|
Plant Physiol, December 2002, Vol. 130, pp. 1983-1991
Effect of Ethylene Pathway Mutations upon Expression of the
Ethylene Receptor ETR1 from Arabidopsis1
Xue-Chu
Zhao,2
Xiang
Qu,2
Dennis E.
Mathews, and
G. Eric
Schaller*
Departments of Biochemistry and Molecular Biology (X.-C.Z., X.Q.,
G.E.S.) and Plant Biology (D.E.M.), University of New Hampshire,
Durham, New Hampshire 03824
 |
ABSTRACT |
The ethylene receptor family of Arabidopsis consists of five
members, one of these being ETR1. The effect of ethylene pathway mutations upon expression of ETR1 was examined. For this purpose, ETR1
levels were quantified in mutant backgrounds containing receptor loss-of-function mutations, ethylene-insensitive mutations, and constitutive ethylene response mutations. Ethylene-insensitive mutations of ETR1 resulted in a
posttranscriptional increase in levels of the mutant receptor.
Treatment of seedlings with silver, which leads to ethylene
insensitivity, also resulted in an increase in levels of ETR1.
Loss-of-function mutations of ETR1 resulted in both
transcriptional and posttranscriptional changes in levels of the
receptor. Most other ethylene pathway mutations, including a newly
isolated T-DNA insertion mutation in the gene encoding the ethylene
receptor ERS1, had relatively minor effects upon the expression of
ETR1. Our results indicate that mutations in ETR1 can
affect expression at the posttranscriptional level, and suggest that
these posttranscriptional changes may contribute to the phenotypes
observed in the mutants. Our results also refine the model on how
mutations in ethylene receptors are able to confer dominant ethylene
insensitivity upon plants.
 |
INTRODUCTION |
Ethylene
(C2H4) is a simple gaseous
hydrocarbon that has profound effects upon plant growth and
development. Ethylene regulates seed germination, seedling growth, leaf
and petal abscission, organ senescence, ripening, stress responses, and
pathogen responses (Mattoo and Suttle, 1991 ;
Abeles et al., 1992 ). An important contribution to our
understanding of ethylene signal transduction has come from the
identification of mutants in Arabidopsis with altered ethylene
sensitivity (Chang and Shockey, 1999 ; Stepanova
and Ecker, 2000 ). These mutations fall into two main classes:
(a) mutations that render a plant insensitive to ethylene, and (b)
mutations that result in a constitutive ethylene response.
Characterization of Arabidopsis mutants has led to the identification
of ethylene receptors and additional components in the ethylene signal
transduction pathway.
The ethylene receptor family of Arabidopsis contains five members
(ETR1, ETR2, ERS1, ERS2, and EIN4; Schaller, 2000 ;
Chang and Stadler, 2001 ), with ethylene binding
confirmed for ETR1 and ERS1 (Schaller and Bleecker,
1995 ; Rodriguez et al., 1999 ; Hall et
al., 2000 ). The receptors contain three N-terminal
transmembrane domains that encompass the ethylene-binding site
(Schaller and Bleecker, 1995 ; Rodriguez et al.,
1999 ). The binding site contains a copper cofactor that is
required for the high-affinity ethylene binding that receptors display
(Rodriguez et al., 1999 ). In the C-terminal half, the
receptors contain regions with similarity to His kinases and, in some
cases, the receiver domains of response regulators (Schaller,
2000 ; Chang and Stadler, 2001 ), signaling elements originally identified as parts of bacterial two-component systems (Parkinson, 1993 ; Schaller,
2000 ). His kinase activity has been confirmed in vitro for ETR1
(Gamble et al., 1998 ), but the role of this activity in
signal output is still unclear (Gamble et al.,
2002 ).
Mutations in the ethylene receptors can result in ethylene
insensitivity or constitutive ethylene responses, dependent on the
nature of the mutation. Ethylene insensitivity can result from single
amino acid changes within the region of the receptor involved in
ethylene binding (Chang et al., 1993 ; Hua et al., 1995 , 1998 ; Sakai et al., 1998 ).
Evidence indicates that these gain-of-function mutations either disrupt
ethylene binding or uncouple ethylene binding from signal output
(Schaller and Bleecker, 1995 ; Hall et al.,
1999 ; Rodriguez et al., 1999 ). For example, the
etr1-1 mutation abolishes the ability of the receptor to
coordinate the copper cofactor, and as a consequence, eliminates
ethylene binding (Rodriguez et al., 1999 ). The
ethylene-insensitive mutations are dominant and a single mutation in
any one of the five family members can confer ethylene insensitivity
upon the plant.
Loss-of-function mutations have been identified in four of five members
of the ethylene receptor family (Hua and Meyerowitz, 1998 ). Single loss-of-function mutations have little or no
effect upon ethylene signal transduction. However, in combination with the ETR1 loss-of-function mutation, the mutants show
constitutive ethylene responses and this effect is most pronounced in
triple and quadruple loss-of-function mutations (Hua and
Meyerowitz, 1998 ). These results indicate that there is
functional overlap among the receptor family members. These results
also indicate that the receptors serve as negative regulators of the
ethylene response pathway because elimination of receptors activates
ethylene responses. According to this model for negative regulation,
wild-type ethylene receptors actively repress ethylene responses in the air. In the presence of ethylene, wild-type receptors switch to a
signaling inactive state that allows for induction of ethylene responses. Ethylene-insensitive mutant receptors, such as etr1-1, are
apparently locked into the signaling state that they have in air, such
that they repress ethylene responses even in the presence of ethylene
(Bleecker, 1999 ).
Additional elements involved in ethylene signal transduction have also
been identified by mutational analysis in Arabidopsis. RAN1 is a
copper-transporting ATPase apparently required for addition of the
copper cofactor to the ethylene receptors (Hirayama et al.,
1999 ; Woeste and Kieber, 2000 ). Mutations in
RAN1 alter ethylene signal transduction, a loss-of-function
mutation resulting in a constitutive ethylene response. CTR1, EIN2, and
EIN3 are all thought to act in the same primary response pathway and
act downstream of the ethylene receptors. CTR1 belongs to the Raf
family of protein Ser/Thr kinases that initiate mitogen-activated
protein kinase cascades in eukaryotes (Kieber et al.,
1993 ) and has been shown capable of physical interaction with
the ethylene receptors ETR1 and ERS1 (Clark et al.,
1998 ). Loss-of-function mutations in CTR1 result in
constitutive ethylene responses (Kieber et al., 1993 ). EIN2 is an integral membrane protein with similarity to the Nramp family of metal ion transporters (Alonso et al., 1999 ).
Loss-of-function mutations in EIN2 result in ethylene
insensitivity. EIN3 belongs to a family of transcription factors that
are directly activated by the ethylene signal transduction system and
are required for ethylene-dependent gene induction (Chao et al.,
1997 ). Loss-of-function mutations in EIN3 render a
plant ethylene insensitive.
