomplete cell divisions in the
outer layers of the mutant hypocotyl. Scale bars = 20 µm in A,
B, F, and G, same magnification; 50 µm in C, D, H, and I, same
magnification; 75 µm in E and K; and 100 µm in M and L, same
magnification.
|
|
At germination, the total cell wall area increased very rapidly in
wild-type seedlings and to a lesser extent also in the mutant. We did
not observe a more frequent appearance of incomplete cell walls as a
result of this expansion, and cell walls in mutant seedlings were
apparently not more disorganized than in bent-cotyledon-stage embryos
(data not shown). Most conspicuously, mutant cells in all seedling
tissues remained extremely tightly packed allowing for considerably
less intercellular space. This was particularly evident in cells of the
mesophyll, where the abundant intercellular cavities present in wild
type were absent in the mutant (Fig. 4, A
and B). Mutant cells also failed to attain certain complex morphologies. Epidermal pavement cells did not display the typical interdigitated pattern, and stomatal guard cells were not produced at
all (Fig. 4, C and D). On vegetative leaves, no trichomes were observed
(data not shown). In contrast to trichomes, root hairs are exclusively
generated by tip growth, and the mutant remarkably produced root hairs
of approximately one-half the normal length (Fig. 4, G and H). Also
transmission of the rsw1-20 allele through mutant pollen was
not reduced. Together, these two observations may reflect a reduced
requirement for RSW1(CESA1) in tip-growing cells.

View larger version (117K):
[in this window]
[in a new window]
|
Figure 4.
Tissues in wild-type (A, C, E, G, and I) and
rsw1-20 (B, D, F, H, and K) light-germinated seedlings
5 d after germination. A and B, Cross sections through cotyledon
mesophyll. Intercellular spaces are strongly reduced, and no air
cavities are formed in the mutant. C and D, Abaxial epidermis of
cotyledons. Note the rounded cell shape and the absence of guard cells
in the mutant. E and F, Hypocotyl epidermis cells, very regularly
shaped in the wild type and generally irregular in the mutant. Within
the irregular epidermal layer, some cells become extremely large. G and
H, Root hairs are generally shorter and often thicker in the mutant. I
and K, Shoot apical meristem, median section. Note fewer cells,
incomplete cell divisions (arrows), and a highly irregular cell pattern
in the mutant meristem. Except for a separation of the epidermal layer,
no zonation is visible at this stage. Bright-field (A, B, E, F, I, and
K) and whole-mount images with differential contrast optics (C, D, G,
and H). Scale bars = 50 µm in A through H and 75 µm in I and
K.
|
|
In the mutant shoot apical meristem, cell divisions appeared highly
irregular and were often incomplete (Fig. 4, I and K). Except for a
discernable epidermal layer, no reproducible cell layer or internal
zonation was apparent. Within 19 d of culture, seedlings produced
an average of 7.6 extremely small vegetative leaves (SD = 1.6, n = 28). In the mutant primary root meristem, cell
arrangements were normal, but cell dimensions were extremely distorted
(Fig. 3M). Primary root growth was extremely limited, and no lateral
roots were formed.
Cellular Defects in rsw1 Mutant Embryos
Differences in primary cell wall texture could be visualized by
staining of the cell wall polysaccharides. As shown in Figure 5, A and B, mutant cell walls had a
granular appearance with short projections to the inside. When viewed
with the transmission electron microscope, markedly thinner, but again
uneven, cell walls were observed in all analyzed tissues of the mutant,
particularly in cells of the epidermis (Fig. 5, C-F). Most
conspicuously, the size of intercellular spaces was strongly reduced in
all tissues (Fig. 5, A and B). The intercellular spaces in between
tissue layers and particularly at wall junctions were partially filled with excess wall material (Fig. 5, B and F).

View larger version (123K):
[in this window]
[in a new window]
|
Figure 5.
Cell wall structure and composition in wild-type
and rsw1-20 mutant embryos. A and B, Periodic acid-Schiff's
stained longitudinal sections in the hypocotyl of bent-cotyledon stage
embryos. Note the presence of intercellular spaces in the wild type
(A), which are absent in the mutant (B), and the uneven, granular
appearance of mutant cell walls (inset). C thorough F, Epidermal cell
walls from hypocotyls of bent-cotyledon stage embryos of wild type (C
and E) and rsw1-20 (D and F). Note that mutant cell walls
are thinner and that the middle lamella is usually not discernible.
Intercellular spaces in the wild type (E) are usually filled with wall
material in rsw1-20 mutants (F). G and H, Calcofluor stained
cross sections in the hypocotyl of bent-cotyledon stage wild-type (G)
and rsw1-20 mutant (H) embryos. Overall reduced staining in
mutant walls indicates reduced -glucan content. Note the uneven
staining intensity in mutant cell walls. I, Densitometric
quantification of cell wall -glucan content measured on digital
images from calcofluor-stained hypocotyl cells of bent-cotyledon stage
embryos. K, Spectrophotometrical determination of -glucan content in
wall preparations of wild-type and mutant seedlings after germination
and growth for 7 d at 31°C. A and B, Bright-field optics images;
C through F, transmission electron micrographs; and G and H,
epifluorescence optics. Scale bars = 20 µm in A, B, G, and H;
insets, 2× magnification; 1 µm in C and D; and 500 nm in E and
F.
|
|
To explore cell wall composition, we chose calcofluor staining to
visualize biochemically wall composition across the entire embryo.
