First published online December 5, 2002; 10.1104/pp.014068
Plant Physiol, December 2002, Vol. 130, pp. 2199-2209
Both Vegetative and Reproductive Actin Isovariants
Complement the Stunted Root Hair Phenotype of the Arabidopsis
act2-1 Mutation1
Laura U.
Gilliland,
Muthugapatti K.
Kandasamy,
Lucia
C.
Pawloski, and
Richard B.
Meagher*
Department of Genetics, University of Georgia, Athens, Georgia
30602-7223
 |
ABSTRACT |
The ACT2 gene, encoding one of eight actin
isovariants in Arabidopsis, is the most strongly expressed actin gene
in vegetative tissues. A search was conducted for physical defects in
act2-1 mutant plants to account for their reduced
fitness compared with wild type in population studies. The
act2-1 insertion fully disrupted expression of
ACT2 RNA and significantly lowered the level of total
actin protein in vegetative organs. The root hairs of the act2-1 mutants were 10% to 70% the length of wild-type
root hairs, and they bulged severely at the base. The length of the
mutant root hairs and degree of bulging at the base were affected by adjusting the osmolarity and gelling agent of the growth medium. The
act2-1 mutant phenotypes were fully rescued by an
ACT2 genomic transgene. When the act2-1
mutation was combined with another vegetative actin mutation,
act7-1, the resulting double mutant exhibited extensive
synergistic phenotypes ranging from developmental lethality to severe
dwarfism. Transgenic overexpression of the ACT7 vegetative isovariant
and ectopic expression of the ACT1 reproductive actin isovariant also
rescued the root hair elongation defects of the act2-1
mutant. These results suggest normal ACT2 gene
regulation is essential to proper root hair elongation and that even
minor differences may cause root defects. However, differences in the
actin protein isovariant are not significant to root hair elongation,
in sharp contrast to recent reports on the functional nonequivalency of
plant actin isovariants. Impairment of root hair functions such as
nutrient mining, water uptake, and physical anchoring are the likely
cause of the reduced fitness seen for act2-1 mutants in
multigenerational studies.
 |
INTRODUCTION |
Actin is found in all eukaryotes as
a principal and indispensable structural component of the cytoskeleton.
In plants, the basal actin cytoskeleton plays many important roles in
development and growth at the organismal level and in routine cellular
functions. Actin is essential or at least implicated in diverse
cellular processes such as cytoplasmic streaming, organelle
orientation, establishment of cell polarity, cell shape and division
plane determination, cell wall deposition, and tip growth
(Mascarenhas, 1993 ; Meagher et al.,
1999b ). Because polarity, the orientation of cell division, and
cell wall deposition are presumed to be the governing factors of organ
shape and pattern formation in plants, actin is a central element in
plant development (Meagher and Williamson, 1994 ).
Different isovariants of actin often have different expression
patterns, and biochemical and complementation studies indicate that not
all actin isovariants are equivalent (Kumar et al.,
1997 ; Fyrberg et al., 1998 ; Meagher et
al., 1999a ; Kandasamy et al., 2002 ). For
example, ectopic expression of plant and animal actins can cause sever
organismal phenotypes (Fyrberg et al., 1998 ;
Kandasamy et al., 2002 ). This manuscript provides evidence that ACT2, one of eight actin genes expressed in
Arabidopsis, is required for normal root hair elongation, but that
diverse plant actin isovariants can perform the necessary protein functions.
On the basis of protein coding sequences, plant actin genes are
monophyletic in origin and split to form two ancient classes encoding
reproductive and vegetative actins early in land plant evolution
(Hightower and Meagher, 1986 ; Meagher and McLean,
1990 ; McDowell et al., 1996b ; Kandasamy
et al., 1999 ). The vegetative class of the actin multigene
family in Arabidopsis is divided into two distinct subclasses, one
composed of ACT7 and the other composed of ACT2
and ACT8 (McDowell et al., 1996b ).
ACT2 and ACT8 are most closely related, differing
by only one amino acid residue, yet their high level of silent
nucleotide substitution differences indicates that they have not shared
a common ancestral gene for 30 to 60 million years (McDowell et
al., 1996b ). ACT2 expression is virtually
constitutive in vegetative tissues, whereas ACT8 expression
is weaker than ACT2, especially in young tissue. In addition, ACT8 is expressed in only a fraction of the
tissues with ACT2 expression (An et al.,
1996b ). ACT7 is expressed in the early developmental
stages of nearly all vegetative tissues. ACT2,
ACT7, and ACT8 are all well expressed in roots
and root hairs.
The act2-1 mutant examined in this study was isolated from
an Arabidopsis T-DNA insertion library using a sequence-based screening technique (McKinney et al., 1995 ). The act2-1
allele contains a T-DNA insertion at the beginning of the first protein
coding exon (exon 1/2) as shown in Figure
1a. The insertion replaces 16 nucleotides
of ACT2 DNA spanning this intron/exon junction. Close
inspection of homozygous act2-1 lines grown on soil revealed no phenotypic distinction from wild-type plants. However, a
multigenerational population study demonstrated the act2-1
mutation acts as a deleterious mutation that can be detected in the 2n
sporophytic generation (Gilliland et al., 1998 ), which
is consistent with the vegetative expression pattern of the
ACT2 gene. Homozygous mutant plants have only 70% of the
fitness of wild-type plants in each generation and even heterozygous
plants have slightly lowered fitness. The kinetics by which the
act2-1 mutant allele was lost over several generations were
consistent with requirements in vegetative growth and viability but
were not consistent with any requirement for ACT2 during
meiotic development (Asmussen et al., 1998 ).
Asmussen et al. (1998) estimated that the
act2-1 allele would be lost from a large population in 20 generations, making it effectively lethal. Because natural selection
should act on phenotypic variation (Lewontin, 1974 ), the
lack of an obvious outward physical phenotype associated with the
strong negative selection potential of the act2-1 allele appeared paradoxical.

View larger version (34K):
[in this window]
[in a new window]
|
Figure 1.
Map of act2-1 mutant allele and
complementing transgenes. a, The act2-1 allele contains a
T-DNA insertion (black) separating most of the ACT2 5'-UTR (white) from
the body of the ACT2 actin coding sequence (white
rectangles, with exons drawn larger than introns or flanking sequence).
