First published online January 9, 2003; 10.1104/pp.010124
Plant Physiol, February 2003, Vol. 131, pp. 463-471
Subcellular Targeting of Methylmercury Lyase Enhances Its
Specific Activity for Organic Mercury Detoxification in
Plants1
Scott P.
Bizily,
Tehryung
Kim,
Muthugapatti K.
Kandasamy, and
Richard B.
Meagher*
Genetics Department, University of Georgia, Athens, Georgia
30602
 |
ABSTRACT |
Methylmercury is an environmental pollutant that
biomagnifies in the aquatic food chain with severe consequences for
humans and other animals. In an effort to remove this toxin in situ, we
have been engineering plants that express the bacterial mercury resistance enzymes organomercurial lyase MerB and mercuric ion reductase MerA. In vivo kinetics experiments suggest that the diffusion
of hydrophobic organic mercury to MerB limits the rate of the coupled
reaction with MerA (Bizily et al., 2000). To optimize reaction kinetics for organic mercury compounds, the
merB gene was engineered to target MerB for accumulation
in the endoplasmic reticulum and for secretion to the cell wall. Plants
expressing the targeted MerB proteins and cytoplasmic MerA are highly
resistant to organic mercury and degrade organic mercury at 10 to 70 times higher specific activity than plants with the cytoplasmically distributed wild-type MerB enzyme. MerB protein in endoplasmic reticulum-targeted plants appears to accumulate in large vesicular structures that can be visualized in immunolabeled plant cells. These
results suggest that the toxic effects of organic mercury are focused
in microenvironments of the secretory pathway, that these hydrophobic
compartments provide more favorable reaction conditions for MerB
activity, and that moderate increases in targeted MerB expression will
lead to significant gains in detoxification. In summary, to maximize
phytoremediation efficiency of hydrophobic pollutants in plants, it may
be beneficial to target enzymes to specific subcellular environments.
 |
INTRODUCTION |
In a rapidly maturing technology
called phytoremediation, plants serve as valuable tools for extracting,
sequestering, and detoxifying harmful environmental pollutants. Native
and genetically engineered plants can be used to degrade toxic organic
pollutants such as trinitrotoluene and trichloroethylene or to manage
immutable elemental pollutants such as the heavy metals mercury and
cadmium (Doty et al., 2000 ; Meagher,
2000 ; Hannink et al., 2001 ; Persans et
al., 2001 ). Methylmercury is one of the most hazardous
elemental pollutants in our environment and a major focus for
phytoremediation research (Meagher et al., 2000 ).
Methylmercury is extremely toxic and is efficiently biomagnified by
several orders of magnitude in long, aquatic food chains. It is the
primary source of human mercury poisoning from consuming fish. Using a
metabolic engineering approach, we have demonstrated the extraordinary
effectiveness of both MerB (organomercurial lyase) and MerA
(mercuric reductase) enzymes at detoxifying hazardous mercury compounds
{i.e. ionic mercury [Hg(II)], methylmercury, and phenylmercury
[PMA]} in transgenic plants (Rugh et al., 1998 ;
Bizily et al., 1999 ; Bizily et al., 2000 )
as shown in Reactions 1 and 2 (see below). MerB transforms methylmercury to less toxic, non-biomagnified ionic mercury [Hg(II), and MerA electrochemically reduces Hg(II) to the least toxic metallic mercury, Hg(0)]. When the MerB and MerA enzymes are co-expressed in
transgenic plants, the coupled reaction transforms methylmercury to
(Hg(0)) (Bizily et al., 2000 ). In this current study, we
examine the impact of subcellular protein targeting on mercury
phytoremediation.
|
|
(1)
|
|
(2)
|
|
Previous work showed that the MerB catalyzed
protonolysis of organic mercury limited the efficiency of the coupled
reaction in engineered plants even when MerB enzyme levels were
relatively high (Bizily et al., 2000 ). We propose two
mechanisms that could cause this problem. First, the cell wall (CW) and
cell membrane present semipermeable barriers to methylmercury ions,
which are probably bound by free thiol ligands at the cell periphery.
As a result, the toxin may accumulate in the CW and diffuse slowly into
the cytoplasm. Second, it is possible that methylmercury inside the
cell is partitioned into hydrophobic microenvironments, such as the
membrane-rich secretory pathway. The evidence for this proposal is the
nonlinear relationship between MerB concentration and the rate of the
two-step conversion of organomercurials to Hg(0) (Reactions 1 and 2).
Ten-fold increases in cytoplasmic MerB levels result in only 2-fold
increases in the protonolytic cleavage rate, even when MerA levels are
greatly in excess over MerB levels (Bizily et al.,
2000 ). In contrast, the rate at which ionic mercury Hg(II) is
reduced to Hg(0) (Reaction 2) is linearly correlated with
merA expression levels (Rugh et al., 1996 ).
Although the substrates for both enzymes are highly reactive, organic
mercurial compounds like methylmercury are much more hydrophobic than
free metal ions and this may affect their cellular behavior. The methyl group on methylmercury makes it far more membrane soluble than ionic
mercury; thus, in higher animals it concentrates in the membrane rich
organs and causes rapid lysosomal damage in cells (Eto et al.,
1997 ; Dare et al., 2001 ). This hydrophobicity
suggests that organomercurial substrates may not diffuse efficiently to the cytoplasmically expressed MerB enzyme.
We proposed that by modifying the bacterial merB gene and
targeting the MerB protein (Bizily et al., 2000 ) for
accumulation in the endoplasmic reticulum (ER) and for secretion to the
CW, we will improve the efficiency of organic mercury processing in plants. By analogy, native eukaryotic cytochrome P-450 hyroxylases that
process hydrophobic organic substrates are targeted to the hydrophobic
environments of the secretory pathway, primarily the ER, and do not
appear at significant levels in the cytoplasm ( Monier et al.,
1988 ; Szczesna-Skorupa and Kemper, 2000 ).