Calcofluor specifically stains weakly or non-substituted -glucans,
which are probably represented by cellulose in these sections
(Hughes and McCully, 1975 ). As shown in Figure 5, G and H, mutant walls again varied in thickness, and the staining was correspondingly nonuniform, in contrast to the even staining of wild-type cell walls. Furthermore, far less stainable material accumulated in the mutant. Quantification of the relative calcofluor fluorescence in identically treated sections from mutant and wild-type bent-cotyledon-stage hypocotyl indicated that mutant cell wall -glucan content was reduced to 22.5% ± 4.2% of the wild-type value (Fig. 5I). We measured the corresponding -glucan content in
material extracted from mutant seedlings as 30% of that of the
wild-type value (Fig. 5K). Importantly, parallel measurements of
available rsw1 mutants grown at 31°C under identical
conditions indicated that -glucan content is lowest in
rsw1-20 mutants (Fig. 5K).
Expression Profiles of CESA Genes
Residual cellulose synthesis in the presumed null-mutant
rsw1-20 may reflect the activity of cellulose synthase
isoforms, encoded by other CESA genes. To identify candidate
CESA genes with overlapping functions, we assessed the
expression of 10 Arabidopsis CESA genes in embryos at three
postembryonic stages by semiquantitative reverse transcription
(RT)-PCR. As shown in Figure 6, all 10 CESA genes were expressed at the three postembryonic stages
(young plant, stem, and flower), whereas only CESA1,
CESA2, CESA3, and CESA9 were
significantly expressed in the embryo. In addition, very weak embryonic
transcript levels were reproducibly detected for
CESA5.

View larger version (56K):
[in this window]
[in a new window]
|
Figure 6.
CESA gene expression in embryos, young
plants, and mature plants. Semiquantitative RT-PCR of total RNA
prepared from embryos, seedlings, inflorescence stems, and flowers.
Lanes 1 to 10, CESA1 to CESA10 RT-PCR products;
R, approximately evenly expressed ROC1 gene (Lippuner
et al., 1994 ); numbers on the right indicate the size of the
PCR products in base pairs.
|
|
The absence of detectable embryonic expression for CESA4,
CESA6, CESA7, CESA8, and
CESA10 suggests that they are not required for embryonic
primary wall formation (see "Discussion"). For CESA2, CESA3, CESA5, and CESA9 genes
expressed along with RSW1(CESA1) in the embryo,
no embryonic mutant defects have been reported. To gain insight into
the roles of these four genes in embryogenesis, we determined their
embryonic mRNA expression domains by in situ hybridization to sectioned
embryos. No CESA5 transcripts were detected at any stage
(data not shown), indicating that CESA5 expression was below
the detection threshold in all analyzed stages and tissues (see
"Discussion"). As shown in Figure 7,
CESA1 was expressed throughout the embryo in the late-heart
and torpedo stage, and was still visible at the bent-cotyledon stage.
CESA2 expression had a very similar spatial and temporal
pattern but at a somewhat reduced expression level, whereas expression
of CESA3 and CESA9 appeared stronger in
cotyledons than in hypocotyls and roots. The expression of all four
genes decreased toward the bent-cotyledon stage, at which
CESA9 was barely detectable. Overall, the expression of none
of the four genes was restricted to specific cell types or stages,
suggesting that they may collectively contribute to cell wall formation
throughout the embryo.

View larger version (135K):
[in this window]
[in a new window]
|
Figure 7.
Expression pattern of CESA gene mRNA in
wild-type (Col-0) embryos at heart/early torpedo
(A-D), late torpedo (E-H), and bent-cotyledon (I-M) stage.
Hybridization with antisense (A-M) and sense probes (N-Q). A, E, I,
and N, RSW1(CESA1); B, F, K, and O,
CESA2; C, G, L, and P, CESA3; and D, H, M, and Q,
CESA9.
|
|
 |
DISCUSSION |
Great efforts are currently being made to identify the role of
individual CESA genes (for review, see Delmer,
1999 ; Richmond, 2000 ; Richmond and
Somerville, 2001 ). The results of these investigations could be
relevant for many crop species, because the high degree of conservation
among orthologs from different plant species compared with paralogs
within a given species suggests conserved functional specialization
within the gene family (Holland et al., 2000 ). The
identification of null mutations in CESA genes and of
developmental stages with reduced genetic complexity can greatly
facilitate this analysis. Here, we have identified a highly probable
null mutation in the RSW1(CESA1) gene and show
that only a subset of CESA genes is expressed along with
RSW1(CESA1) in the Arabidopsis embryo. Therefore,
we suggest embryogenesis as a suitable stage of reduced CESA functional
complexity to study the genetics of primary cell wall formation. As a
first step, we have recorded CESA gene expression patterns
during embryogenesis.
Loss of Gene Function in rsw1-20 Mutants
The structural properties of processive
-glycosyltransferases have been studied extensively (for
summary, see Saxena and Brown, 1997 ; Saxena et
al., 2001 ). Three Asp residues within the "D,D,D,QXXRW"
motif are conserved from bacteria to plants. Although it is not
finally resolved which of the Asp residues serve as bases during the
catalytic reaction, two should be required for two glycosidic linkages
formed simultaneously or sequentially during the synthesis of
cellulose. Moreover, only the third Asp residue, which is affected in
rsw1-20 mutants, is located within "domain B," the
characteristic domain of processive -glycosyltransferases (Saxena et al., 2001 ). Finally, site-directed
mutagenesis in bacteria has directly demonstrated that the exchange of
any of the three Asp residues results in a reduction of
-glycosyltransferase activity to less than 1% of the wild-type
level (Saxena et al., 2001 ). We conclude that
rsw1-20 mutants lack all -glycosyltransferase activity
provided by the RSW1(CESA1) locus and can
therefore serve as a suitable genetic background to assess the
contribution of other cellulose synthase genes. The presumed
null-mutant phenotype supports a pivotal role of
RSW1(CESA1) in primary wall formation but also
indicates that loss of RSW1(CESA1) gene function does not
obstruct embryogenesis and even allows for early stages of vegetative development.