Here, we analyze the effect of ethylene pathway mutations upon
expression of the ethylene receptor ETR1. This analysis was facilitated
by the following: (a) the availability of a number of mutations within
the receptor itself, thereby providing independent verification for
effects of these mutations; (b) the availability of an antibody against
ETR1, thereby allowing for analysis at the protein level; and (c) a
detectable basal level of expression for ETR1, thereby allowing
increases and decreases in expression to be determined. Our results
lend insight into how ethylene receptor mutations affect expression and
indicate that mutations within ETR1 can result in
posttranscriptional changes in its own expression level. Our results
also lend insight into the mechanism by which mutations within the
receptors can lead to dominant ethylene insensitivity.
 |
RESULTS |
Effect of Ethylene Insensitivity Conferring Mutations upon
Expression of ETR1
Four dominant mutations have been isolated in ETR1 that
confer ethylene insensitivity on plants. These mutations, designated etr1-1, etr1-2, etr1-3, and
etr1-4, all result in single amino acid changes within the
hydrophobic domain of ETR1 that has been implicated in ethylene binding
(Fig. 1A; Chang et al.,
1993 ). The etr1-1, etr1-3, and
etr1-4 mutations either reduce or eliminate ethylene binding
(Hall et al., 1999 ). The etr1-2 mutation does not disrupt ethylene binding, but apparently uncouples ethylene binding
from signal output (Hall et al., 1999 ). Based on
immunoblot analysis, the protein levels of the mutant receptors etr1-1,
etr1-2, etr1-3, and etr1-4 were all approximately 2- to 3-fold higher than that of the wild-type receptor ETR1 when analyzed in etiolated seedlings (Fig. 1B). To determine if the effect upon expression occurred at the transcriptional or posttranscriptional level, transcript levels of the receptor were determined by northern blot in
both wild-type and etr1-1 backgrounds (Fig. 1C). No
difference in transcript levels was found for the receptor between wild
type and etr1-1. However, as previously observed (Fig. 1B),
we did find that the etr1-1 protein was present at 2-fold higher levels than the ETR1 protein when analyzed by immunoblot using a portion of
the same plant material examined by northern blot (results not shown).
Thus, the increase in expression of ethylene-insensitive mutations of
ETR1 occurs at the posttranscriptional level.

View larger version (40K):
[in this window]
[in a new window]
|
Figure 1.
Effect of ethylene-insensitive mutations upon
expression of ETR1. A, Structure of ETR1 and position of
ethylene-insensitive mutations. The hydrophobic ethylene-sensing
domain, the GAF domain, the His kinase domain, and the receiver domain
are indicated. The letters H and D indicate putative phosphorylation
sites. B, Immunoblot analysis of wild-type and ethylene-insensitive
mutants of ETR1. Etiolated seedlings were grown for 4 d, and the
level of immunodetectable full-length receptor then determined from 10 µg of membrane proteins using an antibody directed against ETR1.
Expression levels were quantified densitometrically (E) and also
normalized against immunologically determined levels of the
H+-ATPase (E/A) as an internal control. C,
Northern-blot analysis of mRNA obtained from wild-type and
etr1-1 seedlings. Blots were probed with an ETR1
probe and a -tubulin gene probe as an internal control. The numbers
represent the expression level of the ethylene receptor gene after
normalization for the level of -tubulin expression. D, Immunoblot
analysis of ETR1 levels in additional ethylene-insensitive mutant
backgrounds.
|
|
To determine if increased expression of the receptor was
restricted to mutant lesions in ETR1 or was a general feature of ethylene insensitivity in Arabidopsis, we examined other
ethylene-insensitive mutations. Seedlings were examined that contained
dominant ethylene-insensitive mutations in other ethylene receptors
(etr2-1 and ein4-1). Seedlings were also examined
that contained ethylene-insensitive mutations in the downstream
ethylene signaling components EIN2 and EIN3. The
expression level of ETR1 based on immunoblot in these other mutant
backgrounds was comparable with or less than that found in the
wild-type background (Fig. 1D). Thus, the increased expression of
ethylene-insensitive mutants of ETR1 is restricted to those lesions
present in ETR1 itself, rather than being a general feature of
ethylene-insensitive mutations.
Some chemical compounds are able to induce ethylene insensitivity in
plants by interacting with the ethylene receptors. Silver is thought to
replace the copper cofactor present in the ethylene-binding site of the
receptor. Receptors containing silver are still able to bind ethylene
but the binding site is apparently perturbed such that ethylene binding
is uncoupled from signal output (Rodriguez et al.,
1999 ). We hypothesized that binding of silver by an ethylene receptor might mimic the effect of an ethylene-insensitive mutation in
that receptor, and result in an increased expression level of the
receptor. Consistent with this hypothesis, we observed that wild-type
seedlings treated with 10 µg mL 1 silver
nitrate had higher levels of ETR1 than control untreated seedlings
based upon immunoblot analysis (Fig. 2).
The stimulatory effect of silver upon expression was lacking with
ethylene-insensitive mutations of ETR1 (Fig. 2). This supports the
hypothesis that silver mimics the effect of the ethylene-insensitive
mutation because there is no additive effect of silver on expression of the ethylene-insensitive mutants.

View larger version (20K):
[in this window]
[in a new window]
|
Figure 2.
Effect of silver treatment upon expression of
ETR1. Wild-type and etr1 mutant seedlings were grown in the
presence or absence of 10 µg mL 1 silver
nitrate (Ag). Immunoblot analysis was then performed using antibodies
directed against ETR1 and the H+-ATPase as an
internal control on 10 µg of membrane protein. Expression levels are
given based directly upon that determined with anti-ETR1 antibody (E)
and normalized against the ATPase levels (E/A). For each plant
background, expression level of the receptor in the presence of silver
is given relative to that observed in the absence of silver. Results
from two independent experimental treatments of wild-type plants with
silver are shown.
|
|
Effect of Loss-of-Function Mutations in ETR1 upon
its Expression
The mutations etr1-5, etr1-6,
etr1-7, and etr1-8 are all loss-of-function
mutations in ETR1 (Hua and Meyerowitz, 1998 ).