Similarly, we are targeting MerB to the hydrophobic ER and secretory
pathway, where access to organic mercury substrates may be improved. We demonstrate that Arabidopsis plant lines with ER-targeted or
CW-secreted versions of MerB more efficiently resist and detoxify
organic mercury than plants expressing MerB in the cytoplasm.
 |
RESULTS |
MerB, CW-MerB, and ER-MerB Expressed in Escherichia
coli Confer Resistance to PMA
Two merB gene constructs targeting modified MerB
proteins are diagrammed in Figure
1A. The
CW-merB gene encodes CW-MerB with the N-terminal 21-amino
acid signal sequence from tobacco (Nicotiana tabacum)
extensin after the initiator Met codon. Thus, the modified protein
targets the secretory pathway, which carries it through the plasma
membrane to the CW. The ER-merB gene encodes a protein containing the same N-terminal signal sequence as CW-MerB. This gene
also encodes, just before the stop codon, an ER retention signal (KDEL)
characteristic of a large number of ER-accumulated proteins. The goal
of the ER-MerB construct was to trap MerB activity within the secretory
pathway. Before examining the effectiveness of these modified MerB
proteins in plants, we compared their enzymatic and immunological
activities in E. coli with a wild-type (WT) MerB protein
that accumulates in the cytoplasm.

View larger version (30K):
[in this window]
[in a new window]
|
Figure 1.
Modification of the bacterial merB gene
for CW- and ER-specific expression in plants. A, WT 642-bp bacterial
coding sequence of merB (Bizily et al., 1999 )
was altered by two cycles of nested PCR to make gene constructs
targeting the protein product to the CW (CW-merB) and ER
(ER-merB). Arrows show the position of the mutagenic primers
used. B, Bacterial disc sensitivity assays with PMA were used to
compare the functionality of MerB, CW-MerB, and ER-MerB expressed in
E. coli as compared with the a bacterial strain containing
only the empty vector plasmid [( ) merB] or the WT bacterial
sequence (merB; see "Materials and Methods"). C, Western-blot
analysis of MerB, CW- MerB, and ER-MerB expression showed
that three different MerB antibodies all react similarly to
the modified MerB proteins. Blots of the bacterial extracts were probed
with rabbit polyclonal antibody (pAb-MerB) and mouse monoclonal
antibodies mAb10E2 and mAb2H8. CW-MerB and ER-MerB ran at slightly
higher Mrs than MerB as would be predicted
from their increased sequence lengths. CW-MerB and ER-MerB were
quantified (see "Materials and Methods") and normalized relative to
MerB levels in strains expressing WT merB. D. MerB, CW-MerB,
and ER-MerB protein levels were determined on western blots performed
on parallel samples of the crude protein extracts examined in the
p-chloromercuribenzoic acid (PCMB) spectrophotometric MerB
enzyme assays (Table I). The filter was reacted with pAb-MerB and 2-min
exposure is shown. MerB, CW-MerB, and ER-MerB bands were quantified
using a film exposed for 20 s (see Table I). The E. coli protein polynucleotide phosphorylase (PNPase), probed with a
polyclonal antibody, is shown to confirm the equal loading and transfer
of samples to the membrane. Band intensities were normalized relative
to WT MerB protein levels from three repetitions of this experiment
(see Table I).
|
|
The three constructs to be compared were cloned under the control of a
bacterial promoter and transformed into an E. coli strain
already expressing merA (see "Materials and Methods"). Thus, MerB activity would be coupled with MerA to give maximum bacterial resistance to organic mercury (i.e. coupled Reactions 1 and
2). Enzyme functionality was first verified by a disc sensitivity assay
in which 6-mm paper filter discs loaded with a source organic mercury
(PMA) were placed on top of freshly plated bacterial lawns. The
E. coli strain containing the WT form of merB was
the most organic mercury resistant and cells grew very near to the PMA disc with a small zone of clearance (Fig. 1B). Cells expressing merA and an empty vector plasmid,
pBS-SKII+, were highly sensitive to PMA and had a
large zone of clearance. The strains expressing the CW-merB
and ER-merB genes had clearance zones similar in size to
cells with the WT merB gene. Hence, both modified forms of
enzyme are highly active.
To quantitatively compare expression levels among MerB, CW-MerB, and
ER-MerB proteins, we had to exclude the possibility that the available
antibodies differed in their affinity to the modified forms of the
protein. Equal amounts of crude bacterial protein extracts from the
same four strains were separated by SDS-PAGE, blotted, and probed with
a polyclonal (pAb-MerB) and two monoclonal (mAb-2H8 and mAb-10E2)
antibodies that react with MerB (Fig. 1C). All three western blots
detected a single band at approximately 30 to 32 kD and showed similar
in expression levels among strains. The polyclonal antibody pAb-MerB
appeared to react slightly more strongly with the modified proteins
CW-MerB and ER-MerB than the monoclonal antibodies. Equal loading and
transfer of samples among the western blots was confirmed by probing
the high-Mr region of the same blots with
antibodies to PNPase (Fig. 1D, top). Among the strains, MerB was
expressed at the highest level, followed by CW-MerB, and then ER-MerB
at the lowest level. Most noteworthy, it appears that minor differences
in PMA resistance (Fig. 1B) result from significant differences in the
steady-state levels of protein in E. coli as described
previously for MerB levels in plants. The interpretation of these three
assays as independent measurements of MerB levels implicitly assumes
that all three antibodies recognize different epitopes. This is a
reasonable assumption because one of the antibodies is a rabbit
(Sylvilagus robustus) polyclonal and the two monoclonal
antibodies were produced from hybridoma cell lines derived from
different mice (Mus musculus).