RSW1(CESA1) Function in Cell Division
and Cell Expansion
Cell wall defects in rsw1-20 embryos are extremely
severe in late-stage embryos and in apical meristems. By contrast, cell elongation in germinating mutants does not seem to be associated with
additional wall disruptions. Therefore, cell wall integrity seems to be
stringently dependent on RSW1(CESA1) activity in
rapidly dividing cells but less critical in the elongation of
nondividing cells. This differential requirement could reflect the fact
that rsw1 mutations do not interfere with cell division but
strongly restrict cell expansion and thereby reduce the requirement for cellulose synthesis selectively in expanding cells.
Mutations in RSW1(CESA1) restrict cell expansion
during germination in light and in darkness, indicating that no
germination-specific cellulose synthase activity can substitute for the
RSW1(CESA1) function. It has previously been noted that the activities
of the RSW1(CESA1) product and the dark-growth-specific cellulose synthase isoform PRC1(CESA6) are not redundant (Desnos et al., 1996 ; Fagard et al., 2000 ). Because both
rsw1 and prc1 homozygous single mutants are
impaired in cell expansion and double heterozygous individuals look
normal, both proteins could possibly constitute necessary components of
a higher order complex (Fagard et al., 2000 ). Our
observations are consistent with this interpretation for the action of
both gene products in elongating hypocotyls. However,
RSW1(CESA1) must also be able to act in the
absence of PRC1(CESA6), because
PRC1(CESA6) is not expressed in the embryo. Therefore, the strongest argument for a simultaneous nonredundant action of the two gene products is the inability of
RSW1(CESA1) to substitute for the
PRC1(CESA6) function in the elongating hypocotyl. The reciprocal inability of PRC1(CESA6) to
substitute for the RSW1(CESA1) function could
simply reflect the irreversibility of cell wall defects in
rsw1 mutants.
Cell Type-Specific Requirement for
RSW1(CESA1) Function
Plant cells in axial organs, such as stems and roots, deviate most
extremely from isotropic cell shapes. Axially organized microfibrils in
these cells have been genetically implicated in the acquisition of
anisotropic cell shapes by mutations that affect cell wall composition
and simultaneously lead to more isotropic cell shapes (Arioli et
al., 1998 ; Nicol et al., 1998 ; Lane et al., 2001 ; Lukowitz et al., 2001 ; Gillmor
et al., 2002 ). Dramatic reductions in the cellulose content of
embryonic cell walls associated with mutations in the -glucosidase I
gene KNOPF (KNF) as well as in
RSW1(CESA1) have recently been described to cause
corresponding shifts toward isotropic embryo shape (Gillmor et
al., 2002 ). The mutations in KNF indicate a
requirement for N-glycosylation of a component or substrate
in cellulose synthesis. In knf mutants, the cellulose
content of embryo cell walls is reduced to approximately 14% of the
wild-type values, and mutant embryos adopt a nearly spherical shape.
The newly identified rsw1-2 allele also affects embryo shape
but apparently less severely than rsw1-20 mutations, suggesting that there is some residual gene activity in these mutants.
The availability of multiple allelic mutations with related embryonic
defects increases the reliability of functional interpretations drawn from the phenotype.
In rsw1-20 mutants, the normal width to length ratio in the
embryonic hypocotyl of approximately 1:4 gradually approaches 1:<2 at
late embryonic stages (Fig. 3M). Isotropic organ shape seems to be the
biophysically most favorable condition, adopted whenever cell walls
fail to acquire differential extensibility (Gillmor et al.,
2002 ), but local modulations of this effect deserve consideration. First, there seems to be a differential effect on cells
in the main axis of the plant as opposed to cells in lateral shoot
organs. Although elongation of the hypocotyl is extremely reduced and
associated with considerable radial expansion in several tissue layers,
no consistent radial expansion was observed in cotyledons.
Second, particularly strong epidermal defects have consistently been
observed in cell wall mutants and most probably reflect the particular
strain encountered by walls on the outer surface of the plant (for
summary, see Nicol and Höfte, 1998 ). In rsw1-20 mutants, instead of a smooth layer of interdigitated pavement cells, an
uneven cobblestone surface is generated, and cells of complex
morphology, such as trichomes and stomatal guard cells, are not formed.
The highly uneven cell shape in the epidermis suggests that reduced
cellulose synthase activity is associated with stochastic variations in
wall stability (Desnos et al., 1996 ), which, in turn,
should be incompatible with the acquisition of complex cell shapes,
such as trichomes and guard cells. These effects might be further
enhanced in the Ler genetic background. Therefore, even the
seemingly cell type-specific defects in the epidermis may result from a
general weakening of the wall structure.
Dissecting Overlapping CESA Functions
Assigning functions to individual members of large gene families
eventually requires the analysis of multiple loss-of-function mutants.
Expression studies cannot replace, but potentially facilitate, this
genetic analysis. For genes such as cellulose synthase genes that are
expected to act locally, probably cell autonomously, expression studies
can reduce the complexity of future mutant analysis, because only genes
co-expressed at the same stage or tissue need to be examined for
potentially redundant functions.