The T-DNA insertion event deleted the acceptor splice junction
including 12 nucleotides of the leader (5'-UTR) intron and four
noncoding nucleotides of exon one-half of the act2-1 gene,
leaving just five nucleotides between the T-DNA and the
act2-1 start codon. Because the insertion is flanked on
either side by a right border sequence, the allele contains two or more
T-DNAs in tandem at this site. b, The genomic ACT2 transgene
(tACT2g) used to complement the act2-1 mutant was
contained on a 4-kb SalI fragment (white) flanked by T-DNA
sequences (black). c, The genomic actin ACT7 transgene
(tACT7g) used to complement the act2-1 mutant was
contained on a 4-kb HindIII fragment (diagonal lined
rectangles). d, The cDNA transgene, tACT1c, used to
complement the act2-1 mutant, contained the actin
ACT1 protein coding sequence (vertical lined rectangles),
under control of the ACT2 (white) promoter
(ACT2p) and terminator (ACT2t) sequences
(Kandasamy et al., 2002 ). The white arrowheads refer to
positions and orientations of PCR primers and the thick horizontal
black bar (a) refers to the location of the 3'-UTR DNA probe used for
northern analysis.
|
|
A certain amount of functional redundancy is expected between the eight
highly similar actin proteins in Arabidopsis. However, each of these
actin genes presumably must have its own essential properties to be
selectively maintained through tens or in some cases hundreds of
millions of years of evolution (Meagher et al., 1999a ,
1999b ). To distinguish the functional roles of the
predominantly vegetatively expressed actins, the possible physical
phenotype(s) of the act2-1 mutant was explored further in
the following study. A highly shortened root hair phenotype was
observed. This phenotype was directly attributable to the loss of
ACT2 and is the probable cause of low variability in
multigenerational studies. The data presented herein suggest a high
level of functional redundancy among the actin isovariants in their
ability to direct root hair elongation, but a distinct role is
nevertheless indicated for ACT2 gene regulation in this process.
 |
RESULTS |
Root Hair Phenotypes of act2-1 Mutants
A previous multigenerational population study (Gilliland et
al., 1998 ) demonstrated a significant drop in act2-1
allele frequencies relative to the wild-type allele within two
generations, suggesting that the act2-1 mutation is a highly
deleterious allele. The strong negative selection potential of the
act2-1 allele on soil-grown plants implied a phenotypic
defect that was not apparent from physical examination of these plants.
Close inspection of act2-1 homozygous mutants roots on
different defined growth media revealed a strong phenotype in root
hairs. The root hairs of act2-1 mutants were much shorter
than wild-type root hairs as show in Figure 2. Mutant root hairs averaged 20% the
length of those on wild-type plants when grown on solid phytagar
(Invitrogen, Carlsbad, CA)-Murashige and Skoog medium. Mutant root
hairs were 60% the length of those on wild-type plants when grown in
liquid Murashige and Skoog culture (data not shown). These root hairs,
although shorter, still resembled wild-type root hairs in shape,
number, and placement. However, when the act2-1 mutants were
grown on medium containing Phytagel (Sigma-Aldrich, St. Louis) and Suc,
the root hairs are distinctly bulbous (Fig. 2, c-e). The mutant root
hairs (Fig. 2, d-e) are wider and rounder than wild type at their base
and become more narrow toward the tip, exhibiting a pear-like shape.
Occasional branching was also observed. The bulbous root hairs (Fig.
2c) averaged one-seventh (14%) the length of the wild-type filamentous root hairs (Fig. 2f). The length of root hairs was quantitatively compared between wild type and mutant as shown in Figure
3d (left two bars).
ACT2/act2-1 heterozygotes appear fully wild type
(data not shown), indicating that act2-1 is a recessive
allele. The pear-like phenotype is maintained when mannitol, a
non-metabolizable sugar, is substituted for Suc on the phytagel plates,
indicating the bulbous base of the root hair is modulated by osmolarity
rather than nutrient response or metabolism of Suc. Without either
sugar included in the plates, the root hairs produced the short spiked configuration. The number and position of the root hairs is not altered
under any conditions, indicating the act2-1 mutant allele does not effect root hair determination or initiation.

View larger version (63K):
[in this window]
[in a new window]
|
Figure 2.
Root hair phenotypes of the act2-1
mutant and wild-type Arabidopsis plants. Root hairs of
act2-1/act2-1 mutants (a) are shorter than those
of wild type (b), when grown on Phytagel plates in Murashige and Skoog
salts without Suc. When the same medium is supplemented with 1% (w/v)
Suc (c-f), the act2-1/act2-1 mutant
displays distinctive bulbous root hairs that are typically pear-shaped
with occasional branching (c-e), whereas wild-type plants have long
and straight root hairs (f). Bars in the dark field images (a-c, e and
f) and bright field image (d) = 50 µm.
|
|

View larger version (130K):
[in this window]
[in a new window]
|
Figure 3.
Root hairs of the act2-1 mutant
Arabidopsis plants. a through d, Complementation of the
act2-1 root hair phenotype in plants expressing various
actin transgenes. a, Seven-day-old act2-1 mutant seedlings
display wild-type filamentous roots when transformed with genomic
tACT2g fragment (middle seedling). Flanking seedlings are
homozygous act2-1 mutant segregants that did not contain the
complementing tACT2g transgene. b, Seven-day-old
act2-1 mutant seedlings display wild-type filamentous roots
when transformed with genomic tACT7g fragment (middle
seedling). Flanking seedlings are homozygous act2-1 mutants.
c, Seven-day-old act2-1 mutant seedlings display
wild-type filamentous roots when transformed with tACT1c
(Fig. 1d), ACT1 cDNA under expression of ACT2
regulatory regions (middle seedling). Flanking seedlings are homozygous
act2-1 mutants. d, Root hair length in wild-type,
act2-1, and complemented lines. n = 20 for each.
SEs are indicated. e though j, Immunocytochemistry of
wild-type (e and f) and act2-1/act2-1 mutant
Arabidopsis root hairs (g-j). Bar in a through c = 1 mm. Bars in
e through j = 10 µm.
|
|
Immunocytochemical examination of the freeze-substituted root hairs
labeled with the monoclonal actin antibody mAbGPa revealed several
thick actin bundles oriented parallel to the longitudinal axis of the
short mutant root hairs. However, in the very apex of these stunted
root hairs, the actin bundles were often looping through the tip (Fig.
3, g-i) or occasionally showing dense but diffuse fluorescence
labeling (Fig. 3j). Such organization of actin was never observed in
the growing wild-type hairs of the identical root zone (Fig. 3, e and
f). In the long wild-type root hairs, there were dense arrays of
longitudinally oriented thick actin bundles and thin filaments all
through the axis, with the latter extending even into the tip. Overall,
there was no drastic alteration in the cytoarchitecture of the mutant
root hairs except that they contained less actin filaments and showed
frequent looping of the actin bundles at the tip (Fig. 3, h and i).
Complementation of the act2-1 Phenotype by Different
Actin Isovariants
Although the act2-1 allele had been backcrossed to wild
type and segregated with the root hair phenotype in latter generations, the possibility remained that the mutant phenotype was attributable to
a closely linked mutation. A 4-kb genomic DNA fragment
(tACT2g, Fig. 1b) containing the ACT2 gene,
including its 5' promoter region and 3' polyadenylation sites, was
transformed into act2-1/act2-1 plants by vacuum
infiltration of Agrobacterium tumenfaciens carrying the
insert on a Ti plasmid. Reliable detection of the pear-shaped root hair
phenotype of act2-1 mutants permitted a screen for
transformants that exhibited normal filamentous root hairs. A
population of approximately 4,000 seeds derived from vacuum infiltrated
plants was germinated on vertical plates with Suc and no antibiotic
selection for the transgene. More than 40 potential transformants
displaying wild-type root hairs, as shown in Figure 3a, were identified
and transferred to soil. Thus, the phenotypically wild-type plants accounted for more than 1% of the germinated seeds, typical of transformation frequencies we obtained with the vacuum infiltration method (Bariola et al., 1999 ).