The mutations etr1-5, etr1-6, and
etr1-7 were isolated as intragenic suppressors of the
ethylene insensitivity conferred by etr1-1, whereas
etr1-8 was isolated as an intragenic suppressor of
etr1-2 (Fig. 3A). The
etr1-5, etr1-6, and etr1-8 mutations
all introduce premature stop codons into the coding sequence. The
etr1-6 mutation occurs at an intron splice site and
retention of that intron would introduce a premature stop codon. All
four mutants show similar ethylene responsiveness to that of wild-type
plants (Hua and Meyerowitz, 1998 ). To determine whether
the mutations result in the absence of the receptor or produce a
truncated receptor incapable of signaling, we analyzed receptor
expression by immunoblot. Two different antibodies, anti-ETR1(165-400)
and anti-ETR1(401-738), were used that are targeted against different
regions of the receptor (Fig. 3A). In initial experiments using
recombinant fusion proteins expressed in bacteria, we confirmed that
both antibodies recognized the etr1-5 and etr1-8 truncations as
efficiently as full-length ETR1, and that they were incapable of
detecting the etr1-6 truncation (results not shown). When Arabidopsis
membranes were analyzed by immunoblot, no full-length protein was
detected for any of the loss-of-function mutants (Fig. 3B). In
addition, we did not detect any immunoreactive bands that would
correspond to the truncated receptors. Note that the
anti-ETR1(165-400) antibody does cross-react with a protein of 68 kD,
but this is not derived from ETR1. A truncated protein for etr1-5 and
etr1-8 would be detectable with both the anti-ETR1(165-400) and
anti-ETR1(401-738) antibodies. Based on a control dilution series of
the receptor, the anti-ETR1(165-400) antibody was capable of detecting
a protein expressed at 10% of the level found with the wild-type
receptor ETR1 or 5% of the level found with etr1-1. The
anti-ETR1(401-738) antibody is even more sensitive and is capable of
detecting proteins with at least 2-fold higher sensitivity than that of
the anti-ETR1(165-400) antibody.

View larger version (43K):
[in this window]
[in a new window]
|
Figure 3.
Effect of loss-of-function mutations in
ETR1 upon its expression. A, Positions of mutations in ETR1.
The positions of ethylene-insensitive mutations are shown above the
diagram of ETR1. The positions of intragenic suppressors of these
mutations that result in loss of function are shown below the diagram
of ETR1. Positions of regions used to generate the anti-ETR1(165-400)
and anti-ETR1(401-738) antibodies are also indicated. B, Immunoblot
analysis of ETR1 in different loss-of-function backgrounds. Membrane
fractions (10 µg) from etiolated Arabidopsis seedlings were analyzed
by immunoblot using the anti-ETR1(165-400) and anti-ETR1(401-738)
antibodies. The migration position of ETR1 and predicted migration
positions of the etr1-5, etr1-6, and etr1-8 truncated receptors are
indicated on the left. Migration positions of molecular mass markers
are indicated on the right in kilodaltons. C, Transcript levels of
ETR1 in different loss-of-function backgrounds. Blots of
mRNA were probed with an ETR1 probe and a -tubulin gene
probe as an internal control. The numbers represent the expression
level of the ethylene receptor gene after normalization for the level
of -tubulin gene expression.
|
|
The lack of detectable protein for the etr1-5 and
etr1-8 loss-of-function mutants could be because of
instability of the truncated protein or of the mRNA. To differentiate
between these possibilities, we performed northern-blot analysis.
Transcripts were detected for all the loss-of-function mutations in
ETR1 (Fig. 3C). The transcript for etr1-6 is
slightly larger than the other transcripts, as predicted, because of
the presence of an unspliced intron. Compared with wild type, the mRNA
levels of etr1-5 and etr1-8 were reduced
approximately 2- or 4-fold, respectively, whereas the mRNA level of
etr1-6 was increased about 3-fold. The reduction in mRNA
levels of etr1-5 and etr1-8 is significant but
not sufficient to explain the lack of detectable protein, indicating
that posttranscriptional mechanisms may also play a role in reducing
the levels of the truncated proteins.
Effect of Loss-of-Function Mutations in Other Ethylene Receptors
upon Expression of ETR1
Loss of one member in a gene family can sometimes lead to
functional compensation, whereby expression of another member of the
same gene family is induced to compensate for activity of the missing
family member (Bérard et al., 1997 ;
Mulligan et al., 1998 ; Minkoff et al.,
1999 ). An intriguing set of experiments suggests that
functional compensation occurs within the ethylene receptor family of
tomato (Tieman et al., 2000 ). Therefore, we examined the
Arabidopsis ethylene receptor ETR1 to determine if its expression was
affected by loss-of-function mutations in other ethylene receptor
family members. Analysis was performed on single loss-of-function
mutants (etr2-3 and ein4-4), a double mutant (etr2-3;ein4-4), and a triple mutant
(etr2-3;ein4-4;ers2-3; Hua and
Meyerowitz, 1998 ). The single mutants have little effect upon growth of etiolated Arabidopsis seedlings, but seedlings containing the
double and triple mutant demonstrate partial induction of the
triple-response phenotype, consistent with loss of receptors activating
the ethylene response pathway (Fig. 4;
Hua and Meyerowitz, 1998 ). The expression level of ETR1
protein in these mutant backgrounds was comparable with that found in
the wild-type background (Fig. 4), indicating that ETR1 did not
functionally compensate for the loss of these other members of the
receptor family.

View larger version (41K):
[in this window]
[in a new window]
|
Figure 4.
Effect of loss-of-function mutations in
ETR2, EIN4, and ERS2 upon expression
of ETR1. The phenotypes of 4-d-old dark-grown seedlings containing
single, double, and triple mutant combinations of etr2-3,
ein4-4, and ers2-3 are shown. The mean hypocotyl
length is given in millimeters based on measurement of at least 25 seedlings with the SD in parentheses. Immunoblot
analysis was performed using antibodies directed against ETR1 and the
H+-ATPase as an internal control on 10 µg of
membrane protein. Expression levels are given based directly upon that
determined with anti-ETR1 antibody (E) and normalized against the
ATPase levels (E/A).
|
|
The ethylene receptor ERS1 is more closely related at the
sequence level to ETR1 than are the other ethylene receptors of Arabidopsis (Chang and Stadler, 2001 ), but no
loss-of-function mutations have been available for ERS1
(Hua and Meyerowitz, 1998 ) We isolated a T-DNA insertion
in ERS1 by use of a PCR-based strategy, and determined by
sequencing from the left-border junction that the T-DNA was inserted
into the 5'-untranslated region of ERS1 (Fig.
5A). Sequence at the T-DNA junction
with ERS1 was
ATAACGCTCGGATCAATCAtactcga(atattcaattgtaaatggct), with
capitals indicating ERS1 sequence and parentheses indicating T-DNA left border sequence. We named this mutant allele
ers1-2 to differentiate it from the previously characterized
ethylene-insensitive ers1-1 mutation (Hua et al.,
1995 ). The responsiveness to ethylene of plants homozygous for
the ers1-2 mutation was similar to that of wild-type plants
(Fig. 5B). However, a double mutant of ers1-2 with the
etr1-7 loss-of-function mutant displayed a strong ethylene response phenotype when grown in the absence of ethylene (Fig. 5C).
Dark-grown ers1-2;etr1-7 seedlings displayed a
triple-response phenotype in the air. Light-grown
ers1-2;etr1-7 plants were dwarfed with compact
and epinastic leaves in the air and died without bolting. Northern-blot
analysis indicated a substantial reduction in mRNA levels of
ers1-2 compared with that found in wild type, but low levels
of transcript were detected (Fig. 5D). The significant reduction of
ERS1 transcript levels in the ers1-2 mutant would contribute to the strong mutant phenotype observed when the
ers1-2 mutant is combined with the etr1-7 mutant.