Expression profiles of CESA genes have been studied or
deduced from expressed sequence tag frequencies in several species, but
CESA expression in Arabidopsis embryos has not been reported yet (Fagard et al., 2000 ; Holland et al.,
2000 ; Dhugga, 2001 ; Richmond and
Somerville, 2001 ; Scheible et al., 2001 ). We
noticed that transcripts of only five of 10 classified Arabidopsis
CESA genes were detected by RT-PCR in RNA from embryos, of
which one had only an extremely low expression level. By contrast,
transcripts of all 10 genes were readily detectable at all
postembryonic stages. We observed similar expression profiles in three
independent assays, but rather than focusing on the relative transcript
abundance of CESA genes at various stages, we aimed at
detecting minute amounts of embryonic expression. No transcripts of
CESA4, CESA6, CESA7, CESA8,
and CESA10 were found even after extending the number of
amplification cycles up to 32 in RT-PCR of embryonic RNA. The absence
of CESA4, CESA6, CESA7,
CESA8, and CESA10 transcripts from the embryonic
RNA pool is consistent with previously assigned roles for the
IRX3(CESA7) and IRX1(CESA8)
genes in secondary wall formation and for
PRC1(CESA6) in cell expansion at germination (Taylor et al., 1999 , 2000 ; Fagard
et al., 2000 ). On the basis of their expression pattern, we
propose that all five genes (CESA4, CESA6,
CESA7, CESA8, and CESA10) are not
involved in embryonic cell wall formation, which also may be the case
for CESA5. Expression levels of CESA5 are far
below those of any other embryonically expressed CESA gene
in all cell types and could be gratuitous.
In situ hybridization was used to further dissect expression profiles
of embryonically expressed CESA genes. These expression profiles were found to largely overlap, and all four genes were generally expressed throughout the embryo up to the bent-cotyledon stage, which could reflect their collective requirement throughout the
embryo. Cellulose synthase complexes are presumably heteromeric at any
stage, and a minimum of at least two types of subunits has been
proposed (Scheible et al., 2001 ). Our results suggest that no more than four CESA gene products are required for the formation of a functional complex in the embryo and that even a complex
made up of only the active products of CESA2,
CESA3, and CESA9 could retain limited
functionality. This conclusion is based on the observation that despite
marked cell wall defects, primary cell walls are formed in
rsw1-20 mutants. The recessive segregation of the
rsw1-20 mutant phenotype indicates that the mutant
RSW1(CESA1) product is either not incorporated or tolerated as an
inactive component in the cellulose synthase complex.
Because CESA2, CESA3, and CESA9 are
coexpressed with RSW1(CESA1) in virtually all
embryonic tissues, their inability to substitute for RSW1(CESA1)
function in these tissues, indicates functional divergence at the level
of the gene products. By contrast, the degree to which
CESA2, CESA3, and CESA9 can substitute
for each other's function is unclear. The products of CESA2
and CESA9 share extensive sequence similarity and the
absence of identified mutants as well as of dramatic defects in
CESA2 antisense lines (Burn et al., 2002 )
could be attributable to extensive functional overlap between these two
genes. Both genes are also related to
PRC1(CESA6), which in turn has been shown to act
nonredundantly with RSW1(CESA1) during
germination (Fagard et al., 2000 ). The fourth coexpressed gene,
CESA3(IXR1) seems to have a unique function in
higher order complexes, because CESA3 antisense plants have
recently been shown to be impaired in cell elongation in the
postembryonic shoot and because overexpression of CESA3 did
not normalize the rsw1-1 mutant phenotype (Burn et
al., 2002 ). Taken together, at least three of the four
CESA products coexpressed in most cells of the embryo seem
to have unique functions in cellulose synthase complexes, and one
possible scenario is therefore that ideally all four gene products are
present in a complex, but that the loss of CESA2 and
CESA9 would have relatively minor consequences. Given the reduced complexity of CESA function in the highly reproducible cell
pattern in Arabidopsis embryogenesis, this stage seems to be best
suited to genetically trace the requirement for each subunit in primary
cell wall formation.
 |
MATERIALS AND METHODS |
Plant Growth Conditions
Mutants rsw1-20 and rsw1-45 were
isolated from ethyl methyl sulfonate mutagenesis of Ler
seeds of Arabidopsis (Jürgens et al., 1991 ).
Seedlings were germinated and grown on one-half Murashige and
Skoog (1962) medium supplemented with 1.5% (w/v) Suc at the indicated temperatures. For germination in the dark, seeds were cold-treated for 48 h and then exposed to fluorescent white light (80 µM m 2 s 1) for 2 h to
synchronize germination. Subsequently, plates were wrapped in three
layers of aluminum foil. For culture in the light, seeds were
cold-treated for 48 h and then placed under continuous fluorescent
white light (80 µM m 2s 1).
Embryos were isolated from plants that were grown under long-day (16 h)
light cycles in growth chambers (Conviron, Manitoba, Canada) at the
indicated temperatures. Unless stated otherwise, wild type refers to
the Ler line.
Measurement of Hypocotyl Length
Growth of seedlings was arrested by adding an aqueous solution
of 0.4% (w/w) formaldehyde. Hypocotyls and roots were spread on agar
plates, and hypocotyl lengths were measured on digitally captured images.
Light Microscopy
Samples for light microscopy were processed as described by
Beeckman et al. (2000) . To quantify the -glucan
content of cell walls, transverse sections (2 µm) of seeds embedded
in LR White (London Resin, Basingstoke, UK) were made from wild type
and mutant. The sections were stained with 0.07% (w/w) calcofluor
white M2R (Sigma-Aldrich, St. Louis) in phosphate-buffered saline for
10 min, rinsed in phosphate-buffered saline, and mounted in Vectashield (Vector Laboratories, Burlingame, CA). Computer images of well-oriented cross sections through the hypocotyl were captured using an inverted (Axiovert 100M) confocal microscope (LSM510, Zeiss, Jena, Germany) equipped with an UV (364 nm) laser (Coherent Enterprise,
LPS-Lasersysteme, Mössingen, Germany) and HFT UV 375/BP 385-470
as filter combination. Average fluorescence of cell walls of cortical
cells from 10 independent mutant and wild-type embryos was determined
by measuring the average pixel density of selected cell walls using the
ImageJ analysis freeware software version 1.26 ImageJ (developed by
Wayne Rasband, Research Services Branch, National Institute of Mental
Health, Bethesda, MD). The same software was used to determine the
cross-sectional area of selected cell walls. Relative fluorescence was
reported as integrated density, which is the product of the
cross-sectional area and the average fluorescence of cell walls.