Specific Activities of MerB, CW-MerB, and ER-MerB Expressed in
E. coli Are Similar
Even though the PMA resistance levels of the modified enzymes in
bacteria appear similar to WT and approximately proportional to enzyme
expression levels, it was still possible that that the specific
activities (enzyme activity per unit of protein) of the modified forms
of protein were no longer equivalent to WT MerB. To measure the
relative enzymatic activities of WT MerB, CW-MerB, and ER-MerB,
bacterial protein extracts from four Top 10F' E. coli
strains containing an empty vector or plasmids encoding
merB, CW-merB, and ER-merB were added
to enzyme assays containing 100 µM PCMB. PCMB
is a spectrophotometrically active, alternative substrate for the MerB
enzyme. PCMB assays were performed for each bacterial strain and the
values were averaged and are shown in Table
I. Extracts expressing WT MerB had the
strongest activity, followed again by CW-MerB, and ER-MerB had the
weakest activity. Relative protein concentrations were determined for
these same protein extracts (Table I) by quantifying and averaging
duplicate bands on western blots (Fig. 1D). Specific activities for
MerB (enzyme activity per unit protein) were calculated by dividing change in substrate absorbance by the relative amount of MerB, CW-MerB,
or ER-MerB protein added to the reaction chamber, presented in Table I.
These data show that there are no significant differences in specific
activities among MerB, CW-MerB, and ER-MerB enzymes for an organic
mercury substrate.
View this table:
[in this window]
[in a new window]
|
Table I.
Relative specific activities of WT and modified MerB
proteins in bacterial extracts toward an organomercury substrate
|
|
PMA Resistance Phenotypes of Plants Expressing Modified Forms of
MerB
The CW-merB and ER-merB genes were cloned
under control of a constitutive plant promoter in a plant
transformation vector in a manner similar to earlier expression
studies on WT merB (Bizily et al., 2000 ). The
same 35S promoter/nopaline synthase (NOS) terminator combination
was used for each gene construct. Five independently isolated
transgenic plant lines containing each new transgene in a constant
strong merA transgenic plant background (see "Materials and Methods") were analyzed for resistance to toxic organic mercury as shown in Figure 2. Two previously
characterized lines expressing transgenes for WT merB in
this same merA background (merA/merB lines AB-1
and AB-5; Bizily et al., 2000 ) and the merA
parent line lacking merB were used as positive and negative
controls, respectively. AB-1 is the most resistant merA/merB
line that we have thus far isolated from a screen of 60 transformants
and AB-5 is a moderately resistant line (Bizily et al.,
2000 ). The plant lines indicated (Fig. 2A) were grown on
standard germination plates in the absence of PMA and with 1 and 5 µM PMA (Fig. 2, plates B-D, respectively).
Lines with the CW-merB and ER-merB constructs varied greatly in their resistance to PMA as we had found earlier for a
variety of independent merA/merB lines with cytoplasmically expressed MerB (Bizily et al., 2000 ). Lines with the
CW-targeted construct CW-1, -2, and -5 and lines with the ER-targeted
construct ER-1, -2, -3, and -5 appeared as resistant as the positive
controls, AB-1 and AB-5, when grown on 1 µM
PMA. At 5 µM PMA, CW-2, ER-1, and ER-2 showed
comparable growth to the most resistant positive control line, AB-1.
CW-5 and ER-3 grew similarly to AB-5, the moderately resistant positive
control that shows approximately one-third of the organic mercury
processing capacity of AB-1 (Bizily et al., 2000 ). The
most resistant MerB targeted plant lines, CW-2, ER-1, and ER-2, grew as
rapidly and appeared as healthy on 5 µM PMA as
on mercury-free control plates. AB-5, CW-5, and ER-3 appeared healthy,
although they grew at least 50% more slowly on 5 µM PMA. Other lines germinated on 5 µM PMA but were severely stunted, suffered
bleaching, and did not survive past 4 weeks. Root growth of the more
resistant ER and CW targeted lines was equivalent or superior to the
best cytoplasmically expressed MerB lines (Fig. 2, E and F).

View larger version (81K):
[in this window]
[in a new window]
|
Figure 2.
Resistance of Arabidopsis merB, CW-merB, and
ER-merB lines to organic mercury. Arabidopsis seeds were
germinated on 0.8% (w/v) agarose plates containing standard
one-half-strength Murashige and Skoog plant growth medium
(Bizily et al., 2000 ). The various plant lines discussed
in the text are distributed on the plates (B-D) as shown in A. The
plates were dosed with 0 µM PMA (B), 1 µM PMA (C), or 5 µM PMA
(D). Plants were grown for 16 d at 22°C with 16 h of light
per day. The slight growth of the merA negative control line
on 1 µM PMA results from the heavy seed density
used in this experiment. Plant lines "a" and "b" are unrelated
to these experiments. E and F, Root growth of WT, AB-1, CW-2, and ER-3
lines on one-half-strength Murashige and Skoog medium without (E) and
with (F) 2 µM PMA. Seeds were germinated on
plates and plants were grown vertically for 10 d.
|
|
Rates of PMA Conversion to Hg(0)
The organic mercury conversion rate was determined for each
independently derived plant line by measuring gaseous Hg(0), the final product of the coupled MerA- and MerB-catalyzed reactions. Groups of 10 seedlings from each line were immersed in medium with PMA.
Hg(0) emissions were sampled at 0, 5, and 10 min and used to calculate
a PMA-to-Hg(0) conversion rate for each
sample, as shown in Figure 3 and summarized in Table
II. AB-1 and ER-2 transformed PMA
substrate to Hg(0) product at a rate of 800 ng Hg(0)
min 1 g 1 fresh weight
tissue and consistently showed the highest levels of coupled enzyme
activity. CW-2 produced Hg(0) at approximately 50% of this rate,
although this was more rapid than any of the remaining lines examined,
including AB-5. AB-5, CW-5, ER-1, and ER-3 had conversion rates close
to 200 ng Hg(0) min 1 g 1
fresh weight tissue. Conversion rates approximately reflected levels of
PMA resistance with one exception: ER-1 consistently showed a
resistance phenotype comparable with lines that had 2 to 4 times higher
volatilization rates.