The lack of a mutant phenotype in the ers1-2 mutant by
itself could potentially be explained by functional compensation,
ETR1 being a possible candidate because of its sequence
similarity. However, the expression of ETR1 in the
ers1-2 mutant background was comparable with that found in
the wild-type background at both the mRNA and protein levels (Fig. 5, D
and E), indicating that functional compensation was not because of
changes in ETR1 expression.

View larger version (32K):
[in this window]
[in a new window]
|
Figure 5.
Analysis of the T-DNA insertional mutant
ers1-2. A, Location of T-DNA insertion in the
ERS1 gene. Black bars and white bars represent translated
and untranslated regions of the ERS1 transcript,
respectively. B, Phenotype of 3.5-d-old dark-grown seedlings containing
the ers1-2 mutation grown in air or ethylene (50 µL
L 1). Mean hypocotyl lengths are given in
millimeters with SD in parentheses. C, Phenotype
of the ers1-2;etr1-7 double mutant as compared
with seedlings with wild-type phenotype segregating from the same
population. Seedlings were grown in dark for 3.5 d or in the light
for 4 weeks. The ers1-2;etr1-7 double mutant is
on the right in each panel, and a 2-fold enlargement is also inset to
reveal details of the light-grown seedling. D, Northern-blot analysis
of ERS1 and ETR1 expression in the
ers1-2 mutant line performed using 25 µg of total RNA. The
numbers represent the expression level of the ethylene receptor genes
after normalization for the level of -tubulin expression. E, Effect
of the ers1-2 mutation upon expression of ETR1 in etiolated
seedlings. Immunoblot analysis was performed using antibodies directed
against ETR1 and the H+-ATPase as an internal
control on 15 µg of membrane protein. Expression levels are given
based directly upon that determined with anti-ETR1 antibody (E) and
normalized against the ATPase levels (E/A).
|
|
Effect of mutations in RAN1 and CTR1 upon
Expression of ETR1
RAN1 is a copper-transporting ATPase implicated in the delivery of
the copper cofactor to the ethylene receptors (Hirayama et al.,
1999 ; Woeste and Kieber, 2000 ). The
ran1-1 and ran1-2 mutations cause single amino
acid changes in the RAN1 protein and are thought to alter rather than
eliminate function (Hirayama et al., 1999 ). Plants
containing these mutations demonstrate an induction of ethylene
responses when treated with trans-cyclooctene, normally an antagonist
of ethylene responses, but have no other discernible effect upon growth
(Hirayama et al., 1999 ). Both ran1-1 and
ran1-2 seedlings expressed ETR1 at levels similar to
wild-type seedlings (Fig. 6A). The
loss-of-function mutation ran1-3 results in constitutive
activation of the ethylene response pathway. Because ran1-3
plants produce leaves but die without bolting (Woeste and Kieber, 2000 ), we identified homozygous ran1-3
plants based on phenotype from a segregating population of 4-week-old
plants grown in the light. We observed no difference in ETR1 levels in
ran1-3 plants compared with wild-type plants or members of
the segregating population that lacked the ran1-3 phenotype
(Fig. 6A). Loss-of-function mutations in the Ser/Thr kinase CTR1 also
result in constitutive ethylene responses. We typically observed about
a 2-fold increase in levels of ETR1 in the ctr1-2 mutant
background relative to wild type (Fig. 6B). This could arise because of
a low level of ethylene inducibility for the ETR1 transcript
(Hua et al., 1998 ) or be an indirect effect of the
phenotypic differences between ctr1-2 and wild-type plants
(Kieber et al., 1993 ).

View larger version (22K):
[in this window]
[in a new window]
|
Figure 6.
Effect of mutations in RAN1 and
CTR1 upon expression of ETR1. Immunoblot analysis was
performed using antibodies directed against ETR1 and the
H+-ATPase as an internal control. Expression
levels are given based directly upon that determined with anti-ETR1
antibody (E) and normalized against the ATPase levels (E/A). A, Effect
of ran1 mutations on expression of ETR1. For
ran1-1 and ran1-2, etiolated seedlings were
examined; for ran1-3, leaves of 4-week-old plants were
examined. B, Effect of the ctr1-2 mutation upon expression
of ETR1 in etiolated seedlings.
|
|
 |
DISCUSSION |
Expression of the ethylene receptor ETR1 was sensitive
to mutations within its own coding sequence. Both gain-of-function mutations and loss-of-function mutations affected expression of ETR1 at the posttranscriptional level and, as discussed
below, these posttranscriptional changes could contribute to the
phenotypes observed in the mutants. Expression of ETR1 was affected to
only a limited extent by mutations in other pathway components. For instance, loss-of-function mutations in other members of the ethylene receptor family had little effect upon expression of ETR1, indicating that ETR1 does not functionally compensate for the loss of these receptors by an increase in its own expression.
Expression analysis of ethylene pathway mutations refines the model
shown in Figure 7 on how ethylene
insensitivity is conferred by mutant forms of ETR1. Each of the four
ethylene-insensitive mutations of ETR1 results in increased
protein levels of the receptor, apparently through a
posttranscriptional mechanism. The effect upon receptor expression can
be phenocopied at the molecular level by treatment of plants with
silver, which is also capable of generating ethylene insensitivity in
plants. Both the ethylene-insensitive mutations (Hall et al.,
1999 ) and silver (Rodriguez et al., 1999 ) are
thought to perturb the ethylene-binding site (Fig. 7), and thus
ethylene perception may play a role in regulating expression of the
receptor. The ethylene-insensitive forms of the receptor could
potentially have a slower rate of turnover than the wild-type receptors
because turnover of animal hormone receptors is commonly regulated by
ligand binding (Wiley, 1992 ). In such a case, endogenous ethylene levels within the plant would have to be sufficient to result
in differing rates of turnover for the wild-type and mutant receptors.

View larger version (33K):
[in this window]
[in a new window]
|
Figure 7.
A model for signaling by wild-type and mutant
versions of the ethylene receptor ETR1. The ethylene receptor ETR1
contains one ethylene-binding site per homodimer, with ethylene binding
mediated by a single copper ion (Cu) present in the ethylene-binding
site. In air, wild-type (WT) receptors actively repress ethylene
responses. In ethylene, wild-type receptors are inactivated, thereby
relieving repression of the ethylene response pathway. The etr1-1
mutation (indicated by a white circle) eliminates binding of the copper
cofactor and locks the receptor into a conformation such that the
receptor represses ethylene responses even in the presence of ethylene.