Polysaccharides in cell walls were visualized through periodic
acid-thiocarbohydrazide silver proteinate staining (PATAg;
Roland and Vian, 1991 ).
Measurement of Cellulose Content
Wild-type and rsw1-20 seeds were germinated and
grown in continuous light at 31°C. Seedlings were harvested and
frozen in liquid nitrogen 7 d after germination. Crude cell walls
were extracted as described by Reiter et al. (1993) .
Plant samples of 20 mg of wall material (dry weight) were processed
together with 20 mg of filter paper (cellulose content: 80% as a
standard). Cellulose was isolated and solubilized by the method of
Updegraff (1969) . Cellulose content was deduced from Glc
concentration measured by the anthrone method as described by
Scott and Melvin (1953) . Three independent measurements
were performed.
Transmission Electron Microscopy
Specimens for electron microscopy were fixed in 2.5% (w/w)
glutaraldehyde and 4% (w/v) paraformaldehyde in cacodylate buffer for
4 d at 4°C, post-fixed in 1% (v/v) OsO4 for
2.5 h at 4°C, and contrasted with 1% (v/v) uranyl acetate at
4°C; ultra-thin sections were analyzed with a transmission electron
microscope (Siemens, Karlsruhe, Germany).
Sequence Analysis
Approximately 4 kb of genomic DNA encompassing the entire
RSW1(CESA1) transcription unit defined by
the external primer sequences (5'-gagatgccgtattgaatcgg and
3'-catggaatcaccttaactgcc) were amplified in multiple PCR reactions on
DNA from the Ler background line and from homozygous
rsw1-20 and rsw1-45 mutants. PCR
fragments were directly sequenced by the dideoxy chain termination
method (Sanger et al., 1977 ) on an ABI377 automated
sequencer (PerkinElmer Instruments, Norwalk, CT). Single-base pair
deviations from Ler in the two mutant lines were
confirmed in four independent DNA samples of each genotype. No other
sequence deviations in mutant lines were reproduced from independent
DNA samples. Secondary structure prediction in protein sequences was
performed with the PREDATOR program
(http://mips.gsf.de/mips/staff/frishman; Frishman and Argos, 1997 )
using default parameters.
Semiquantitative RT-PCR
Embryos of heart to bent-cotyledon stages were excised from
siliques. Young plants were harvested after growth on Murashige and
Skoog medium containing 1.5% (w/v) Suc at 25°C for 7 d. Stem tissue and flowers were obtained from the upper infloresence of plants
grown for 3 weeks at 22°C. Total RNA was isolated with RNeasy
(Qiagen, Hilden, Germany) according to the manufacturer's instructions. Semiquantitative RT-PCR of total RNA was performed with
One-Step-RT-PCR (Qiagen) according to the manufacturer's instructions.
In each reaction, 100 ng of total RNA was used. The length of an
intron-spanning RT-PCR product of the ACT7 transcript (McDowell
et al., 1996 ) confirmed the absence of DNA contamination in all
RNA preparations. Specificity of CESA gene PCR products was controlled by analytical restriction digests. Approximate linearity
of the PCR reaction was monitored by comparing relative amounts of PCR
products after 24, 26, and 28 cycles. An amplification fragment from
the ROC1 transcript (Lippuner et al.,
1994 ) served as expression standard of an evenly expressed
gene. Cycling conditions were: 50°C for 30 min, followed by
incubation at 95°C for 15 min, 26 cycles of 94°C for 30 s,
55°C for 45 s, and 72°C for 1 min, and one cycle at 72°C for
10 min. Primer sequences were ACT7-F, ggtgaggatattcagccacttgtctg;
ACT7-R, tgtgagatcccgacccgcaagatc; ROC1F,
caaacctcttcttcagtctgatagaga; ROC1R, gagtgctcattccttatttctggtag; Ath-B(CESA3) F, gttccgcagacttgccagat; Ath-B(CESA3) R,
caagctacattcccgagtcca; Ath-A F, cactctcttcacgccttaacacc; Ath-A R,
gaggcgacacagaattaacatcc; IRX3 F, tctgctgaggctatgctgtatgg; IRX3 R,
agagacagcgaaccagatttcac; IRX1 F, taggtctcccatctgcaacact; IRX1 R,
tgagcgtcttgttgttcagc; CESA4 F, gcgatgaggtcaaagacgat; CESA4 R,
tctttccccaacacacttcc; CESA5 F, ggactgcctttgattgaactc; CESA5 R,
tcagacaagaagaatccctcaca; CESA6 F, ttcccacggatcaaagagag; CESA6 R,
gtctccaagcatgcggatt; CESA9 F, tggtttggtcgattcttcttg; CESA9 R,
cagcatccattcagggtctt; CESA10 F, attcgccatcgattcaaatg; and CESA10 R, taccacaatcgttcggtgaa.
In Situ Hybridization
Blunt-end PCR products for CESA1, CESA3, CESA5, and
CESA9 (primer sequences, see above) were inserted in both
orientations into pBluescript (Promega, Madison, WI); for
CESA2, a fragment bordered by the sequences
gctaagggggaccagtgtt and caaaagaattaatttaggggtaacaaa was chosen.