View larger version (17K):
[in this window]
[in a new window]
|
Figure 3.
Organic mercury to Hg(0) conversion by selected
Arabidopsis merB, CW-merB, and ER-merB lines. PMA to Hg(0) conversion
(Reactions 1 and 2) rates were measured for each transgenic line. The
enzyme activity [nanograms of Hg(0) per minute per gram plant tissue
[fresh weight]) for each line is reported as the average of three
separate assays with 10 seedlings each and the SE among
these three assays.
|
|
View this table:
[in this window]
[in a new window]
|
Table II.
Relative Hg(0) volatilizing activity of plants
expressing wild-type or modified MerB proteins
See Figure 3 for mercury volatilization rate and units and Figure 4 for
relative protein levels. The relative specific activities were obtained
by dividing the volatilization rate by the relative protein level.
|
|
Thirty 2-week-old Arabidopsis plants from each line were assayed by
western blot for MerB protein levels in crude protein extracts, as
shown in Figure 4 and summarized in Table
II. Relative to the modified merB lines, 10 times less crude protein
was loaded for WT merB lines (AB-1 and AB-5) because pilot
experiments showed that WT MerB was expressed at much higher levels.
PEP-carboxylase levels were also measured on these same western blots
as an indicator of total protein loading and transfer to the membrane
(Bizily et al., 2000 ). The 10-fold reduction in protein
loading for the AB-1 and AB-5 lines is confirmed in the PEP carboxylase
assays (top of each set of assays, Fig. 4, A and B). MerB and the
modified forms of the protein ran as a single band at 32 kD in plants. AB-1 expressed 300% to 500% higher levels of MerB as compared with
AB-5. CW-2 contained approximately 14% as much MerB as AB-5. ER-2,
ER-3, and ER-1 contained 13%, 3%, and 1%, respectively, of the
amount of MerB in AB-5. CW-1, -3, -4, and -5, and ER-4 and -5 did not
produce detectable levels of MerB in three repetitions of this
experiment. MerB was undetectable in CW-5 despite having volatilization
and resistance phenotypes similar to ER-3. ER-1 had a very low level of
MerB compared with CW-2 and ER-2, reflecting ER-1's lower
volatilization rate; however, the disproportionately high level of PMA
resistance for ER-1 is still enigmatic. Similar results were obtained
in several repetitions of these assays.

View larger version (70K):
[in this window]
[in a new window]
|
Figure 4.
Western-blot analysis of MerB, CW-MerB, and
ER-MerB expression levels in transgenic Arabidopsis lines. For each
line, 30 2-week-old seedlings were removed from mercury-free growth
medium and ground in liquid nitrogen. Crude cell protein extracts were
resolved on 12.5% (w/v) PAGE (Bizily et al.,
2000 ). Western blots were probed with the pAb-MerB and an
anti-phosphoenolpyruvate (PEP)-carboxylase
polyclonal antisera. Crude protein loading was reduced 10-fold for
lines AB-1 and AB-5. CW-MerB and ER-MerB bands were quantified and
normalized relative to the MerB level in the line AB-5.
|
|
In summary, the CW- and ER-targeted, merB-expressing lines
were highly resistant to PMA and volatilized large amounts of Hg(0), and yet they expressed very low levels of MerB protein relative to
lines expressing WT MerB with similar levels of resistance. Using the
coupled conversion of PMA to Hg(0) as a measure of MerB activity
(Bizily et al., 2000 ) and western blots to assay
relative MerB protein levels, the relative specific activities of MerB in the various plant line were estimated, as shown in Table II. Our
analysis of the one CW-targeted and three ER-targeted lines, where MerB
levels could be quantified, indicated that these plants had much higher
specific activities for MerB than plants with cytoplasmic MerB.
Specific activities ranged from 12-fold (CW-2) to 67-fold (ER-1) higher
than AB-5. AB-5 and AB-1 had nearly identical specific activities as
expected. The ER-targeted lines ER-1 and ER-2 and one of the
CW-targeted lines, CW-2, had resistance levels equivalent to the best
WT merA/merB line, AB-1. One of these lines, ER-2,
volatilized an equal amount of Hg(0) as AB-1. ER-1 and CW-2 volatilized
Hg(0) at approximately 25% and 50% the rate of AB-1. Remarkably,
ER-1, ER-2, and CW-2 all had less than 5% of the MerB protein
expressed in AB-1. Furthermore, lines such as ER-5, CW-1, and CW-5
showed significant PMA resistance (Fig. 2C) despite having undetectable
levels of MerB (Fig. 4).
Subcellular Localization of MerB and ER-MerB
Leaf cells from Arabidopsis seedlings containing merA
alone, and the highly resistant AB-1, CW-2, and ER-2 lines, were fixed and reacted with pAb-MerB primary antibodies and Texas red-conjugated goat-anti-rabbit secondary antibodies (Molecular Probes, Inc., Eugene,
OR). Visualization of the labeled cells from the merB line,
AB-1, with the confocal microscope show strong expression of MerB in
the cytoplasm (Fig. 5A). The large oval
opaque regions without MerB label represent chloroplasts, which are
abundant in leaf cells. Under equivalent laser light settings, cells
from the negative control (merA) line showed no apparent
fluorescence signal or exhibited a very weak autofluorescence (Fig.
