Department of Biochemistry, University of Cambridge,
Building O, Downing Site, Cambridge CB2 1QW, United Kingdom (F.G.,
A.M., Z.Z., P.D.); and Department of Biology, University of Leicester,
University Road, Leicester LE1 7RH, United Kingdom (S.K.P.,
D.T.)
The cellulose synthase-like proteins are a large
family of proteins in plants thought to be processive polysaccharide
-glycosyltransferases. We have characterized an Arabidopsis mutant
with a transposon insertion in the gene encoding AtCSLA7 of the CSLA
subfamily. Analysis of the transmission efficiency of the insertion
indicated that AtCSLA7 is important for pollen tube growth. Moreover,
the homozygous insertion was embryo lethal. A detailed analysis of seed
developmental progression revealed that mutant embryos developed more
slowly than wild-type siblings. The mutant embryos also showed abnormal
cell patterning and they arrested at a globular stage. The defective
embryonic development was associated with reduced proliferation and
failed cellularization of the endosperm. AtCSLA7 is
widely expressed, and is likely to be required for synthesis of a cell
wall polysaccharide found throughout the plant. Our results suggest
that this polysaccharide is essential for cell wall structure or for
signaling during plant embryo development.
 |
INTRODUCTION |
Plant cell walls are composed mainly
of the matrix pectic and hemicellulosic polysaccharides and cellulose
(Brett and Waldron, 1996
; Fry, 2000
). The
matrix polysaccharides are diverse and complex in structure, with
-
or
-linked sugars in long backbones often decorated with short side
chains. Xyloglucan, which has a
-1,4-glucan backbone, is the most
abundant hemicellulose found in the primary cell wall of dicotyledonous
plants, and is thought to cross-link cellulose microfibrils.
Hemicellulosic polysaccharides with backbones of
-1,3-glucan
(callose),
-1,4-mannan, or
-1,4-xylan are also abundant in
certain cell types (Brett and Waldron, 1996
; Fry, 2000
). Classical arabinogalactan proteins (AGPs), consisting of up to 90% polysaccharide, are often also considered hemicellulosic polysaccharides (Fry, 2000
). The arabinogalactan chains
on AGPs consist of
-1,3-galactan with
-1,6-galactan branches that
are further decorated, mostly with Ara (Fry, 2000
;
Majewska-Sawka and Nothnagel, 2000
). These
arabinogalactan chains can probably be found on a wide variety of cell
wall proteins (Borner et al., 2002
). In contrast to
these polysaccharides with
-linked sugars in the backbones, the main
backbone of pectin is
-1,4-polygalacturonan or, in
rhamnogalacturonan I (RG-I), alternating
-1,4-rhamnosyl and
-1,2-galacturonosyl residues. The backbone of RG-I is modified by the addition of side chains of
-1,5-arabinan and
-1,4-galactan. Other polysaccharides such as mixed linkage
-glucans are found in certain species or tissues (Fry,
2000
). Therefore, cell walls contain a rich array of different
polymers, but the role and the extent of functional
redundancy between these different polysaccharides are unknown.
For many years, researchers have attempted to purify transferases
involved in the synthesis of cell wall polysaccharides to isolate the
corresponding gene. However, just two have been successfully purified
because of difficulties both in retaining activity after solubilization
and assaying the transferases has limited the success of this approach.
A galactomannan galactosyltransferase was purified from developing
fenugreek (Trigonella foenum-graecum) cotyledons (Edwards et al., 1999
) and a xyloglucan fucosyl
transferase was purified from pea (Pisum sativum)
seedlings (Perrin et al., 1999
). These two transferases
are predicted to have a single transmembrane domain with the
transferase activity within the lumen of the Golgi apparatus.
In contrast, the plant cellulose synthase genes were first identified
based on the high homology of the gene family with cellulose synthases
(CELA) of bacteria (Pear et al., 1996
). Second, studies of Arabidopsis mutants have been invaluable in identifying and characterizing the cellulose synthase genes. Recently, callose synthase
of Arabidopsis (Hong et al., 2001
), tobacco
(Nicotiana talata; Doblin et al.,
2001
), and cotton (Gossypium hirsutum; Cui et al., 2001
) have also been identified
by a sequence homology-based approach. Both the cellulose and callose
synthases are plasma membrane proteins with multiple
membrane-spanning domains. Although there are 12 cellulose
synthase (CESA) genes in Arabidopsis (Richmond and
Somerville, 2000
; Saxena and Brown, 2000
),
characterization of the various Arabidopsis mutants has indicated that
the genes are not redundant (Williamson et al., 2001
).
This could be because they form hetero-oligomeric complexes
(Taylor et al., 2000
), and because the genes are
expressed at different growth and development stages.