Orientation of the inserts was determined by analytical PCR. Sense and
antisense transcripts were generated by transcription from the T7
promoter. Antisense probes were linearized in the plasmid polylinker or
at gtactgttgagttcaactaccctcagaa (CESA3) and
agaatctgtggtcttgactgtttaaa (CESA9) to ensure specificity. Maximum similarity to any database sequence for any antisense probe was
below 10%. All probes were spotted on nylon membranes (Amersham
Biosciences UK, Ltd., Little Chalfont, Buckinghamshire, UK) along with
labeled RNA controls (Roche Diagnostics, Brussels) to monitor the yield
of digoxigenin-labeled RNA. Sensitivity of hybridization to sections of
bent-cotyledon-stage embryos was tested by hybridization of control
probes. Preparation of tissue sections, hybridization, and exposure
were performed as described (Jackson, 1992 ).
 |
ACKNOWLEDGMENTS |
We would like to thank Richard E. Williamson (Australian
National University, Canberra, Australia) for providing the
rsw1-1 mutant and for helpful suggestions, Gerd
Jürgens and Ulrike Mayer (Universität Tübingen,
Germany) and Ben Scheres (University of Utrecht, The Netherlands) for
providing mutant seeds, Heiko Schoof and Gerhard Wanner (Technical
University Munich, Germany) for help with protein secondary structure
analysis and transmission electron microscopy and for various
suggestions on the manuscript, respectively, and Rebecca Verbanck and
Martine De Cock (Ghent University, Belgium), for help in
preparing figures and manuscript.
 |
FOOTNOTES |
Received June 27, 2002; returned for revision July 22, 2002; accepted August 29, 2002.
1
This work was supported by the Multidisciplinary
Network program of the Natural Science and Engineering Research Council
of Canada, by the Interuniversity Poles of Attraction Program (Belgian State, Prime Minister's Office, Federal Office for Scientific, Technical and Cultural Affairs; grant nos. P4/15 and P5/13), and by the
European Community BIOTECH Research Program (grant no. ERB-BIO4-CT96-0217).
2
These authors contributed equally to the paper.
3
Present address: Institute of Experimental Genetics,
GSF-National Research Center for Environment and Health, D-85764
Neuherberg, Germany.
4
Present address: Department of Genetics and Genomic
Biology, The Hospital for Sick Children, Toronto, Canada M5G 1X8.
*
Corresponding author; e-mail berleth{at}botany.utoronto.ca; fax
416-978-5878.
Article, publication date, and citation information can be found at
www.plantphysiol.org/cgi/doi/10.1104/pp.102.010603.
 |
LITERATURE CITED |
-
Arioli T, Peng L, Betzner AS, Burn J, Wittke W, Herth W, Camilleri C, Höfte H, Plazinski J, Birch R, et al
(1998)
Molecular analysis of cellulose biosynthesis in Arabidopsis.
Science
279: 717-720[Abstract/Free Full Text]
-
Beeckman T, De Rycke R, Viane R, Inzé D
(2000)
Histological study of seed coat development in Arabidopsis thaliana.
J Plant Res
113: 139-148[CrossRef]
-
Burn JE, Hocart CH, Birch RJ, Cork AC, Williamson RE
(2002)
Functional analysis of the cellulose synthase genes CesA1, CesA2, and CesA3 in Arabidopsis.
Plant Physiol
129: 797-807[Abstract/Free Full Text]
-
Carpita NC, Gibeaut DM
(1993)
Structural models of primary cell walls in flowering plants: consistency of molecular structure with the physical properties of the walls during growth.
Plant J
3: 1-30[CrossRef][Web of Science][Medline]
-
Cutler S, Somerville C
(1997)
Cellulose synthesis: cloning in silico.
Curr Biol
7: R108-R111[CrossRef][Web of Science][Medline]
-
Delmer DP
(1999)
Cellulose biosynthesis: exciting times for a difficult field of study.
Annu Rev Plant Physiol Plant Mol Biol
50: 245-276[CrossRef][Web of Science]
-
Desnos T, Orbovic' V, Bellini C, Kronenberger J, Caboche M, Traas J, Höfte H
(1996)
Procuste1 mutants identify two distinct genetic pathways controlling hypocotyl cell elongation, respectively in dark- and light-grown Arabidopsis seedlings.
Development
122: 683-693[Abstract]
-
Desprez T, Vernhettes S, Fagard M, Refrégier G, Desnos T, Aletti E, Py N, Pelletier S, Höfte H
(2002)
Resistance against herbicide isoxaben and cellulose deficiency caused by distinct mutations in same cellulose synthase isoform CESA6.
Plant Physiol
128: 482-490[Abstract/Free Full Text]
-
Dhugga KS
(2001)
Building the wall: genes and enzyme complexes for polysaccharide synthases.
Curr Opin Plant Biol
4: 488-493[CrossRef][Web of Science][Medline]
-
Fagard M, Desnos T, Desprez T, Goubet F, Refregier G, Mouille G, McCann M, Rayon C, Vernhettes S, Höfte H
(2000)
PROCUSTE1 encodes a cellulose synthase required for normal cell elongation specifically in roots and dark-grown hypocotyls of Arabidopsis.
Plant Cell
12: 2409-2423[Abstract/Free Full Text]
-
Frishman D, Argos P
(1997)
Seventy-five percent accuracy in protein secondary structure prediction.
Proteins
27: 329-335[CrossRef][Web of Science][Medline]
-
Gillmor CS, Poindexter P, Lorieau J, Palcic MM, Somerville C
(2002)
-Glucosidase I is required for cellulose biosynthesis and morphogenesis in Arabidopsis.
J Cell Biol
156: 1003-1013[Abstract/Free Full Text] -
Green PB
(1994)
Connecting gene and hormone action to from pattern and organogenesis: biophysical transductions.
J Exp Bot Suppl
45: 1775-1788
-
Holland N, Holland D, Helentjaris T, Dhugga KS, Xoconostle-Cazares B, Delmer DP
(2000)
A comparative analysis of the plant cellulose synthase (CesA) gene family.