5B). Cells from line ER-2 expressed relatively low levels of ER-MerB
relative to AB-1 showed strong staining (Fig. 5, C and D), but in a
pattern that was entirely different from that observed for AB-1. The
signal is restricted to large vesicular structures that are consistent in shape and size with components of the ER and Golgi network. Confirmation of their subcellular location would require observation by
electron microscopy. Most of the ER-2 cells examined showed this
pattern of MerB localization (not shown). We were unable to observe any
consistent strong signal in several attempts to localize CW-MerB in the
line CW-2 (data not shown), consistent with the low protein levels
detected by western. There was no specific localization of CW-MerB in
the CW, and very little MerB detected anywhere in these cells despite
repeated attempts to detect this protein. This is likely due to the
fact that the CW was partially digested with cellulase and pectinase
during preparation of single cells for immunolabeling and any protein
contained on the cell surface could be lost in this step. It is also
possible that CW-MerB was secreted through the CW and lost before
fixation. In any case, for the CW-MerB protein to produce the strong
PMA resistance and transformation phenotypes observed it must have been
functioning as it moved through the secretory pathway.

View larger version (103K):
[in this window]
[in a new window]
|
Figure 5.
Immunofluorescence localization of MerB and
ER-MerB in fixed Arabidopsis leaf cells. A, MerB WT line. B, MerA line
with no MerB (negative control). C and D, ER-MerB line. The confocal
images shown are reconstructed from stacks of 0.5-micron photographs.
Under equivalent laser parameters, MerB (A) and ER-MerB (C and D)
showed different patterns of localization. The dimension of each cell
is approximately 25 × 40 µm.
|
|
 |
DISCUSSION |
It may be beneficial to target some enzymes to specific
subcellular microenvironments when engineering metabolic pathways (Burbulis and Winkel-Shirley, 1999 ; Facchini,
2001 ). Clearly, localizing organomercury lyase activity to the
ER, and possibly through it in the case of CW-MerB, allowed more
efficient detoxification of organic mercury than cytoplasmic expression
of the MerB enzyme. Perhaps localization to nucleus, mitochondria,
chloroplasts, and peroxisomes also will have beneficial effects on
organic mercury processing and resistance.
There are a few possible interpretations of our results demonstrating
more efficient organic mercury processing when MerB proteins are
targeted. First, we had previously demonstrated that the metabolic flow
(Kacser and Porteous, 1987 ) through the coupled mercury
transformation pathway (Reactions 1 and 2) is most limited by flux
through organomercury lyase (Bizily et al., 2000 ), but that increasing flux required disproportionately large increases in
cytoplasmic MerB concentrations. Herein, we have demonstrated that
movement of MerB into or through the membrane-rich ER and secretory
pathways improves enzyme-substrate reaction kinetics, perhaps because
these cellular compartments have higher substrate concentrations.
Increased substrate concentrations would certainly improve MerB
activity because it appears to have a low substrate or high product
affinity. The in vitro Km values of MerB
are in the range of 0.5 mM for most substrates
(Begley et al., 1986 ), whereas environmental and
laboratory organic mercury concentrations are generally in the low
micromolar range. Rapid movement of even small amounts of CW-MerB
through the secretory pathway may be sufficient to transform toxic
organic mercury and flush it out of this system. Second, these
subcellular compartments may provide a chemical environment that favors
a higher substrate-to-product turnover rate for MerB. For example, the
high thiol content of the ER system or particular thiol compounds like
glutathione might favor more efficient removal of Hg(II) from the
MerB-Hg(II) enzyme product complex during the reaction (Begley
et al., 1986 ; Pitts and Summers, 2002 ). Third,
it appears that with ER- and CW-targeted enzymes we have changed the
problem of flux through organomercury lyase from one of substrate
limitation to one with greater direct dependence on enzyme
concentration. This is a highly positive outcome because it is quite
feasible to isolate more active plants or to further engineer MerB for
increased expression in the secretory system. Indirect evidence for
this is the fact that 60 transgenic plants were screened to find the
line AB-1 (Bizily et al., 2000 ), whereas only five lines
of each of the targeted lines were screened herein to find plants with
equal organic mercury processing activities. Finally, the fact that
both the CW and ER forms of the enzyme produce similarly efficient
resistance to and processing of organic mercury suggests organic
mercury is most toxic early in the ER and secretory pathways.
 |
CONCLUSION |
This research on increasing the efficiency of MerB catalysis is
motivated by our interest in creating an optimal tool for detoxifying
methylmercury and remediating mercury contaminated marshlands and other
aquatic ecosystems, where methylmercury is most abundant and
biomagnified. We have demonstrated that targeting MerB protein to the
secretory pathway increased the efficiency of processing toxic organic
mercury by more than an order of magnitude. In addition, targeting
greatly reduced the total number of transformed plants that were
screened to achieve the same high levels of toxic substrate processing
relative to plants expressing untargeted cytoplasmic MerB. A recent
publication suggests that native trees along riverbanks transmit from
mercury-contaminated sediments dangerous levels of methylmercury
through their fallen leaves into the adjacent aquatic environments
(Balogh et al., 2002 ). Wetland trees expressing enzymes
that efficiently degraded methylmercury to Hg(II) or Hg(0) could be a
solution to this problem. Future efforts will apply the enhanced
effects of MerB protein targeting to environmentally relevant species
such as cottonwood (Populus deltoides), willow
(Salix nigra), and aquatic plants that could eliminate
sources of methylmercury before they enter the food chain.