The replacement of the copper cofactor by silver (WT+Ag) also serves to
lock the receptor into a conformation such that it continuously
represses ethylene responses. In contrast, elimination of the copper
cofactor (WT-Cu) results in the receptor adapting an inactive
conformation in air and ethylene.
|
|
The discovery that ethylene-insensitive mutants of ETR1 have a higher
expression level than wild-type receptors helps resolve an apparent
paradox in our understanding of signaling by ethylene receptors
(Hua and Meyerowitz, 1998 ; Bleecker,
1999 ; Chang and Stadler, 2001 ). An
ethylene-insensitive mutation in one member of the five-member ethylene
receptor family is sufficient to confer ethylene insensitivity,
suggesting that signaling by one family member is enough to repress
ethylene responses. On the other hand, loss-of-function mutations in
three receptors simultaneously are sufficient to induce ethylene
responses (Hua and Meyerowitz, 1998 ), a situation under
which two family members would still theoretically be signaling to
repress ethylene responses. Our data indicate that the signal output by
an ethylene-insensitive receptor mutant is not equivalent to that of a
wild-type receptor because of the difference in expression levels. The
increase in expression of the ethylene-insensitive mutants of
ETR1 would result in an increase in signal output and the ability to
repress ethylene responses. Other mechanisms may also increase signal
output of the ethylene-insensitive mutant receptors, such as their
postulated ability to convert wild-type receptors to an
ethylene-insensitive signaling state via heteromeric interactions
(Chang and Stadler, 2001 ; Gamble et al.,
2002 ).
Analysis of ETR1 expression in the ran1-3 background further
clarifies the mechanism by which mutations in ethylene receptors confer
ethylene insensitivity. The ran1-3 mutant eliminates a copper transporter required for delivery of the copper cofactor to the
ethylene receptors (Hirayama et al., 1999 ; Woeste
and Kieber, 2000 ). Plants containing the ran1-3
mutation display a constitutively active ethylene response
(Woeste and Kieber, 2000 ). Interestingly, mutations like
etr1-1 that produce a receptor unable to bind the copper
cofactor result in the opposite phenotype: ethylene insensitivity (Rodriguez et al., 1999 ). This difference in phenotypes
could be because of: (a) destabilization of the ethylene receptors in the ran1-3 background, or (b) functional differences between
receptors lacking copper and the ethylene-insensitive receptor
mutations. Our data support the second hypothesis. ETR1 protein was
detected in the ran1-3 background at similar levels to that
found in the wild-type background indicating that, although the
receptor is present and lacking the copper cofactor, it does not confer
ethylene insensitivity. Presumably, protein levels of the other members of the ethylene receptor family are similarly unaffected. Thus, wild-type ethylene receptors lacking the copper cofactor have a
loss-of-function phenotype (i.e. the ran1-3 mutation
produces the same constitutive ethylene response phenotype found in
plant lines containing multiple loss-of-function mutations in the
ethylene receptors). Wild-type receptors lacking the copper cofactor
may adopt a signaling-inactive conformation similar to the conformation of wild-type receptors that have ethylene bound (Fig. 7). In contrast, the amino acid changes that result from mutations like
etr1-1 (Cys-65-Tyr) result in a gain of function because
they prevent not only copper binding but also lock the receptor into a
signaling-active conformation such as it has in air (Fig. 7). The
proposal that receptors in the ran1-3 background are not
equivalent to receptors containing ethylene-insensitive mutations is
consistent with the finding that the ethylene-insensitive
etr1-3 mutant can suppress the ran1-3
constitutive ethylene phenotype (Woeste and Kieber, 2000 ). The finding that ETR1 is still present in the
ran1-3 background also raises the possibility that not all
mutations that eliminate ethylene binding will, as a consequence,
confer ethylene insensitivity.
The loss-of-function mutants etr1-5, etr1-6,
etr1-7, and etr1-8 were isolated as intragenic
suppressors of the ethylene insensitivity conferred by either
etr1-1 or etr1-2, and are predicted to result in
premature termination of the encoded protein (Hua and
Meyerowitz, 1998 ). However, we have found that a truncated
version of etr1-1 containing the first 349 amino acids is still capable
of conferring ethylene insensitivity when transformed into Arabidopsis
(Gamble et al., 2002 ). This raises the question as to
why no ethylene insensitivity is observed with the loss-of-function
mutants, in particular with etr1-5 and etr1-8,
which are predicted to code for receptors containing 562 amino acids.
Our data indicate that the loss-of-function mutants may reduce
expression at the transcriptional and posttranscriptional levels.
Transcript, but no protein, was detected for each of the
ETR1 loss-of-function mutants. Examination of
etr1-5 and etr1-8 indicated a reduction to 43%
and 23%, respectively, of wild-type mRNA levels. This reduction in
expression could be because of mechanisms for mRNA surveillance such as
nonsense-mediated decay whereby mRNAs containing premature stop codons
are targeted for degradation (van Hoof and Green, 1996 ).
However, the reduction in mRNA expression levels of etr1-5
and etr1-8 is probably not sufficient to reduce protein
levels below detection limits for the antibodies. Thus, the results
obtained with the loss-of-function mutations suggest that premature
termination of the protein may lead to an absence of receptor rather
than a truncated receptor, presumably because of instability of the
truncated protein. The genetic screen for intragenic suppressors may
have favored the isolation of destabilizing mutations.
To facilitate our analysis of ethylene pathway mutations, we isolated a
T-DNA insertion mutation in the ERS1 gene that, based on
northern-blot analysis, substantially reduces expression of ERS1. As has been found in the analysis of loss-of-function
genes in other ethylene receptors, the ers1-2 mutant by
itself had little effect upon ethylene responses in the mutant
seedlings. However, a double mutant of ers1-2 and
etr1-7 exhibited a constitutive ethylene response. The
phenotype observed with the ers1-2;etr1-7 double
mutant was comparable with that previously reported for an
etr1;etr2;ein4;ers2
quadruple loss-of-function mutant (Hua and Meyerowitz,
1998 ). These data suggest that ETR1 and ERS1 play more
predominant roles in the regulation of ethylene signaling than the
other three members of the ethylene receptor family. The relative
importance of ETR1 and ERS1 could be because of the presence of His
kinase activity (Gamble et al., 1998 ), the ability to
interact with the downstream signaling component CTR1 (Clark et
al., 1998 ), or possibly higher expression levels compared with those of the other ethylene receptors.