Plant Physiol
123: 1313-1323[Abstract/Free Full Text]
-
Hughes A, McCully M
(1975)
The use of an optical brightener in the study of plant structure.
Stain Technol
50: 319-329[Web of Science][Medline]
-
Jackson D
(1992)
In situ hybridization in plants.
In
SJ Gurr, MJ McPherson, DJ Bowles, eds, Molecular Plant Pathology: A Practical Approach, Vol. I. Practical Approach Series. IRL Press, Oxford, pp 163-174
-
Jürgens G, Mayer U, Torres Ruiz RA, Berleth T, Miséra S
(1991)
Genetic analysis of pattern formation in the Arabidopsis embryo.
Development
Suppl 1: 27-38
-
Lane DR, Wiedemeier A, Peng L, Höfte H, Vernhettes S, Desprez T, Hocart CH, Birch RJ, Baskin TI, Burn JE, et al
(2001)
Temperature-sensitive alleles of RSW2 link the KORRIGAN endo-1,4-
-glucanase to cellulose synthesis and cytokinesis in Arabidopsis.
Plant Physiol
126: 278-288[Abstract/Free Full Text] -
Lippuner V, Chou IT, Scott SV, Ettinger WF, Theg SM, Gasser CS
(1994)
Cloning and characterization of chloroplast and cytosolic forms of cyclophilin from Arabidopsis thaliana.
J Biol Chem
269: 7863-7868[Abstract/Free Full Text]
-
Lukowitz W, Nickle TC, Meinke DW, Last RL, Conklin PL, Somerville CR
(2001)
Arabidopsis cyt1 mutants are deficient in a mannose-1-phosphate guanylyltransferase and point to a requirement of N-linked glycosylation for cellulose biosynthesis.
Proc Natl Acad Sci USA
98: 2262-2267[Abstract/Free Full Text]
-
McCann MC, Roberts K
(1991)
Architecture of the primary cell wall.
In
CW Lloyd, ed, The Cytoskeletal Basis of Plant Growth and Form. Academic Press, London, pp 109-129
-
McCann MC, Roberts K
(1994)
Changes in cell wall architecture during cell elongation.
J Exp Bot
45: 1683-1691[Web of Science]
-
McDowell JM, An Y-Q, Huang S, McKinney EC, Meagher RB
(1996)
The Arabidopsis ACT7 actin gene is expressed in rapidly developing tissues and responds to several external stimuli.
Plant Physiol
111: 699-711[Abstract]
-
Murashige T, Skoog F
(1962)
A revised medium for rapid growth and bio assays with tobacco tissue cultures.
Physiol Plant
15: 473-497[CrossRef]
-
Nicol F, His I, Jauneau A, Vernhettes S, Canut H, Höfte H
(1998)
A plasma membrane-bound putative endo-1,4-
-D-glucanase is required for normal wall assembly and cell elongation in Arabidopsis.
EMBO J
17: 5563-5576[CrossRef][Web of Science][Medline] -
Nicol F, Höfte H
(1998)
Plant cell expansion: scaling the wall.
Curr Opin Plant Biol
1: 12-17[CrossRef][Medline]
-
Reiter W-D, Chapple CCS, Somerville CR
(1993)
Altered growth and cell walls in a fucose-deficient mutant of Arabidopsis.
Science
261: 1032-1035
-
Richmond T
(2000)
Higher plant cellulose synthases.
Genome Biol
1: 3001-3005
-
Richmond TA, Somerville CR
(2001)
Integrative approaches to determining Csl function.
Plant Mol Biol
47: 131-143[CrossRef][Web of Science][Medline]
-
Roland JC, Vian B
(1991)
General preparation and staining of thin sections.
In
JL Hall, C Hawes, eds, Electron Microscopy of Plant Cells. Academic Press, London, pp 1-66
-
Sanger F, Nicklen S, Coulson AR
(1977)
DNA sequencing with chain-terminating inhibitors.
Proc Natl Acad Sci USA
74: 5463-5467[Abstract/Free Full Text]
-
Saxena IM, Brown RM
(1997)
Identification of cellulose synthase(s) in higher plants: sequence analysis of processive
-glycosyltransferases with the common motif 'D, D, D35Q(R,Q) XRW'.
Cellulose
4: 33-49[CrossRef][Web of Science] -
Saxena IM, Brown RM Jr
(2000)
Cellulose synthases and related enzymes.
Curr Opin Plant Biol
3: 523-531[CrossRef][Web of Science][Medline]
-
Saxena IM, Brown RM, Dandekar T
(2001)
Structure-function characterization of cellulose synthase: relationship to other glycosyltransferases.
Phytochemistry
57: 1135-1148[CrossRef][Web of Science][Medline]
-
Scheible W-R, Eshed R, Richmond T, Delmer D, Somerville C
(2001)
Modifications of cellulose synthase confer resistance to isoxaben and thiazolidinone herbicides in Arabidopsis ixr1 mutants.
Proc Natl Acad Sci USA
98: 10079-10084[Abstract/Free Full Text]
-
Scott AS, Melvin EH
(1953)
Determination of dextran with anthrone.
Anal Chem
25: 1656-1661[CrossRef]
-
Taylor NG, Laurie S, Turner SR
(2000)
Multiple cellulose synthase catalytic subunits are required for cellulose synthesis in Arabidopsis.
Plant Cell
12: 2529-2539[Abstract/Free Full Text]
-
Taylor NG, Scheible W-R, Cutler S, Somerville CR, Turner SR
(1999)
The irregular xylem3 locus of Arabidopsis encodes a cellulose synthase required for secondary cell wall synthesis.
Plant Cell
11: 769-779[Abstract/Free Full Text]
-
Updegraff DM
(1969)
Semimicro determination of cellulose in biological materials.