 |
MATERIALS AND METHODS |
Modification of merB and Cloning for Expression
A 21-amino acid plant signal sequence (Met Gly Lys Met Ala Ser
Leu Phe Ala Thr Phe Leu Val Val Leu Val Ser Leu Ser Leu Ala) derived
from the Nicotiana plumbaginifolia ext
(extensin) gene (De Loose et al., 1991 ) efficiently
directs extensin to the ER and through to the CW. These 21 codons were
added de novo to the 5' end of merB using two rounds of
nested PCR with primers positioned as diagrammed in Figure 1A. Two
sense (S) primers, ext-1S (5'AGTGTCACTTAGCTTAGCTATGAAGCTCGC CCCATATATTTTAGAACTTCTCACTTCGGTCAATCGT) and ext-2S
(5'ACGGTCGGATCCTAAGGAGGAGAAACCATGGGAAAAATGGCTTCTCTATTTGC CACATTTTTAGTGGTTTTAGTGTCACTTAGCTTAGCT), encoded the N-terminal signal sequence and an in-frame stop codon, a Shine-Delgarno sequence for bacterial expression, and sequence of six nucleotides typical of
plant translation signals in front of the initiation codon. Ext-1S also
contains 18 nucleotides at its 3' end homologous to the
merB N-terminal sequence. The ext-2S primer contains
restriction sites and its 3' end overlaps the 5' end of ext-1S by 18 nucleotides for the second round of PCR. Two antisense (A) primers, 1A
(5'AGTATCCTCGAGGAATTCAAGCTTAT CAGATATCCGGTGTCCTAGATGACATGGTCTGCAACAGATGTCGATTAAACT) and 2A
(5'AGTATCCTCGAGGAATTCAAGCTTATCAGATATCTAGCTCATCTTTCTCAGACG GTGTCCTAGATGACATGGTCTGCAACAGATGTCGATTAAACT), add the 3' end
sequences to CW-merB and ER-merB,
respectively. Both were designed to overlap the 3' end of
merB by 18 nucleotides and contained suitable
restriction sites for cloning. Primer 2A also contains added codons for
the ER retention sequence, (SE)KDEL, immediately in front of the stop codon.
After two rounds of nested PCR, the appropriately sized fragments for
each modified merB gene were gel purified, digested with
BamHI and XhoI, and ligated into digested
pBluescript SKII+ plasmids. The
BamHI/XhoI fragment from the WT
merB gene was similarly subcloned (Bizily et al.,
1999 ). These plasmids, named pBS-CW-merB and
pBS-ER-merB, were transformed into Top10F' competent
Escherichia coli (Invitrogen, Inc., Carlsbad, CA) by
electroporation and their sequences were confirmed. Plasmids containing
WT and modified merB gene sequences for plant
expression, pBS-35S/CW-merB/NOS and
pBS-35S/ER-merB/NOS, were prepared by subcloning the
same BamHI/XhoI fragments into the
multilinker replacement region of pBS-VST1. To make pBS-VST1, the 35S
cauliflower mosaic virus promoter and NOS 3' terminator from the
plant binary vector pVST1 (Malik and Wahab, 1993 ) were
subcloned into the SacI-KpnI replacement region of Bluescript SKII+. The entire promoter, modified
merB coding sequence, and terminator fragments were then
subcloned into the corresponding regions of pCAMBIA
(Hajdukiewicz et al., 1994 ) vector by digesting at an SacI site upstream of the promoter and a
KpnI site downstream of the NOS terminator.
pCAMBIA-35S/CW-merB/NOS and
pCAMBIA-35S/ER-merB/NOS were used for
Agrobacterium tumefaciens-based plant transformations. The pCAMBIA vector confers kanamycin resistance and hygromycin resistance for bacterial and plant selections, respectively.
Assays of Bacterially Expressed MerB
Bacterial strains were tested for resistance to PMA using a disc
assay described previously (Bizily et al., 1999 ). Each
paper disc contained 2 µL of 100 mM PMA and the diameter
of the zone of clearing was measured from the plate after 16 h of
incubation at 37°C. Plasmid pDU202 encodes the narrow spectrum
mer operon with several genes for drug and mercury
resistance (MerA). E. coli strain pDU202/SK1592
(Foster, 1983 ; Hamlett et al., 1992 ; no.
890), which is resistant to inorganic mercury but lacks MerB, was
transformed with pBS-CW-merB and
pBS-ER-merB. The zone of clearance (average diameter)
and SEs presented were calculated from at least six
repetitions. Repetitions within experiments on a single strain varied
by no more than 0.5 mm. Bacterial protein was isolated from these
strains, as well as from positive (pBS-merB) and
negative (pBSKSII) control strains, in the form of crude extract by
sonication (Bizily et al., 1999 ) and mixed immediately
with 2× sample buffer (4% [w/v] SDS, 125 mM
Tris-HCl [pH 6.7], 30% [v/v] glycerol, 2% [v/v]
-mercaptoethanol, and 0.002% [w/v] bromphenol blue;
O'Farrell et al., 1977 ). Clarified protein extracts
were resolved by 12.5% (w/v) PAGE and blotted. Protein loading
was equalized based on Coomassie blue staining of pilot gels and
confirmed by running samples in parallel along with those blotted for
this experiment. PNPase levels were used as an independent assessment of the efficiency of equivalent loading (not shown). Mouse monoclonal antibodies mAb2H8 and mAb10E2 were used at 1 µg mL 1
concentrations, whereas rabbit polyclonal serum pAb-MerB was used at a
1:500 (v/v) dilution (Bizily et al., 2000 ).
Primary reactions were carried out for 1 h after which the blots
were washed 3 × 10 min. Secondary reactions with horseradish
peroxidase-linked anti-mouse or anti-rabbit antibodies (Amersham
Pharmacia Biotech, Piscataway, NJ) were performed at 1:2,000
(v/v) dilutions for 1 h. Blots were washed 3 × 10 min
before development using a horseradish peroxidase luminol-based kit
(Amersham Pharmacia Biotech). The blots were checked for equal loading
by staining them directly with Coomassie blue after exposing them to
film. Quantification of MerB bands on western blots was performed by
scanning the exposed film in a densitometer loaded with the ImageQuant
Software (Molecular Dynamics, Sunnyvale, CA).
MerB kinetics assays were performed using an assay solution containing
50 mM Tris-HCl (pH 7.5), 100 µM PCMB, and 1 mM L-Cys based on a modification of MerB assays
described previously (Boyer, 1954 ; Begley et al.,
1986 ). PCMB has an absorbance peak at 250 nm that shifts when
MerB cleaves it into mercury and chlorobenzoate. Enzymatic rates were
measured as A250 absorbance with time.