In summary, the results described here clarify the mode of action of
ethylene pathway mutations previously identified in Arabidopsis. Mutations in the ethylene receptor ETR1 affected expression of the
receptor at the posttranscriptional level. Similar mutations conferring
ethylene insensitivity and intragenic suppressor mutations that result
in premature stop codons have been identified in other members of the
ethylene receptor family of Arabidopsis (Hua et al.,
1995 , 1998 ; Hua and Meyerowitz,
1998 ; Sakai et al., 1998 ). Thus, the mechanisms
described here may be applicable to other ethylene receptors besides ETR1.
 |
MATERIALS AND METHODS |
Plant Material and Growth Conditions
Arabidopsis mutants in the ecotype Columbia were used for all
experiments except those involving the ers1-2 mutant,
which was in the ecotype Wassilewskija. The ERS1
T-DNA insertion allele (ers1-2) was isolated from the
60,480 kanamycin-resistant T-DNA-tagged Arabidopsis lines of the
University of Wisconsin Knockout Arabidopsis facility
(http://www. biotech.wisc.edu/Arabidopsis). The mutant was
identified with a PCR primer for the T-DNA left border
(CATTTTATAATAACGCTGCGGACATCTAC) and an ERS1-specific
primer (CAGAGAGTTCTGTCACTCCTGGAAATGGT). Plants containing the wild-type
ERS1 gene were identified by use of PCR with the above
ERS1 primer and a second ERS1-specific
primer (CACAACCGCGCAAGAGACTTTAGCAATAGT). The
ers1-2;etr1-7 double mutant was
identified by crossing plants homozygous for the single mutations and
subsequent PCR-based genotyping of F2 progeny according to
Hua and Meyerowitz (1998) . Upon request, the
ers1-2 mutant and all novel materials described in this
publication will be made available in a timely manner for noncommercial
research purposes.
Unless indicated otherwise, seedlings were grown on 0.8% (w/v) agar
plates of one-half-strength Murashige and Skoog basal medium (pH 5.65)
with Gamborg's vitamins (Murashige and Skoog media, Sigma, St. Louis).
Seeds were stratified for 2 d at 4°C before growth at 22°C.
Seeds were exposed to light for 12 h, then incubated in the dark.
Seedlings were typically examined after 4 d, with time 0 corresponding to when the plates were removed from 4°C and brought to
22°C. For ethylene treatment, seedlings were grown in sealed chambers
in the presence of 50 µL L 1 ethylene. Measurements of
hypocotyl length were performed as described by Gamble et al.
(2002) . For analysis of the ran1-3 mutant,
seedlings from a segregating population were grown for 4 weeks under an
8-h light cycle to allow for maximal rosette development before
harvest. Homozygous ran1-3 seedlings were identified based on their readily distinguishable constitutive ethylene response phenotype (Woeste and Kieber, 2000 ).
Antibodies
The anti-ETR1(401-738) antibody was prepared against a
glutathione S-transferase (GST) fusion protein
with amino acids 401 to 738 of ETR1 (Schaller et al.,
1995 ) and was used for detection of ETR1 in all cases except
where indicated in Figure 3. The serum was depleted of antibodies that
cross-react with GST by passing through a column of Affigel-10 (Bio-Rad
Laboratories, Hercules, CA) cross-linked to GST. The antibody was
affinity purified by binding to an Affigel column cross-linked to
GST-ETR1(401-738) (Schaller et al., 1995 ), then eluted
with 0.1 M Gly (pH 2.5). The anti-ETR1(165-400) antibody
used for Figure 3 was prepared against a GST fusion protein with amino
acids 165 to 400 of ETR1 (Schaller et al., 1995 ) and was
affinity purified as described (Gamble et al., 2002 ).
The anti-(H+-ATPase) antibody (DeWitt et al.,
1996 ) used as an internal loading control was provided by Dr.
Michael Sussman (University of Wisconsin, Madison).
Protein Isolation and Immunoblot Analysis
For isolation of Arabidopsis membranes, plant material was
homogenized at 4°C in extraction buffer (50 mM Tris [pH
8.5], 150 mM NaCl, 10 mM EDTA, and 20%
[v/v] glycerol) containing 1 mM phenylmethylsulfonyl fluoride, 1 µg mL 1 pepstatin, 10 µg mL 1
aprotinin, and 10 µg mL 1 leupeptin as protease
inhibitors. The homogenate was strained through Miracloth
(Calbiochem-Novobiochem, San Diego) and centrifuged at
8,000g for 15 min. The supernatant was centrifuged at
100,000g for 30 min, and the membrane pellet was
resuspended in 10 mM Tris (pH 7.5), 150 mM
NaCl, 1 mM EDTA, and 10% (v/v) glycerol with protease
inhibitors. Protein concentration was determined by a modification of
the Lowry assay (Lowry et al., 1951 ) in which samples
were treated with 0.4% (w/v) sodium deoxycholate
(Schaller and DeWitt, 1995 ). Bovine serum albumin was
used as a standard for protein assays.
For immunoblot analysis, membranes were mixed with SDS-PAGE loading
buffer and incubated at 37°C for 1 h. Proteins were fractionated by SDS-PAGE using 8% (w/v) polyacrylamide gels (Laemmli,
1970 ). After electrophoresis, proteins were either stained with
Coomassie Blue or electrotransferred to Immobilon nylon membrane
(Millipore, Bedford, MA). Immunoblotting was performed by using
anti-ETR1(165-400), anti-ETR1(401-738), or
anti-(H+-ATPase) polyclonal antibodies. Immunodecorated
proteins were visualized by enhanced chemiluminescence detection
according to the manufacturer (Pierce Chemical, Rockford, IL).
Densitometric analysis was performed by using the NIH Image program
(http://rsb.info.nih.gov/nih-image) after first scanning the exposed
film and then capturing the images with Photoshop (Adobe Systems, San
Jose, CA). The relative expression level for ETR1 was quantified
by comparison to a dilution series of ETR1.
Northern-Blot Analysis
Total RNA was extracted from Arabidopsis tissue according to the
method of Carpenter and Simon (1998) . For Figures 1 and
3, RNA was isolated from etiolated seedlings; and for Figure 5, RNA was
isolated from 15-d-old leaf tissue of plants grown in liquid culture as
described by Chang et al. (1992) . mRNA was isolated from
total RNA using the PolyATract mRNA isolation system (Promega, Madison,
WI). For northern-blot analysis, RNA was separated on 1% (w/v)
agarose gels using the NorthernMax-Gly kit (Ambion, Austin, TX)
according to the manufacturer's instructions. RNA was transferred to
nylon membrane by the capillary method and fixed by UV cross-linking. Hybridizations were performed using buffers supplied with the NorthernMax-Gly kit. Single-stranded DNA antisense probes were made
using primers designed to anneal at the 3' end of the selected genes.
Radiolabeled probes were made and the blot stripped between hybridizations by using the Strip-EZ PCR kit (Ambion) according to the
manufacturer's instructions. Radioactivity was imaged and quantitated
by phosphor imaging with a Molecular Imager FX (Bio-Rad Laboratories),
using accompanying Quantity One software.
 |
ACKNOWLEDGMENTS |
We thank Michael Sussman for providing the
anti-(H+-ATPase) antibody, Jian Hua and Elliot Meyerowitz
for the ethylene receptor loss-of-function seed lines, Yi-Feng Chen for
assistance with affinity purification of antibodies, and Anita Klein
and Estelle Hrabak for critical reading of the manuscript.
 |
FOOTNOTES |
Received July 23, 2002; returned for revision August 18, 2002; accepted August 30, 2002.