PCR performed on leaf samples confirmed the presence of the
complementing transgene (tACT2g) and the absence of a true
ACT2 allele in all of the 36 complemented plant lines
tested. The independent complementing tACT2g alleles were
identified with PCR by pairing a sense primer located outside of the
cloned area of ACT2 in the T-DNA (BINTD2369; see
"Materials and Methods") to an antisense primer (ATG30A) located in
the first coding exon (Fig. 1b). The presence of a native
ACT2 allele was distinguished by pairing a sense primer
(1414S) upstream of the 5' SalI site and the ACT2 promoter with the ATG30A antisense primer. Progeny derived from 29 of
the 31 transformants examined exhibited ratios of bulbous to
filamentous wild-type root hair phenotypes consistent with segregation
of one or two unlinked copies of the tACT2 gene, providing further evidence that the tACT2g gene is responsible for the
complementation. Complemented plants had average root hair lengths
similar to wild type (Fig. 3d).
Considering the extreme conservation of each plant actin isovariant
(Meagher et al., 1999a , 1999b ) and
recent reports of the functional nonequivalency of plant actins
(Kandasamy et al., 2002 ), we further considered the
possibility that only the ACT2 protein could perform the necessary root
hair functions for complementation. This was tested by determining
whether genes encoding other distant Arabidopsis actin isovariants,
ACT7 and ACT1, could rescue the bulbous root hair
phenotype in the act2-1 mutant. The ACT7 protein differs in
about 6.8% of its amino acid residues from ACT2, and ACT7
promoter-reporter fusions were expressed in transgenic root hairs
(McDowell et al., 1996a ). Like ACT2,
ACT7 encodes a vegetative class actin. A 4-kb genomic DNA
fragment containing the entire ACT7 gene (Fig. 1c) was
transformed into act2-1/act2-1 plants by vacuum
infiltration. From about 500 potential transformants examined growing
on vertical Suc plates, five independent seedlings with wild-type root
hairs were identified, and two were selected for further study. The
root phenotype observed in a segregating population of seedlings
derived from one of these complemented lines is shown in Figure 3b. The
two complementing plant lines that were examined by PCR contained the
tACT7g transgene and were homozygous for the
act2-1 allele. Thus, the phenotype of the vegetative actin
act2-1 mutation was rescued by overexpression of the
ACT7 gene encoding the most distant vegetative actin
isovariant, with which ACT2 has not shared a common ancestor
for 200 million years (Meagher et al., 1999a ). This
result suggested that the actin isovariant sequence might not be
important, but that the level of actin expression might be critical to
root hair development (Fig. 3d) Quantitative data revealed that
tACT7g expression restored normal root hair length to mutant plants.
The reproductive actin gene ACT1 encodes the most distant
actin isovariant from ACT2 protein in Arabidopsis. Although the ACT1
protein is only slightly more divergent from ACT2 in total amino acid
differences (7.2%) than ACT7, ACT1 is a reproductive class actin and
contains many more non-synonymous amino acid substitutions relative to
ACT2. A construct shown in Figure 1d (tACT1c) containing the
cDNA from ACT1 under the control of an ACT2
promoter and terminator (Kandasamy et al., 2001 ) was
transformed into act2-1/act2-1 plants. Approximately 1% of T1 seedlings displayed wild-type root hairs and
tACT1c transgene segregated with the normal root hair
phenotype as shown in Figure 3c. tACT1c restored root hair
length in mutant plants to wild-type levels as shown for two different
complemented lines in Figure 3d. Thus, the ACT1 actin isovariant
substituted for the loss of ACT2 in root hair development, when the
reproductive cDNA was expressed ectopically from the vegetative
ACT2 promoter. In contrast to the full complementation of
the root hair elongation phenotype, many of the tACT1c
transformants of the act2-1 line also exhibited the
whole-plant morphological defects and dwarfing of above-ground organs
that were seen on wild-type plants expressing ACT1
ectopically (Kandasamy et al., 2002 ). Ectopic
overexpression of ACT1 isovariant in above-ground organs was evidently
harmful in both mutant and wild-type backgrounds.
Transcript Levels in act2-1 Mutants
The T-DNA insertion event creating the act2-1 allele
separates the ACT2 promoter from its coding region, deletes
the first splice acceptor site of the primary transcript, and thus
should disrupt any normal ACT2 expression. However, because
the downstream ACT2 coding region is intact, there is a
formal possibility that transcription from the T-DNA insertion results
in expression of a hybrid but functional act2-1 mRNA.
Northern analysis was performed on rosette leaves and young
inflorescences from mature plants using a double-stranded DNA probe
located on the 3'-untranslated region (-UTR) of ACT2 (ACT2
3'-UTR, Fig. 1a). Appreciable levels of ACT2 mRNA were not
detected in the act2-1 mutant leaf tissue relative to wild
type as shown in Figure 4a or in mutant
inflorescence tissue (not shown). After a more extended exposure of the
blot shown in Figure 4 or parallel blots, a faint band of RNA was
detected in act2-1/act2-1 mature plants.
Calculations from densitometer readings on both the northern and RNA
dot blots (data not shown) suggest that act2-1 mRNA levels
were less than 4% of the wild-type ACT2 message levels. In
numerous control experiments, cross-hybridization was not detected
between ACT2 DNA and ACT8 DNA (An et al.,
1996b ) and their respective 3'-UTR probes. These two genes are
the most homologous among the Arabidopsis actins but show only 45%
sequence homology over their approximately 300-nucleotide 3'-UTR
regions, making it unlikely that this weak RNA signal resulted from
cross-hybridization between the DNA probe and the ACT8
transcript. Thus, the act2-1 may be a leaky allele. The same
blot was rehybridized with a labeled rRNA probe to demonstrate equal
loading and transfer to membrane (Fig. 4b). Four repetitions of this
experiment failed to detect any higher or more significant levels of
act2-1 transcript.

View larger version (64K):
[in this window]
[in a new window]
|
Figure 4.
Steady-state actin RNA levels of the
act2-1 mutant. a, Total RNA from 5-week-old
act2-1 and wild-type rosette leaves and inflorescences were
blotted to a nylon membrane and hybridized with radiolabeled
double-stranded DNA from the ACT2-3'-UTR region (see map in
Fig. 1a). b, The membrane was reprobed with a radiolabeled 18S
ribosomal RNA (rRNA) oligonucleotide (see "Materials and Methods")
to demonstrate equal loading and transfer of RNA to the membrane
imprint.
|
|
Protein Levels in act2-1 Mutant and Complemented
Lines
Western analysis was performed on seedlings to assay the reduction
in actin protein levels in the act2-1 mutant plants.
Membrane imprints of total protein were incubated with several distinct monoclonal antibodies that recognize different subclasses of actin proteins. Monoclonal antibody mAbGPa, which recognizes all plant actins
(Kandasamy et al., 1999 ), was used to examine total
actin expression as shown in Figure 5a.