Anal Biochem
32: 420-424[CrossRef][Web of Science][Medline]
-
Williamson RE, Burn JE, Birch R, Baskin T, Arioli T, Betzner AS, Cork A
(2001)
Morphology of rsw1, a cellulose-deficient mutant of Arabidopsis thaliana.
Protoplasma
215: 116-127[CrossRef][Web of Science][Medline]
-
Wyatt SE, Carpita NC
(1993)
The plant cytoskeleton: cell-wall continuum.
Trends Cell Biol
3: 413-417[CrossRef][Medline]
-
Wymer C, Lloyd C
(1996)
Dynamic microtubules: implications for cell wall patterns.
Trends Plant Sci
1: 222-228[CrossRef]
© 2002 American Society of Plant Biologists
This article has been cited by other articles:

|
 |

|
 |
 
T. J. Donner, I. Sherr, and E. Scarpella
Regulation of preprocambial cell state acquisition by auxin signaling in Arabidopsis leaves
Development,
October 1, 2009;
136(19):
3235 - 3246.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-L. Xu, A. Rahman, T. I. Baskin, and J. J. Kieber
Two Leucine-Rich Repeat Receptor Kinases Mediate Signaling, Linking Cell Wall Biosynthesis and ACC Synthase in Arabidopsis
PLANT CELL,
November 1, 2008;
20(11):
3065 - 3079.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Wang, J. E. Elliott, and R. E. Williamson
Features of the primary wall CESA complex in wild type and cellulose-deficient mutants of Arabidopsis thaliana
J. Exp. Bot.,
July 1, 2008;
59(10):
2627 - 2637.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Lu, L. Li, X. Yi, C. P. Joshi, and V. L. Chiang
Differential expression of three eucalyptus secondary cell wall-related cellulose synthase genes in response to tension stress
J. Exp. Bot.,
February 16, 2008;
(2008)
erm350v1.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Ma, Q. Gong, and H. J. Bohnert
An Arabidopsis gene network based on the graphical Gaussian model
Genome Res.,
November 1, 2007;
17(11):
1614 - 1625.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Persson, A. Paredez, A. Carroll, H. Palsdottir, M. Doblin, P. Poindexter, N. Khitrov, M. Auer, and C. R. Somerville
Genetic evidence for three unique components in primary cell-wall cellulose synthase complexes in Arabidopsis
PNAS,
September 25, 2007;
104(39):
15566 - 15571.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Chu, H. Chen, Y. Zhang, Z. Zhang, N. Zheng, B. Yin, H. Yan, L. Zhu, X. Zhao, M. Yuan, et al.
Knockout of the AtCESA2 Gene Affects Microtubule Orientation and Causes Abnormal Cell Expansion in Arabidopsis
Plant Physiology,
January 1, 2007;
143(1):
213 - 224.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Mizoi, M. Nakamura, and I. Nishida
Defects in CTP:PHOSPHORYLETHANOLAMINE CYTIDYLYLTRANSFERASE Affect Embryonic and Postembryonic Development in Arabidopsis
PLANT CELL,
December 1, 2006;
18(12):
3370 - 3385.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Van Damme, S. Coutuer, R. De Rycke, F.-Y. Bouget, D. Inze, and D. Geelen
Somatic Cytokinesis and Pollen Maturation in Arabidopsis Depend on TPLATE, Which Has Domains Similar to Coat Proteins
PLANT CELL,
December 1, 2006;
18(12):
3502 - 3518.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Wang, P. A. Howles, A. H. Cork, R. J. Birch, and R. E. Williamson
Chimeric Proteins Suggest That the Catalytic and/or C-Terminal Domains Give CesA1 and CesA3 Access to Their Specific Sites in the Cellulose Synthase of Primary Walls
Plant Physiology,
October 1, 2006;
142(2):
685 - 695.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Wang, S. B. Tiwari, G. Hagen, and T. J. Guilfoyle
AUXIN RESPONSE FACTOR7 Restores the Expression of Auxin-Responsive Genes in Mutant Arabidopsis Leaf Mesophyll Protoplasts
PLANT CELL,
July 1, 2005;
17(7):
1979 - 1993.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. S. Gillmor, W. Lukowitz, G. Brininstool, J. C. Sedbrook, T. Hamann, P. Poindexter, and C. Somerville
Glycosylphosphatidylinositol-Anchored Proteins Are Required for Cell Wall Synthesis and Morphogenesis in Arabidopsis
PLANT CELL,
April 1, 2005;
17(4):
1128 - 1140.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Refregier, S. Pelletier, D. Jaillard, and H. Hofte
Interaction between Wall Deposition and Cell Elongation in Dark-Grown Hypocotyl Cells in Arabidopsis
Plant Physiology,
June 1, 2004;
135(2):
959 - 968.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. S. Hardtke, W. Ckurshumova, D. P. Vidaurre, S. A. Singh, G. Stamatiou, S. B. Tiwari, G. Hagen, T. J. Guilfoyle, and T. Berleth
Overlapping and non-redundant functions of the Arabidopsis auxin response factors MONOPTEROS and NONPHOTOTROPIC HYPOCOTYL 4
Development,
March 1, 2004;
131(5):
1089 - 1100.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. A. Burton, N. J. Shirley, B. J. King, A. J. Harvey, and G. B. Fincher
The CesA Gene Family of Barley. Quantitative Analysis of Transcripts Reveals Two Groups of Co-Expressed Genes
Plant Physiology,
January 1, 2004;
134(1):
224 - 236.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Tanaka, K. Murata, M. Yamazaki, K. Onosato, A. Miyao, and H. Hirochika
Three Distinct Rice Cellulose Synthase Catalytic Subunit Genes Required for Cellulose Synthesis in the Secondary Wall
Plant Physiology,
September 1, 2003;
133(1):
73 - 83.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|