Protein extracts were prepared from 250 mL of Top 10F' E.
coli cultures grown in Luria broth medium for 2 h
to an optical density of approximately 0.3 at
A560, induced with 1 mM
isopropylthio- -galactoside, and grown for an additional
4 h. Cultures were spun down at 5,000 rpm for 15 min, washed with
protein extraction buffer (50 mM Tris-HCl [pH
7.5], 1 mM -mercaptoethanol, 1 mM
phenylmethylsulfonyl fluoride, 0.5 M EDTA, and 5%
[v/v] glycerol), and spun down again. Final cell pellets were
resuspended in 2 mL of protein extraction buffer, sonicated for 15 s, and spun down at 15,000 rpm for 10 min. Twenty microliters of crude
protein supernatant was added to and mixed with 1 mL of assay solution
in a quartz cuvette to initiate an assay.
A250 readings were taken at 1-min intervals
over 20 min and compared against a blank containing 1 mL of assay
solution. Four independent assays were averaged for each value
presented in Table I.
Analysis of Transgenic Plants
MerA Arabidopsis RLD plants (line A9-1A) already
expressing mercuric ion reductase (Rugh et al., 1996 )
were grown up and transformed using vacuum infiltration to deliver
A. tumefaciens carrying the various gene constructs
(Bariola et al., 1999 ). T1 progeny were selected from the seed population for hygromycin resistance and allowed
to self fertilize. T2 plants were used for all experiments described in this paper.
Organic mercury (PMA) resistance assays on seedlings and plants were
described previously (Bizily et al., 2000 ). Protein
extracts and western blots were prepared as described previously for
MerB (Bizily et al., 2000 ) or with a direct SDS protein
extraction procedure (McLean et al., 1990 ). Equal
amounts of protein for all CW-merB and
ER-merB lines and merA negative control
plant lines were resolved on SDS-PAGE, transferred to membranes, and reacted with antibodies. Measurements of PMA to Hg(0) conversion rates
were done as previously described with the exception that samples
consisted of 10 2-week-old seedlings rather than individual plants
(Bizily et al., 2000 ).
Immunocytochemistry
Seedlings from the AB-1, CW-2, and ER-2 lines were grown for 2 to 3 weeks on agar plates and prepared by rapid freeze fixation and
freeze substitution for immunofluorescence microscopy as described previously (Kandasamy et al., 1999 ). The dissociated
cells were labeled with pAb-MerB primary antibody at 1:100 (v/v)
dilution for 16 h. Cells were washed 3 × 15 min in
phosphate-buffered saline (PBS) and labeled with Texas
red-conjugated goat anti-rabbit Ig secondary antibody (Amersham Life
Science, Cleveland) at 1:100 (v/v) dilution for 3 h. After
washing again in PBS (3 × 15 min) the samples were mounted in
90% (v/v) glycerol in PBS containing 0.1% (w/v)
para-phenylenediamene and visualized with an MCR-600 confocal
microscope (Bio-Rad, Hercules, CA).
 |
ACKNOWLEDGMENTS |
We thank Gay Gragson, Russel Malmberg, Anne Summers, Mark
Farmer, and Michael Bender, for reviewing this work. Anne Summers and
Sidney Kushner generously supplied the pAb-MerB and PNPase antibodies, respectively.
 |
FOOTNOTES |
Received June 14, 2002; returned for revision July 18, 2002; accepted October 17, 2002.
1
This work was supported by the Department of
Energy (Environmental Management Sciences grant no. DEG0796ER20257 to
R.B.M.) and by the National Institutes of Health (Graduate Student
Training Grant no. 2T32-GM07103 to S.P.B.).
*
Corresponding author; e-mail meagher{at}arches.uga.edu; fax
706-542-1387.
Article, publication date, and citation information can be found at
www.plantphysiol.org/cgi/doi/10.1104/pp.010124.
2Where R-CH2 can be
hydrophobic organic modifiers of mercury like methyl, phenyl, propyl,
or phenyl groups (Begley et al., 1986 ).
 |
LITERATURE CITED |
-
Balogh SJ, Huang Y, Offerman HJ, Meyer ML, Johnson DK
(2002)
Episodes of elevated methylmercury concentrations in prairie streams.
Environ Sci Technol
36: 1665-1670[Medline]
-
Bariola PA, MacIntosh GC, Green PJ
(1999)
Regulation of S-like ribonuclease levels in Arabidopsis. Antisense inhibition of RNS1 or RNS2 elevates anthocyanin accumulation.
Plant Physiol
119: 331-342[Abstract/Free Full Text]
-
Begley TP, Walts AE, Walsh CT
(1986)
Mechanistic studies of a protonolytic organomercurial cleaving enzyme: bacterial organomercurial lyase.
Biochemistry
25: 7192-7200[Medline]
-
Bizily S, Rugh CL, Meagher RB
(2000)
Phytodetoxification of hazardous organomercurials by genetically engineered plants.
Nat Biotechnol
18: 213-217[CrossRef][ISI][Medline]
-
Bizily S, Rugh CL, Summers AO, Meagher RB
(1999)
Phytoremediation of methylmercury pollution: merB expression in Arabidopsis thaliana confers resistance to organomercurials.
Proc Natl Acad Sci USA
96: 6808-6813[Abstract/Free Full Text]
-
Boyer PD
(1954)
Spectrophotometric study of the reaction of protein sulfhydryl groups with organic mercurials.
J Am Chem Soc
76: 4331-4337[CrossRef]
-
Burbulis IE, Winkel-Shirley B
(1999)
Interactions among enzymes of the Arabidopsis flavonoid biosynthetic pathway.
Proc Natl Acad Sci USA
96: 12929-12934[Abstract/Free Full Text]
-
Dare E, Li W, Zhivotovsky B, Yuan X, Ceccatelli S
(2001)
Methylmercury and H(2)O(2) provoke lysosomal damage in human astrocytoma D384 cells followed by apoptosis.