This immune reagent clearly shows that total actin protein is reduced
more than 2-fold in act2-1/act2-1 plants compared
with wild type. Western analysis with the monoclonal antibody mAb13a,
which recognizes only subclass 1 and 3 actins (ACT2 and ACT8, and
ACT11, respectively [Kandasamy et al., 2001 ]), also
shows a 2-fold decrease of actin protein in independent protein samples
(Fig. 5c). The lower band seen in Figure 5c is a common degradation
product of actin. Because the ACT11 gene is not
significantly expressed in vegetative tissues (Huang et al.,
1997 ), the actin detected should represent only ACT8 and any
residual ACT2. This examination of actin protein levels was repeated
several times on independent act2-1 plants with similar
results. Monoclonal antibody mAb2345a, which recognizes all Arabidopsis
actins except the ACT2/8 subclass (ACT7, ACT11, ACT1/3, and ACT4/12
[Kandasamy et al., 2001 ]), recognizes the low levels
of ACT7 in vegetative tissues. This reagent demonstrates approximately
equal protein loading and transfer to membranes (Fig. 5b). Thus, the
decrease in total actin is specifically attributable to a decrease in
the subclass of actins containing ACT2. Furthermore, there was not any
reproducible increase in other actins, like the hormone-responsive ACT7
isovariant, to compensate for the loss of the ACT2 isovariant.

View larger version (58K):
[in this window]
[in a new window]
|
Figure 5.
Actin protein expression of the act2-1
mutant. a through c, Membrane imprints of total protein from
act2-1/act2-1 and ACT2 wild-type seedlings
resolved by SDS-PAGE were incubated with three distinct monoclonal
antibodies that recognize different subsets of actin proteins. Relative
signal strengths for these antibodies are shown below each band. a,
Monoclonal antibody mAbGPa is a general antibody that recognizes all
plant actins. b, Monoclonal antibody mAb2345a recognizes all
Arabidopsis actins (ACT1, -3, -4, -7, -11, and -12) except those in
subclass 1 (ACT2 and ACT8). c, Monoclonal antibody mAb13a recognizes
only ACT2, -8, and -11 of subclasses 1 and 3. d, Western-blot
analysis of late pollen actin protein expression in leaves of the
act2-1/act2-1 mutant complemented with
tACT1c. Duplicate membranes were reacted with mAbGPa
(top) and mAb45a (bottom). Monoclonal antibody mAb45a reacts with the
late pollen actins including ACT1, which are not expressed in
vegetative tissue of wild-type plants. Lane 1, Wild-type (WT) control.
Lanes 2 and 3, Two mutant independent plant lines in which the
act2-1 mutation is complemented with tACT1c
construct expressing ACT1.
|
|
Western-blot analysis revealed that act2-1 mutant plants
complemented with tACT7g or tACT1c transgenes and
showing the wild-type root hair morphology expressed higher levels of
total actin protein in vegetative organs than their mutant parents. For
example, when protein extracts from wild-type plants and mutants
complemented with tACT1c are reacted with the general actin
antibody, mAbGPa, almost similar levels of total actin were detected in
all plants (Fig. 5d, top panel). When duplicates of these filters were
reacted with monoclonal antibody mAb45a, which reacts only with
late-pollen-specific actins including ACT1, ACT1 protein is found at
significant levels in the complemented lines (Fig. 5d,
act2-1:tACT1c) but not in the wild-type plants
(Fig. 5d, WT). Similar levels of total actin were seen in the
tACT7g complemented lines (not shown) and in several
repetitions of these experiments.
The Phenotypes of an act2-1 + act7-1 Double
Mutant
Considering that the ACT2 gene encodes the most highly
expressed Arabidopsis actin in nearly all mature vegetative tissues, it
was surprising that after its disruption, only defects in root hairs
were observed. This suggested that the remaining actins were
sufficiently redundant in function and expression patterns that they
contributed to the nearly normal development of act2-1 mutant plants. To asses the need for other vegetative actins, double
mutant plants homozygous for both act2-1 and
act7-1 alleles were generated from crosses of plants
containing the individual mutant alleles. The act7-1 allele
is a T-DNA insertion with undetectable levels of ACT7 protein in
seedlings (McKinney et al., 1995 ; Gilliland et
al., 2002 ). Thus, the act2-1 + act7-1 double mutant
plant is effectively null for two of the three vegetative actin genes, leaving ACT8 as the only functional vegetative actin gene
(An et al., 1996b ). The double mutant has severe
abnormalities in nearly every aspect of development, as shown in Figure
6. When grown on a Suc-containing medium,
the seedlings and plants are severely dwarfed (Fig. 6a, right) but are
able to grow and produce functional reproductive structures and a few
viable seeds by self-fertilization. The leaves are small and curled
under and have high densities of phenotypically normal trichomes. A
wild-type leaf from the same aged plant (Fig. 6a, left) is shown for
comparison. Only a small number of flowers are produced, and siliques
never fully elongate compared with wild-type plants, but otherwise the
double mutant flowers appear fully normal. The root system is highly branched (Fig. 6a). Compared with elongated wild-type root epidermal cells, the surface cells of the double mutant roots appear rounded, swollen, and even bulbous (Fig. 6c). The root epidermal cells are not
arranged in regular files and almost always lack root hairs. The plants
are poorly anchored into the solid growth medium.

View larger version (164K):
[in this window]
[in a new window]
|
Figure 6.
Phenotypes of the act2-1 + act7-1
double mutant. a, A 5-week-old double mutant grown on Murashige and
Skoog medium with 1% (w/v) Suc. The plant has started to bolt
and is shown next to a rosette leaf from a wild-type plant of the same
age. The crooked stem is a result of prolonged growth on a petri plate
and not an abnormality of the double mutant (bar = 2 mm). b,
Eleven-day-old double mutant arrested in development after germinating
on Murashige and Skoog medium lacking exogenous sugar; bar = 0.2 mm. c, Dark field image of root from act2-1 act7-1 double
mutant grown on Suc showing bulging surface cells and absence of root
hairs.
|
|
The phenotype of the double mutant is drastically different when grown
without a supplemental sugar source (Fig. 6b). The seeds germinate, but
seedlings arrest in growth at the appearance of the first leaves.
Primary roots are much thinner than the hypocotyls, lack root hairs,
and do not grow into the solid medium. The cotyledons look normal but
do not extend on petioles and turn chlorotic after 2 weeks. The first
true leaves are just visible at the base of the cotyledons and usually
remain green well after bleaching of the cotyledons. There are few
visible trichomes on the true leaves. Double mutants germinated on
plates supplemented with mannitol or higher concentrations of agar were
less drastic and exhibited phenotypes closely resembling those
germinated on Suc. This effect may indicate that the phenotype is
modulated by osmolarity similar to the effect on act2-1
single mutants.
 |
DISCUSSION |
ACT2-Specific Functions in Root Hair Elongation
The disruption of a highly expressed vegetative actin gene,
ACT2, resulted in an extreme root hair phenotype. We
observed no phenotypes in any above-ground organs or cells including
leaves, trichomes, stems, and flowers. Although the above-ground plant structures were unaffected, the process of root hair elongation is
compromised. It has been shown with both genetic (Schiefelbein and Somerville, 1990 ; Parker et al., 2000 ) and
biochemical studies (Bibikova et al., 1999 ;
Miller et al., 1999 ) that root hair growth can be
separated into three distinct phases: determination of the trichoblast
cell to form a root hair, initiation of the hair as a bulge, and tip
elongation. Loss of ACT2 in the act2-1 mutant does not affect root hair number or positioning, a finding that agrees
well with existing data that new actin polymerization is not needed to
determine which cells initiate root hair development (Miller et
al., 1999 ; Baluska et al., 2000 ). However, both
visualization of actin filaments and chemical inhibition of actin has
suggested a strong role for actin in root hair elongation. Actin
filament bundles are seen running the length of the root hair during
root hair elongation and thin out to undetectable levels in the apical tip (Miller et al., 1999 ). The actin perturbing drug,
cytochalasin D, stops elongation of root hairs but does not prevent
initiation of root hair bulges (Miller et al., 1999 ). It
is interesting to note here that the role of actin in tip growth has
also been established in organisms from several kingdoms. For example,
fruitfly (Drosophila melanogaster) bristle elongation
(Hopmann et al., 1996 ; Tilney et al.,
2000 ) and hyphal tip morphogenesis in Saprolegnia
ferax and Neurospora crassa (Heath et al.,
2000 ) are also dependent on the actin cytoskeleton.