1
This work was supported by the National Science
Foundation (grant nos. MCB-9982510 and DBI-9975908 to G.E.S.). This
is scientific contribution no. 2,138 from the New Hampshire
Agricultural Experiment Station.
2
These authors contributed equally to the paper.
*
Corresponding author; e-mail egs{at}cisunix.unh.edu; fax
603- 862-4013.
Article, publication date, and citation information can be found at
www.plantphysiol.org/cgi/doi/10.1104/pp.011635.
 |
LITERATURE CITED |
-
Abeles FB, Morgan PW, Saltveit ME Jr
(1992)
Ethylene in Plant Biology, Ed 2. Academic Press, San Diego
-
Alonso JM, Hirayama T, Roman G, Nourizadeh S, Ecker JR
(1999)
EIN2, a bifunctional transducer of ethylene and stress responses in Arabidopsis.
Science
284: 2148-2152[Abstract/Free Full Text]
-
Bérard J, Luo H, Chen H, Mukuna M, Bradley WE, Wu J
(1997)
Abnormal regulation of retinoic acid receptor beta2 expression and compromised allograft rejection in transgenic mice expressing antisense sequences to retinoic acid receptor beta1 and beta3.
J Immunol
159: 2586-2598[Abstract]
-
Bleecker AB
(1999)
Ethylene perception and signaling: an evolutionary perspective.
Trends Plant Sci
4: 269-274[CrossRef][Web of Science][Medline]
-
Carpenter CD, Simon AE
(1998)
Preparation of RNA.
In
JM Martinez-Zapater, J Salinas, eds, Methods in Molecular Biology, Vol. 82: Arabidopsis Protocols. Humana Press, Totowa, NJ, pp 85-89
-
Chang C, Kwok SF, Bleecker AB, Meyerowitz EM
(1993)
Arabidopsis ethylene response gene ETR1: similarity of product to two-component regulators.
Science
262: 539-544[Abstract/Free Full Text]
-
Chang C, Schaller GE, Patterson SE, Kwok SF, Meyerowitz EM, Bleecker AB
(1992)
The TMK1 gene from Arabidopsis codes for a protein with structural and biochemical characteristics of a receptor protein kinase.
Plant Cell
4: 1263-1271[Abstract/Free Full Text]
-
Chang C, Shockey JA
(1999)
The ethylene-response pathway: signal perception to gene regulation.
Curr Opin Plant Biol
2: 352-358[CrossRef][Web of Science][Medline]
-
Chang C, Stadler R
(2001)
Ethylene hormone receptor action in Arabidopsis.
BioEssays
23: 619-627[CrossRef][Web of Science][Medline]
-
Chao Q, Rothenberg M, Solano R, Roman G, Terzaghi W, Ecker JR
(1997)
Activation of the ethylene gas response pathway in Arabidopsis by the nuclear protein ETHYLENE-INSENSITIVE3 and related proteins.
Cell
89: 1133-1144[CrossRef][Web of Science][Medline]
-
Clark KL, Larsen PB, Wang X, Chang C
(1998)
Association of the Arabidopsis CTR1 Raf-like kinase with the ETR1 and ERS1 ethylene receptors.
Proc Natl Acad Sci USA
95: 5401-5406[Abstract/Free Full Text]
-
DeWitt ND, Hong B, Sussman MR, Harper JF
(1996)
Targeting of two Arabidopsis H+-ATPase isoforms to the plasma membrane.
Plant Physiol
112: 833-844[Abstract]
-
Gamble RL, Coonfield ML, Schaller GE
(1998)
Histidine kinase activity of the ETR1 ethylene receptor from Arabidopsis.
Proc Natl Acad Sci USA
95: 7825-7829[Abstract/Free Full Text]
-
Gamble RL, Qu X, Schaller GE
(2002)
Mutational analysis of the ethylene receptor ETR1. Role of the histidine kinase domain in dominant ethylene insensitivity.
Plant Physiol
128: 1428-1438[Abstract/Free Full Text]
-
Hall AE, Chen QG, Findell JL, Schaller GE, Bleecker AB
(1999)
The relationship between ethylene binding and dominant insensitivity conferred by mutant forms of the ETR1 ethylene receptor.
Plant Physiol
121: 291-299[Abstract/Free Full Text]
-
Hall AE, Findell JL, Schaller GE, Sisler EC, Bleecker AB
(2000)
Ethylene perception by the ERS1 protein in Arabidopsis.
Plant Physiol
123: 1449-1458[Abstract/Free Full Text]
-
Hirayama T, Kieber JJ, Hirayama N, Kogan M, Guzman P, Nourizadeh S, Alonso JM, Dailey WP, Dancis A, Ecker JR
(1999)
RESPONSIVE-TO-ANTAGONIST1, a Menkes/Wilson disease-related copper transporter, is required for ethylene signaling in Arabidopsis.
Cell
97: 383-393[CrossRef][Web of Science][Medline]
-
Hua J, Chang C, Sun Q, Meyerowitz EM
(1995)
Ethylene insensitivity conferred by Arabidopsis ERS gene.
Science
269: 1712-1714[Abstract/Free Full Text]
-
Hua J, Meyerowitz EM
(1998)
Ethylene responses are negatively regulated by a receptor gene family in Arabidopsis thaliana.
Cell
94: 261-271[CrossRef][Web of Science][Medline]
-
Hua J, Sakai H, Nourizadeh S, Chen QG, Bleecker AB, Ecker JR, Meyerowitz EM
(1998)
EIN4 and ERS2 are members of the putative ethylene receptor family in Arabidopsis.
Plant Cell
10: 1321-1332[Abstract/Free Full Text]
-
Kieber JJ, Rothenberg M, Roman G, Feldman KA, Ecker JR
(1993)
CTR1, a negative regulator of the ethylene response pathway in Arabidopsis, encodes a member of the Raf family of protein kinases.
Cell
72: 427-441[CrossRef][Web of Science][Medline]
-
Laemmli UK
(1970)
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227: 680-685[CrossRef][Medline]
-
Lowry OH, Rosebrough NJ, Farr AL, Randall RJ
(1951)
Protein measurement with the Folin phenol reagent.
J Biol Chem
193: 265-275[Free Full Text]
-
Mattoo AK, Suttle JC, eds
(1991)
The Plant Hormone Ethylene. CRC Press, Inc., Boca Raton, FL
-
Minkoff R, Bales ES, Kerr CA, Struss WE
(1999)
Antisense oligonucleotide blockade of connexin expression during embryonic bone formation: evidence of functional compensation within a multigene family.
Dev Genet
24: 43-56[CrossRef][Web of Science][Medline]
-
Mulligan GJ, Wong J, Jacks T
(1998)
p130 is dispensable in peripheral T lymphocytes: evidence for functional compensation by p107 and pRB.