Free Radic Biol Med
30: 1347-1356[CrossRef][ISI][Medline]
-
De Loose M, Gheysen G, Tire C, Gielen J, Villarroel R, Genetello C, Van Montagu M, Depicker A, Inzé D
(1991)
The extensin signal peptide allows secretion of a heterologous protein from protoplasts.
Gene
99: 95-100[CrossRef][ISI][Medline]
-
Doty SL, Shang TQ, Wilson AM, Tangen J, Westergreen AD, Newman LA, Strand SE, Gordon MP
(2000)
Enhanced metabolism of halogenated hydrocarbons in transgenic plants containing mammalian cytochrome P450 2E1.
Proc Natl Acad Sci USA
97: 6287-6291[Abstract/Free Full Text]
-
Eto K, Yasutake A, Miyamoto K, Tokunaga H, Otsuka Y
(1997)
Chronic effects of methylmercury in rats: II. Pathological aspects.
Tohoku J Exp Med
182: 197-205[Medline]
-
Facchini PJ
(2001)
Alkaloid biosynthesis in plants: biochemistry, cell biology, molecular regulation, and metabolic engineering applications.
Annu Rev Plant Physiol Plant Mol Biol
52: 29-66[CrossRef][ISI][Medline]
-
Foster TJ
(1983)
Plasmid-determined resistance to anti-microbial drugs and toxic metal ions in bacteria.
Microbiol Rev
47: 361-409[Free Full Text]
-
Hajdukiewicz P, Svab Z, Maliga P
(1994)
The small, versatile pPZP family of Agrobacterium binary vectors for plant transformation.
Plant Mol Biol
25: 989-994[CrossRef][ISI][Medline]
-
Hamlett NV, Landale EC, Davis BH, Summers AO
(1992)
Roles of the Tn21 merT, merP, and merC gene products in mercury resistance and mercury binding.
J Bacteriol
174: 6377-6385[Abstract/Free Full Text]
-
Hannink N, Rosser SJ, French CE, Basran A, Murray JA, Nicklin S, Bruce NC
(2001)
Phytodetoxification of TNT by transgenic plants expressing a bacterial nitroreductase.
Nat Biotechnol
19: 1168-1172[CrossRef][ISI][Medline]
-
Kacser H, Porteous JW
(1987)
Control of metabolism: What do we have to measure?
Trends Biol Sci
12: 5-14
-
Kandasamy MK, McKinney E, Meagher RB
(1999)
The late pollen specific actins in angiosperms.
Plant J
18: 681-691[CrossRef][ISI][Medline]
-
Malik VS, Wahab SZ
(1993)
Versatile vectors for expressing genes in plants.
J Plant Biochem Biotechnol
2: 69-70
-
McLean BG, Huang S, McKinney EC, Meagher RB
(1990)
Plants contain highly divergent actin isovariants.
Cell Motil Cytoskelet
17: 276-290[Medline]
-
Meagher RB
(2000)
Phytoremediation of toxic elemental and organic pollutants.
Curr Opin Plant Biol
3: 153-162[CrossRef][ISI][Medline]
-
Meagher RB, Rugh CL, Kandasamy MK, Gragson G, Wang NJ
(2000)
Engineered phytoremediation of mercury pollution in soil and water using bacterial genes.
In
N Terry, G Banuelos, eds, Phytoremediation of Contaminated Soil and Water. Lewis Publishers, Boca Raton, FL, pp 203-221
-
Monier S, Van Luc P, Kreibich G, Sabatini DD, Adesnik M
(1988)
Signals for the incorporation and orientation of cytochrome P450 in the endoplasmic reticulum membrane.
J Cell Biol
107: 457-470[Abstract/Free Full Text]
-
O'Farrell PZ, Goodman HM, O'Farrell PH
(1977)
High resolution two-dimensional electrophoresis of basic as well as acidic proteins.
Cell
12: 1133-1142[CrossRef][ISI][Medline]
-
Persans MW, Nieman K, Salt DE
(2001)
Functional activity and role of cation-efflux family members in Ni hyperaccumulation in Thlaspi goesingense.
Proc Natl Acad Sci USA
98: 9995-10000[Abstract/Free Full Text]
-
Pitts KE, Summers AO (2002) The roles of thiols in the
bacterial organomercurial lyase (MerB). Biochemistry (in press)
-
Rugh CL, Senecoff JF, Meagher RB, Merkle SA
(1998)
Development of transgenic yellow poplar for mercury phytoremediation.
Nat Biotechnol
16: 925-928[CrossRef][ISI][Medline]
-
Rugh CL, Wilde D, Stack NM, Thompson DM, Summers AO, Meagher RB
(1996)
Mercuric ion reduction and resistance in transgenic Arabidopsis thaliana plants expressing a modified bacterial merA gene.
Proc Natl Acad Sci USA
93: 3182-3187[Abstract/Free Full Text]
-
Szczesna-Skorupa E, Kemper B
(2000)
Endoplasmic reticulum retention determinants in the transmembrane and linker domains of cytochrome P450 2C1.
J Biol Chem
275: 19409-19415[Abstract/Free Full Text]
© 2003 American Society of Plant Biologists
This article has been cited by other articles:

|
 |

|
 |
 
Y. Li, O. P. Dankher, L. Carreira, A. P. Smith, and R. B. Meagher
The Shoot-Specific Expression of {gamma}-Glutamylcysteine Synthetase Directs the Long-Distance Transport of Thiol-Peptides to Roots Conferring Tolerance to Mercury and Arsenic
Plant Physiology,
May 1, 2006;
141(1):
288 - 298.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-M. Gong, D. A. Lee, and J. I. Schroeder
Long-distance root-to-shoot transport of phytochelatins and cadmium in Arabidopsis
PNAS,
August 19, 2003;
100(17):
10118 - 10123.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|