The phenotypes of the act2-1 mutant and complementation data
with the wild-type gene not only corroborates the requirement of actin
for root hair elongation, but identifies a specific actin gene required
for this function: ACT2. Our analysis of protein levels with
subclass-specific monoclonal antibodies indicate that the mutant plants
have significantly less total actin than wild-type plants (Fig. 5).
Evidence is presented demonstrating that other actin isovariants can
substitute for the loss of ACT2 and restore normal root hair elongation
to the act2-1 mutant: An exogenous genomic copy of the
ACT7 gene and ectopic expression of the ACT1 coding region under the regulatory regions of ACT2 both
suppressed the short and bulbous root hair phenotypes. These data argue
that individual actin proteins are, at least in part, functionally redundant for root hair elongation and suggest that the normal expression pattern of ACT2 may be the primary factor
responsible for its dominance in the root hair elongation process. The
predominantly pollen-specific ACT1 might substitute for ACT2 function,
despite the hundreds of millions of years separating these protein
sequences, because the parallel functions of pollen tube and root hair
elongation by tip growth may have conserved similar functional domains
on these actin proteins. Kumar et al. (1997) report a
similar example of actin functional redundancy in mice, where the
coding region of one actin isovariant expressed under an appropriate
promoter can partially rescue a defect caused by the loss of a
different actin isovariant. Nevertheless, although other actin
proteins, ACT8 and ACT7, are found in trichoblasts (An et al.,
1996b ; McDowell et al., 1996a ), they appear to
be less effective at performing the task of root hair elongation. A
mutation in ACT7, which is strongly expressed in root hairs,
does not affect root-hair elongation (Gilliland et al.,
2002 ), further indicating that Arabidopsis specifically uses
ACT2 protein as the main actin responsible for root hair elongation.
These data showing functional redundancy of plant actin for root hair
elongation are in sharp contrast to the results from ectopically
expressing ACT1 protein in the rest of the plant organs and tissues
(Kandasamy et al., 2002 ). Ectopic ACT1 protein
expression from the ACT2 promoter and terminator regulatory regions
disrupted leaf, shoot, flower, and silique development, and resulted in severe dwarf phenotypes. Even the epidermal cells of leaves and hypocotyls were dwarfed when ecotopically expressing ACT1.
Overexpression of ACT2 itself did not give these dwarf phenotypes.
Ectopic expression of tACT1c in the act2-1 mutant
background produced the same above-ground phenotypes (not shown). There
appear to be common functional elements required for root hair
elongation that are shared among the diverse ACT1 and ACT2 isovariants
and not compatible with many other aspects of above-ground plant development.
Bulbous Root Hair Phenotype and Cell Wall Defects
The bulging of the root hair base in the act2-1 mutants
is more difficult to explain than shortened root hairs partly because this root hair phenotype is far less commonly reported than defects in
elongation. The mutation root hair development 1-1, which
maps to a different location than any actin gene (McKinney and
Meagher, 1998 ; Parker et al., 2000 ), causes
swelling of the root hair base with root hair length varying greatly
depending on the gelling agent used in the medium (Schiefelbein
and Somerville, 1990 ; Favery et al., 2001 ).
Similarly, the pronounced bulbous root hair phenotype of the
act2-1 mutant was observed only when the Phytagel gelling agent was used instead of Phytagar and the phenotype required the
presence of an osmoticum in the medium. This sensitivity of the
phenotype to growth substrate suggests that part of the selection against the act2-1 mutant may be intermittent
(Brookfield, 1997 ; Nowak et al., 1997 )
and dependent upon environmental conditions such as contact with the
substrate or soil.
Extrapolation of the phenotypes in yeast actin mutants and proposed
actin functions in plants suggest a compelling explanation for the
bulge observed at the base of the act2-1 mutant root hairs. Both cell wall deposition and transport of secretory vesicles are
likely functions for actin in expanding yeast cells (Novick and
Botstein, 1985 ; Gabriel and Kopecka, 1995 ) and
plants (Kobayashi et al., 1987 ; Foissner and
Wasteneys, 1997 ; Boevink et al., 1998 ). Although
root-hair determination and initiation remain intact, there may still
be a stimulus for tip growth. But the loss of actin may result in
inadequate transportation of vesicles carrying the necessary building
blocks and enzymes to the growing tip and the accumulation of these
vesicles at the base of the root hair. Mislocalization and/or
accumulation of cell wall-loosening components at the base of the root
hair may allow the cell wall to expand and bulge. The effect of
altering medium osmolarity on the phenotype of the root hairs is
particularly striking, because yeast actin mutants also have osmotic
sensitivity. Increased osmotic strength of the medium significantly
lowered the permissive temperature for the yeast phenotype
(Novick and Botstein, 1985 ). This finding suggests a
parallel function for plant actin in osmoregulation, because in our
study the bulbous root hair phenotype is conditionally dependent on a
high-osmotic-strength medium.
The Essential Role for Actin in Plant Development
The gross morphological phenotypes of the act2-1 + act7-1 double mutant give us further insight into the functions of
the actin in plants. Although six other functional actin genes remain, there is only one fully functioning vegetative actin gene,
ACT8. The double act2-1 + act7-1 mutant has
severe phenotypes in practically all aspects of vegetative plant
growth, underscoring the diverse functions of these two actins in the
plant cytoskeleton and linked developmental processes. In fact, the
plants are not viable without a metabolizable sugar source. The
severity of the phenotype of the double mutant is not simply an
additive combination of the single mutants, which would indicate the
action of independent genes. Rather, the sever phenotype suggests a
synergistic relationship between the two actin genes. This synergistic
relationship argues against stringent sorting of isovariants into
specific filaments. If each isovariant was sorted into specific
filaments, the removal of one isovariant would eliminate specific
groups of filaments responsible for a subset of functions. The
resultant double mutant would then be expected to have an additive
combination of the two phenotypes of the single mutants, because both
subsets of filaments and their dependent functions are disrupted. A
microfilament system using a common pool of actin monomers in
heteropolymers would alternately be only mildly disturbed by the loss
of a single actin gene product, because other isovariants are present
and all classes of filaments could still be assembled. A quantitative loss of actin protein would affect polymerization rates of the whole
microfilament system, and thereby of most systems dependent on actin,
and would result in the severe, synergistic phenotype seen in the
double mutant. Future cell biological research with actin
isovariant-specific antibodies or in vitro biochemical analysis of
purified actin isovariants can test this model for isovariant sorting.