Mol Cell Biol
18: 206-220[Abstract/Free Full Text]
-
Parkinson JS
(1993)
Signal transduction schemes of bacteria.
Cell
73: 857-871[CrossRef][Web of Science][Medline]
-
Rodriguez FI, Esch JJ, Hall AE, Binder BM, Schaller GE, Bleecker AB
(1999)
A copper cofactor for the ethylene receptor ETR1 from Arabidopsis.
Science
283: 996-998[Abstract/Free Full Text]
-
Sakai H, Hua J, Chen QG, Chang C, Medrano LJ, Bleecker AB, Meyerowitz EM
(1998)
ETR2 is an ETR1-like gene involved in ethylene signaling in Arabidopsis.
Proc Natl Acad Sci USA
95: 5812-5817[Abstract/Free Full Text]
-
Schaller GE
(2000)
Histidine kinases and the role of two-component systems in plants.
Adv Bot Res
32: 109-148
-
Schaller GE, Bleecker AB
(1995)
Ethylene-binding sites generated in yeast expressing the Arabidopsis ETR1 gene.
Science
270: 1809-1811[Abstract/Free Full Text]
-
Schaller GE, DeWitt ND
(1995)
Analysis of the H+-ATPase and other proteins of the Arabidopsis plasma membrane.
Methods Cell Biol
50: 129-148[Web of Science][Medline]
-
Schaller GE, Ladd AN, Lanahan MB, Spanbauer JM, Bleecker AB
(1995)
The ethylene response mediator ETR1 from Arabidopsis forms a disulfide-linked dimer.
J Biol Chem
270: 12526-12530[Abstract/Free Full Text]
-
Stepanova AN, Ecker JR
(2000)
Ethylene signaling: from mutants to molecules.
Curr Opin Plant Biol
3: 353-360[CrossRef][Web of Science][Medline]
-
Tieman DM, Taylor MG, Ciardi JA, Klee HJ
(2000)
The tomato ethylene receptors NR and LeETR4 are negative regulators of ethylene response and exhibit functional compensation within a multigene family.
Proc Natl Acad Sci USA
97: 5663-5668[Abstract/Free Full Text]
-
van Hoof A, Green PJ
(1996)
Premature nonsense codons decrease the stability of phytohemagglutinin mRNA in a position-dependent manner.
Plant J
10: 415-424[CrossRef][Web of Science][Medline]
-
Wiley HS
(1992)
Receptors: topology, dynamics, and regulation.
In
EE Bittar, ed, Fundamentals of Medical Cell Biology, Vol. 5A. JAI Press Inc., Greenwich, CT, pp 113-142
-
Woeste KE, Kieber JJ
(2000)
A strong loss-of-function mutation in RAN1 results in constitutive activation of the ethylene response pathway as well as a rosette-lethal phenotype.
Plant Cell
12: 443-455[Abstract/Free Full Text]
© 2002 American Society of Plant Biologists
This article has been cited by other articles:

|
 |

|
 |
 
Z. Gao, C.-K. Wen, B. M. Binder, Y.-F. Chen, J. Chang, Y.-H. Chiang, R. J. Kerris III, C. Chang, and G. E. Schaller
Heteromeric Interactions among Ethylene Receptors Mediate Signaling in Arabidopsis
J. Biol. Chem.,
August 29, 2008;
283(35):
23801 - 23810.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. D. Argyros, D. E. Mathews, Y.-H. Chiang, C. M. Palmer, D. M. Thibault, N. Etheridge, D. A. Argyros, M. G. Mason, J. J. Kieber, and G. E. Schaller
Type B Response Regulators of Arabidopsis Play Key Roles in Cytokinin Signaling and Plant Development
PLANT CELL,
August 1, 2008;
20(8):
2102 - 2116.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-F. Chen, S. N. Shakeel, J. Bowers, X.-C. Zhao, N. Etheridge, and G. E. Schaller
Ligand-induced Degradation of the Ethylene Receptor ETR2 through a Proteasome-dependent Pathway in Arabidopsis
J. Biol. Chem.,
August 24, 2007;
282(34):
24752 - 24758.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. W. Woodward, S. E. Ratzel, E. E. Woodward, Y. Shamoo, and B. Bartel
Mutation of E1-CONJUGATING ENZYME-RELATED1 Decreases RELATED TO UBIQUITIN Conjugation and Alters Auxin Response and Development
Plant Physiology,
June 1, 2007;
144(2):
976 - 987.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Dreher and J. Callis
Ubiquitin, Hormones and Biotic Stress in Plants
Ann. Bot.,
May 1, 2007;
99(5):
787 - 822.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-H. Cho and S.-D. Yoo
ETHYLENE RESPONSE 1 Histidine Kinase Activity of Arabidopsis Promotes Plant Growth
Plant Physiology,
February 1, 2007;
143(2):
612 - 616.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. M. Binder, R. C. O'Malley, W. Wang, T. C. Zutz, and A. B. Bleecker
Ethylene Stimulates Nutations That Are Dependent on the ETR1 Receptor
Plant Physiology,
December 1, 2006;
142(4):
1690 - 1700.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Xie, Q. Liu, and C.-K. Wen
Receptor Signal Output Mediated by the ETR1 N Terminus Is Primarily Subfamily I Receptor Dependent
Plant Physiology,
October 1, 2006;
142(2):
492 - 508.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. S. Resnick, C.-K. Wen, J. A. Shockey, and C. Chang
From The Cover: REVERSION-TO-ETHYLENE SENSITIVITY1, a conserved gene that regulates ethylene receptor function in Arabidopsis
PNAS,
May 16, 2006;
103(20):
7917 - 7922.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-F. CHEN, N. ETHERIDGE, and G. E. SCHALLER
Ethylene Signal Transduction
Ann. Bot.,
May 1, 2005;
95(6):
901 - 915.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Chang and A. B. Bleecker
Ethylene Biology. More Than a Gas
Plant Physiology,
October 1, 2004;
136(2):
2895 - 2899.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Qu and G. E. Schaller
Requirement of the Histidine Kinase Domain for Signal Transduction by the Ethylene Receptor ETR1
Plant Physiology,
October 1, 2004;
136(2):
2961 - 2970.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Gao, Y.-F. Chen, M. D. Randlett, X.-C. Zhao, J. L. Findell, J. J. Kieber, and G. E. Schaller
Localization of the Raf-like Kinase CTR1 to the Endoplasmic Reticulum of Arabidopsis through Participation in Ethylene Receptor Signaling Complexes
J. Biol. Chem.,
September 5, 2003;
278(36):
34725 - 34732.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. E. Hall and A. B. Bleecker
Analysis of Combinatorial Loss-of-Function Mutants in the Arabidopsis Ethylene Receptors Reveals That the ers1 etr1 Double Mutant Has Severe Developmental Defects That Are EIN2 Dependent
PLANT CELL,
September 1, 2003;
15(9):
2032 - 2041.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|