The dwarfed size, high density of trichomes on leaves, and rounded
shape of surface root cells in the double mutant may suggest that a
shortage of actin prevents some cells from expanding or elongating
properly (Staiger and Cande, 1991 ; Meagher et
al., 1999b ). The swollen nature of the root surface cells may
indicate a defect in the cell wall, an idea further supported by the
observation that the double mutant root was permeated more rapidly by
the fixative osmium tetroxide than a wild-type root (data not shown). The lack of root hairs on the double mutant further underscores the
requirement of actin for root hair elongation, and the extensive lateral root formation may be an attempt to compensate for the decrease
of surface area vital for nutrient uptake. The presence of normal and
fertile reproductive structures in double mutant plants grown on Suc is
consistent with the normally low expression or absence of both
ACT7 and ACT2 in reproductive structures and with
the strong expression of the five reproductive actin genes that are
still functional.
The root-hair-specific phenotype of the act2-1 single mutant
contrasts with the broad systemic phenotypes of the act2-1 + act7-1 double mutant. The enhanced fitness of plants maintaining the ACT2 allele instead of the act2-1 allele
(Asmussen et al., 1998 ; Gilliland et al.,
1998 ) implies ACT2 plays an essential and distinct
role in plant development. The decrease in root hair length found on
the act2-1 mutant plants demonstrates the role of
ACT2 in root hair development and probably explains the loss of fitness when act2-1 plants were grown at high density on
soil and competing for nutrients. When the root-hair-specific
act2-1 phenotype is compared with the extensive systemic
phenotypes of the double mutants, it appears that many of the roles of
ACT2 can be seen as partially redundant with other actins.
The functions lost in the double mutant must normally be performed
jointly and redundantly with the other actin isovariants present in
vegetative tissues (e.g. ACT7 and ACT8). The
severity and range of defects in the double mutant demonstrate that
both the universal and essential roles of actin in vegetative cells can
use multiple isovariants with partially overlapping functions.
 |
MATERIALS AND METHODS |
Growth Conditions and Media
A homozygous act2-1 line that was free of other
T-DNA insertions (McKinney et al., 1995 ) was backcrossed
to the wild-type Wassilewskija ecotype. The offspring of this backcross
were used for all analyses. All plants were grown at 22°C at 16-h
days/8-h nights. Plants exhibiting bulbous root hairs were grown on
vertical plates containing one-half strength Murashige and Skoog salts, 0.3% (w/v) Phytagel (Sigma-Aldrich), and 1% (w/v) Suc.
This medium was adjusted to 1.0% to 3.0% (w/v) Suc to assess
changes in the phenotype. Liquid culture medium contained
one-quarter Murashige and Skoog salts and 0.5% (w/v) Suc. In
some experiments the Phytagel gelling agent was replaced with Phytagar
(Invitrogen). Mature plants used for northern analysis were grown on
soil under artificial light. Nine-day-old seedlings used for western
analysis were grown in liquid culture.
Immunocytochemistry
Root hair samples were prepared for F-actin labeling using the
rapid freeze fixation and freeze substitution methods described previously (Kandasamy et al., 2002 ). The general actin
monoclonal antibody mAbGPa, which reacts with all the Arabidopsis actin
isovariants, was used for immunocytochemistry at 5 µg
mL 1 concentration.
PCR Primers and Methods
The following primers were used to distinguish the various
ACT2 alleles (arrows in Fig. 1). Pairing AAc2-I485S with
a primer found in the right border of the T-DNA (RB16843S) will amplify the act2-1 allele, whereas pairing it with an antisense
actin primer (AAc2-ATG30A) located in the first coding exon at the
insertion site will preferentially amplify the wild-type
ACT2 allele (Gilliland et al.,
1998 ). Pairing a sense primer located outside of the cloned area of ACT2, in the T-DNA (BINTD2369,
ACTGGAAAGCGGGCAGT- GAGCGCAACGCAAT, or BINTD2683,
AAGGAGCGGGCGCCATTCAGGCTGCGCAAC-TGT) or the Arabidopsis genome
(AAc2-1414S, TATAAGTGACGAGGACACCAACAAAC-TATT), to the common antisense primer ATG30A specifically amplifies only the complementing (tACT2) allele and native ACT2 alleles,
respectively, using PCR. Leaf or cotyledon tissue DNA was prepared as
described by Gilliland et al. (1998) and used as
template in PCR for genotype determination.
Complementation of the act2-1 allele: A 5.5-kb
HindIII genomic clone of ACT2 (An
et al., 1996b ) was digested with SalI and yielded a 4-kb fragment containing the full ACT2 gene
including 750 bp of sequence upstream of the TATA box. This product was cloned into the SalI site of pBluescript and subcloned
into the plant transformation vector pBIN19. The construct was
electroporated into Escherichia coli using Gene Pulser
(Bio-Rad, Hercules, CA) according to manufacturer's instructions.
Plasmids containing the genomic fragments were retrieved and isolated
using QIAprep Spin Miniprep kit (Qiagen USA, Valencia, CA) and directly
transformed into Agrobacterium tumenfaciens strain
C58C1. The configuration of the insertions was verified by both
restriction digests and PCR. The constructs were then transformed by
vacuum infiltration into 5-week-old
act2-1/act2-1 plants as described by
Bariola et al. (1999) . Seeds were collected about 3 weeks after vacuum infiltration and surface sterilized. The seeds were
imbibed at 4°C for 2 d and then placed in horizontal lines at
approximately 4 per cm on vertical plates containing 1% (w/v) Suc and
0.3% (w/v) Phytagel. The plants were screened under a
dissecting scope (12-25×) for elongated root hairs after 2 weeks of
growth. Any plants containing long wild-type root hairs were gently
removed and transplanted to moist soil. Approximately 20 to 35 progeny
from each of the potential tACT2 transformants were
plated vertically on Phytagel medium and scored for root hair
phenotype. The tACT7 and tACT1c constructs were prepared as described by Gilliland et al.
(2002) and Kandasamy et al. (2002) , respectively,
and vacuum infiltrated into act2-1/act2-1
plants as above.
RNA Preparation and Northern Analysis
RNA was prepared as by Logemann et al. (1987) ,
and 30 µg was resolved on a 1% (w/v) agarose, 16% (v/v)
formaldehyde gel and transferred onto a Biotrans (+) nylon
membrane by chromatography. A PCR product using primers AAc2-376S
(An et al., 1996b ) and AAc2-3'A2 (ACTAAAACGCAAAACGAAAGCGGTT; Fig. 1) was gel purified and labeled with
[ -32P]dATP by Klenow (Feinberg and Vogelstein,
1983 ). The probe was purified through a Sepharose 6B column.
Blots were hybridized for 48 h as described by An et
al. (1996a) and washed twice for 15 min with 6× SSC and 0.5%
(w/v) SDS, once for 10 min with 2× SSC and 0.2% (w/v) SDS, and
once for 5 min with 1× SSC and 0.1% (w/v) SDS. The blots were
exposed to X-film (Eastman Kodak, Rochester, NY) for 4 to 16 d. A
densitometer (Molecular Dynamics, Sunnyvale, CA) was used to compare
hybridization strength. An rRNA probe was hybridized to the previously
used blot to demonstrate equal loading. The 26-nucleotide antisense
rRNA oligo complementary to the 18S subunit sequence starting at
nucleotide 1,627 (Eckenrode et al., 1985 ) was
radiolabeled as described by Tanzer and Meagher (1995) .
Prehybridization was performed with Blotto mix of 0.25% (w/v) dry
milk, 2× SSC, and 0.2% (w/v) SDS. The blot was hybridized at
48°C and washed three times with a solution of 2× SSC and 0.5% (w/v) SDS. Blot was exposed to X-film for 10 min.
Protein Preparation and Western Analysis
Plant extracts were prepared in actin stabilization buffer as
described by Kandasamy et al. (1999) . Protein samples
were separated on a 12% (w/v) SDS-PAGE gel, and western was
performed as described by Kandasamy et al. (1999) , but
washed five times before incubation with the secondary antibody.
Western blots in Figure 5 were exposed to Hyperfilm (Amersham
Biosciences AB, Uppsala) for 20 to 60 s. A Molecular Dynamics
densitometer was used to compare the signals.
Generation of Double Mutants
The pollen of an ACT7/act7-1 plant
was crossed to an emasculated
act2-1/act2-1 parent, the progeny were
screened by PCR for the presence of the act7-1 allele,
and these F1 plants were allowed to self-pollinate.
F2 progeny displaying the dwarf phenotypes were checked by
PCR for presence of both mutant alleles and the absence of both
wild-type alleles.
 |
ACKNOWLEDGMENTS |
We thank Libby McKinney for helpful suggestions during a number
of experiments and Gay Gragson for editing the manuscript.
 |
FOOTNOTES |
Received November 27, 2001; returned for revision September 18, 2002; accepted September 18, 2002.
1
This work was supported by the National
Institutes of Health (Training grant no. 2T32-GM 07103-27 to the
Genetics Department and grant no. GM 36397-14 to L.U.G.).
*
Corresponding author; e-mail meagher{at}arches.uga.edu; fax
706-542-1387.
Article, publication date, and citation information can be found at
www.plantphysiol.org/cgi/doi/10.1104/pp.014068.
 |
LITERATURE CITED |
-
An Y-Q, Huang S, McDowell JM, McKinney EC, Meagher RB
(1996a)
Conserved expression of the Arabidopsis ACT1 and ACT3 actin subclass in organ primordia and mature pollen.
Plant Cell
8: 15-30[Abstract]
-
An Y-Q, McDowell JM, Huang S, McKinney EC, Chambliss S, Meagher RB
(1996b)
Strong, constitutive expression of the Arabidopsis ACT2/ACT8 actin subclass in vegetative tissues.
Plant J
10: 107-121[CrossRef][Web of Science][Medline]
-
Asmussen MA, Gilliland LU, Meagher RB
(1998)
Detection of deleterious genotypes in multigenerational studies: II. Theoretical and experimental dynamics with selfing and selection.
Genetics
149: 727-737[Abstract/Free Full Text]
-
Baluska F, Salaj J, Mathur J, Braun M, Jasper F, Samaj J, Chua NH, Barlow PW, Volkmann D
(2000)
Root hair formation: F-actin-dependent tip growth is initiated by local assembly of profilin-supported F-actin meshworks accumulated within expansin-enriched bulges.
Dev Biol
227: 618-632[CrossRef][Web of Science][Medline]
-
Bariola PA, MacIntosh GC, Green PJ
(1999)
Regulation of S-like ribonuclease levels in Arabidopsis: Antisense inhibition of RNS1 or RNS2 elevates anthocyanin accumulation.
Plant Physiol
119: 331-342[Abstract/Free Full Text]
-
Bibikova TN, Blancaflor EB, Gilroy S
(1999)
Microtubules regulate tip growth and orientation in root hairs of Arabidopsis thaliana.
Plant J
17: 657-665[CrossRef][Web of Science][Medline]
-
Boevink P, Oparka K, Santa Cruz S, Martin B, Betteridge A, Hawes C
(1998)
Stacks on tracks: The plant Golgi apparatus traffics on an actin/ER network.
Plant J
15: 441-447[CrossRef][Web of Science][Medline]
-
Brookfield JFY
(1997)
Genetic redundancy.
In
JC Hall, T Friedmann, JC Dunlap, F Giannelli, eds, Advances in Genetics, Vol. 36. Academic Press, San Diego, pp 137-155
-
Eckenrode VK, Arnold J, Meagher RB
(1985)
Comparison of the nucleotide sequence of soybean 18S rRNA with the sequence of other small subunit rRNAs.
J Mol Evol
21: 259-269
-
Favery B, Ryan E, Foreman J, Linstead P, Boudonck K, Steer M, Shaw P, Dolan L
(2001)
KOJAK encodes a cellulose synthase-like protein required for root hair cell morphogenesis in Arabidopsis.
Genes Dev
15: 79-89[Abstract/Free Full Text]
-
Feinberg AP, Vogelstein B
(1983)
A technique for radiolabelling DNA restriction endonuclease fragments to high specific activity.
Anal Biochem
132: 6-13[CrossRef][Web of Science][Medline]
-
Foissner I, Wasteneys GO
(1997)
A cytochalasin-sensitive actin filament meshwork is a prerequisite for local wound wall deposition in Nitella internodal cells.
Protoplasma
200: 17-30
-
Fyrberg EA, Fyrberg CC, Biggs JR, Saville D, Beall CJ, Ketchum A
(1998)
Functional nonequivalence of Drosophila actin isoforms.
Biochem Genet
36: 271-287[CrossRef][Web of Science][Medline]
-
Gabriel M, Kopecka M
(1995)
Disruption of the actin cytoskeleton in budding yeast results in formation of an aberrant cell wall.
Microbiology
141: 891-899[Abstract/Free Full Text]
-
Gilliland LU, McKinney EC, Asmussen MA, Meagher RB
(1998)
Detection of deleterious genotypes in multigenerational studies: I. Disruptions in individual Arabidopsis actin genes.
Genetics
149: 717-725[Abstract/Free Full Text]
-
Gilliland LU, Pawloski L, Kandasamy MK, Meagher RB (2002)
The Arabidopsis actin isovariant, ACT7, plays a vital role
in germination and root growth. Plant J (in press)
-
Heath IB, Gupta G, Bai S
(2000)
Plasma membrane-adjacent actin filaments, but not microtubules, are essential for both polarization and hyphal tip morphogenesis in Saprolegnia ferax and Neurospora crassa.
Fungal Genet Biol
30: 45-62[CrossRef][Web of Science][Medline]
-
Hightower RC, Meagher RB
(1986)
The molecular evolution of actin.
Genetics
114: 315-332[Abstract/Free Full Text]
-
Hopmann R, Cooper JA, Miller KG
(1996)
Actin organization, bristle morphology, and viability are affected by actin capping protein mutations in Drosophila.
J Cell Biol
133: 1293-1305[Abstract/Free Full Text]
-
Huang S, An Y-Q, McDowell JM, McKinney EC, Meagher RB
(1997)
The Arabidopsis ACT11 actin gene is strongly expressed in tissues of the emerging inflorescence, pollen and developing ovules.
Plant Mol Biol
33: 125-139[CrossRef][Web of Science][Medline]
-
Kandasamy MK, Gilliland L, McKinney E, Meagher RB
(2001)
One plant actin isovariant, ACT7, is induced by auxin and required for normal callus formation.
Plant Cell
13: 1541-1554[Abstract/Free Full Text]
-
Kandasamy MK, McKinney E, Meagher RB
(1999)
The late pollen specific actins in angiosperms.
Plant J
18: 681-691[CrossRef][Web of Science][Medline]
-
Kandasamy MK, McKinney EC, Meagher RB
(2002)
Functional non-equivalency of actin isovariants in Arabidopsis.
Mol Biol Cell
13: 251-261[Abstract/Free Full Text]
-
Kobayashi H, Fukuda H, Shibaoka H
(1987)
Reorganization of actin filaments associated with the differentiation of tracheary elements in Zinnia mesophyll cells.
Protoplasma
138: 69-71[CrossRef][Web of Science]
-
Kumar A, Crawford K, Close L, Madison M, Lorenz J, Doetschman T, Pawlowski S, Duffy J, Neumann J, Robbins J, et al
(1997)
Rescue of cardiac alpha-actin-deficient mice by enteric smooth muscle gamma-actin.
Proc Natl Acad Sci USA
94: 4406-4411[Abstract/Free Full Text]
-
Lewontin RC
(1974)
The problem of genetic diversity.
Harvey Lect
70: 1-20[Medline]
-
Logemann J, Schell J, Willmitzer L
(1987)
Improved method of isolation of RNA from plant tissues.
Anal Biochem
163: 16-20[CrossRef][Web of Science][Medline]
-
Mascarenhas JP
(1993)
Molecular mechanisms of pollen tube growth and differentiation.
Plant Cell
5: 1303-1314[Free Full Text]
-
McDowell J, An Y-Q, McKinney EC, Huang S, Meagher RB
(1996a)
The Arabidopsis ACT7 actin gene is expressed in rapidly developing tissues and responds to several external stimuli.
Plant Physiol
111: 699-711[Abstract]
-
McDowell JM, Huang S, McKinney EC, An Y-Q, Meagher RB
(1996b)
Structure and evolution of the actin gene family in Arabidopsis thaliana.
Genetics
142: 587-602[Abstract]
-
McKinney EC, Ali N, Traut A, Feldmann KA, Belostotsky DA, McDowell JM, Meagher RB
(1995)
Sequence-based identification of T-DNA insertion mutations in Arabidopsis: actin mutants act2-1 and act4-1.
Plant J
8: 613-622[CrossRef][Web of Science][Medline]
-
McKinney EC, Meagher RB
(1998)
Members of the Arabidopsis actin gene family are widely dispersed in the genome.
Genetics
149: 663-675[Abstract/Free Full Text]
-
Meagher RB, McKinney EC, Kandasamy MK
(1999a)
Isovariant dynamics expand and buffer the responses of complex systems: the diverse plant actin gene family.
Plant Cell
11: 995-1006[Free Full Text]
-
Meagher RB, McKinney EC, Vitale AV
(1999b)
The evolution of new structures: clues from plant cytoskeletal genes.
Trends Genet
15: 278-284[CrossRef][Web of Science][Medline]
-
Meagher RB, McLean BG
(1990)
Diversity of plant actins.
Cell Motil Cytoskeleton
16: 164-166
-
Meagher RB, Williamson RE
(1994)
The plant cytoskeleton.
In
E Meyerowitz, C Somerville, eds, Arabidopsis. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp 1049-1084
-
Miller DD, de Ruijter NCA, Bisseling T, Emons AMC
(1999)
The role of actin in root hair morphogenesis: studies with lipochito-oligosaccharide as a growth stimulator and cytochalasin as an actin perturbing drug.
Plant J
17: 141-154
-
Novick P, Botstein D
(1985)
Phenotypic analysis of temperature-sensitive yeast actin mutants.
Cell
40: 405-416[CrossRef][Web of Science][Medline]
-
Nowak MA, Boerlijist C, Cooke J, Smith JM
(1997)
Evolution of genetic redundancy.
Nature
388: 167-171[CrossRef][Medline]
-
Parker JS, Cavell AC, Dolan L, Roberts K, Grierson CS
(2000)
Genetic interactions during root hair morphogenesis in Arabidopsis.
Plant Cell
12: 1961-1974[Abstract/Free Full Text]
-
Schiefelbein JW, Somerville C
(1990)
Genetic control of root hair development in Arabidopsis thaliana.
Plant Cell
2: 235-243[Abstract/Free Full Text]
-
Staiger CJ, Cande WZ
(1991)
Microfilament distribution in maize meiotic mutants correlates with microtubule organization.
Plant Cell
3: 637-644[Abstract/Free Full Text]
-
Tanzer MM, Meagher RB
(1995)
Degradation of the soybean ribulose-1,5-bisphosphate carboxylase small-subunit mRNA, SRS4, initiates with endonucleolytic cleavage.
Mol Cell Biol
15: 6641-6652[Abstract]
-
Tilney LG, Connelly PS, Vranich KA, Shaw MK, Guild GM
(2000)
Actin filaments and microtubules play different roles during bristle elongation in Drosophila.
J Cell Sci
113: 1255-1265[Abstract]
© 2002 American Society of Plant Biologists
This article has been cited by other articles:

|
 |

|
 |
 
M. K. Kandasamy, E. C. McKinney, and R. B. Meagher
A Single Vegetative Actin Isovariant Overexpressed under the Control of Multiple Regulatory Sequences Is Sufficient for Normal Arabidopsis Development
PLANT CELL,
March 1, 2009;
21(3):
701 - 718.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Berkowitz, R. Jost, S. Pollmann, and J. Masle
Characterization of TCTP, the Translationally Controlled Tumor Protein, from Arabidopsis thaliana
PLANT CELL,
December 1, 2008;
20(12):
3430 - 3447.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. K. Kandasamy, B. Burgos-Rivera, E. C. McKinney, D. R. Ruzicka, and R. B. Meagher
Class-Specific Interaction of Profilin and ADF Isovariants with Actin in the Regulation of Plant Development
PLANT CELL,
October 1, 2007;
19(10):
3111 - 3126.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Deeks, C. Rodrigues, S. Dimmock, T. Ketelaar, S. K. Maciver, R. Malho, and P. J. Hussey
Arabidopsis CAP1 a key regulator of actin organisation and development
J. Cell Sci.,
August 1, 2007;
120(15):
2609 - 2618.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Stevenson-Paulik, R. J. Bastidas, S.-T. Chiou, R. A. Frye, and J. D. York
Generation of phytate-free seeds in Arabidopsis through disruption of inositol polyphosphate kinases
PNAS,
August 30, 2005;
102(35):
12612 - 12617.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X.-B. Li, X.-P. Fan, X.-L. Wang, L. Cai, and W.-C. Yang
The Cotton ACTIN1 Gene Is Functionally Expressed in Fibers and Participates in Fiber Elongation
PLANT CELL,
March 1, 2005;
17(3):
859 - 875.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Diet, S. Brunner, and C. Ringli
The enl Mutants Enhance the lrx1 Root Hair Mutant Phenotype of Arabidopsis thaliana
Plant Cell Physiol.,
June 15, 2004;
45(6):
734 - 741.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Nishimura, E. Yokota, T. Wada, T. Shimmen, and K. Okada
An Arabidopsis ACT2 Dominant-Negative Mutation, which Disturbs F-actin Polymerization, Reveals its Distinctive Function in Root Development
Plant Cell Physiol.,
November 15, 2003;
44(11):
1131 - 1140.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|