The cellulose synthases are part of a large family of inverting
processive
-glycosyltransferases. The family includes mammalian hyaluronan synthases and fungal chitin synthases, and belongs to the
glycosyltransferase superfamily GT2 (Henrissat and Davies, 2000
). In silico analysis suggests that a large number of
relatively uncharacterized genes in plants, called the CELLULOSE
SYNTHASE-LIKE (CSL) genes (Richmond and Somerville,
2000
; Saxena and Brown, 2000
; Hazen et
al., 2002
) encode glycosyltransferases in this family. These
proteins have been divided into between six and eight different
subfamilies (depending on the plant), and they show varying degrees of
sequence similarity to CESA proteins. It was initially speculated that
each subfamily might be involved in synthesizing the backbones of the
abundant polysaccharides, namely callose,
-1,4-polygalacturonan,
RG-I, RG-II, xyloglucan, and xylan (Richmond and Somerville,
2000
). However, the recently identified callose synthase is not
a member of the CSL family (Doblin et al., 2001
;
Hong et al., 2001
). Furthermore, the pectin backbones
contain
-linkages, which are unlikely to be synthesized by a member
of the GT2 glycosyltransferase family. Thus, the CSL subfamilies might
synthesize the backbone of the remaining
-linked polysaccharides
such as
-1,4-galactan, xylan, mannan, xyloglucan, and the
-1,3-
and
-1,6-galactan of AGPs. In this hypothesis, type II transferases
would be used to synthesize the
-linked backbones of arabinan and
pectin and the short side chains on the
-linked polysaccharide backbones.
Studies of two genes in the CSLD subfamily, the subfamily
most similar to the CESA genes, have been published recently
(Favery et al., 2001
; Wang et al., 2001
).
Two Arabidopsis mutants (kojak and csld3) have
been produced by T-DNA or dissociation element (Ds) insertions into AtCSLD3. The mutants have
fewer root hairs than the wild type (WT). By genetic analysis, it
appears that the CSLD3 gene acts early in the process of root hair
outgrowth (Favery et al., 2001
; Wang et al.,
2001
). Although this protein is expressed in all parts of the
plant (Wang et al., 2001
), it is only in the root hair
that a phenotype has been observed in the mutant. In contrast,
NaCSLD1 of tobacco is only expressed in anther and in
vitro-grown pollen tubes, and it has been predicted that this might be
a cellulose synthase in pollen (Doblin et al., 2001
).
In the work described here, we identified a mutation in
AtCSLA7 of the CSLA subfamily of putative processive
-glycosyltransferases. The gene is ubiquitously expressed, and is
important for pollen tube growth and essential for embryogenesis,
suggesting a requirement for a specific
-linked polysaccharide in
plant development.
 |
RESULTS |
Isolation of AtCSLA7 cDNA
As part of an ongoing program to screen for Arabidopsis insertion
mutants in genes encoding polysaccharide synthases, we selected SGT4425
in the collection of Ds transposon insertion mutants with flanking sequences generated by Parinov et al. (1999)
.
The sequence flanking the insertion in this line indicated that a Ds
element had inserted in a gene encoding a putative glycosyltransferase. Before further analysis of this insertion mutant line, we confirmed by
reverse transcriptase (RT)-PCR on RNA isolated from WT Arabidopsis callus that this gene was expressed. Preliminary sequence alignments suggested that the annotation of the gene AAD15455.1 by The Institute for Genomic Research was not correct because nucleotide sequence upstream of the proposed initiator Met appeared to encode amino acid
sequence conserved in homologous genes. Using Netplantgene2 (Brunak et al., 1991
; Hebsgaard et al.,
1996
), we identified a potential upstream exon, and confirmed
the existence of this exon by amplification of a longer cDNA by RT-PCR.
The cDNA amplified contains an in-frame upstream stop codon; therefore,
we are confident that this sequence is full length. The intron/exon
structure of the gene is shown in Figure
1A. The protein contains 556 amino acids
(Fig. 1B), and has a predicted molecular mass of 63,795 D and a
pI of 9.0. We predict that the protein has six transmembrane domains
(Fig. 1B) with N and C termini in the cytosol (Fig. 1C).

View larger version (34K):
[in this window]
[in a new window]
|
Figure 1.
Structure of the predicted AtCSLA7 gene
and AtCSLA7 protein. A, Position of introns, exons, and Ds
insertion in AtCSLA7. Rectangular boxes represent the exons
and the lines represent introns in the gene. Light-gray rectangles are
untranslated regions. Start and stop codons are indicated. The
dark-gray rectangle represents the Ds insertion. Numbers
refer to nucleotide position in the BAC T20F21.
B, AtCSLA7 protein. Underlined amino acids correspond to the
putative transmembrane domains of the protein. Shaded characters are
the amino acids conserved in most members of the CSLA family. Bold
characters are highly conserved amino acids in CSL, CELA, and CESA
families. Boxes represent the D,D,D,QXXRW motif characteristic of
-glycosyltransferases. C, Topology model of AtCSLA7.
|
|
Homology searches indicated that the encoded protein is a member
of the processive
-glycosyltransferase superfamily
(GT2) that includes plant and bacterial cellulose synthases
(Henrissat and Davies, 2000
). The CSL genes
of Arabidopsis have been grouped into six subfamilies by
Richmond and Somerville (2000)
. Using this nomenclature,
the cDNA isolated corresponds to the gene AtCSLA7 in the
CSLA subfamily containing 15 members in Arabidopsis. The "D,D,D,QXXRW" characteristic motifs of processive
-glycosyltransferases (Karnezis et al., 2000
;
Saxena and Brown, 2000
; Williamson et al.,
2001
) are also found in AtCSLA7 (Fig. 1B, boxed). By alignment with CESA and CSL subfamily proteins, we found many residues conserved in all members (Fig. 1B, bold), or conserved within the CSLA subfamily (Fig. 1B, shadowed). Therefore, AtCSLA7 contains all the
characteristics expected of a processive
-glycosyltransferase.
AtCSLA7 Expression
To investigate any organ-specific expression of
AtCSLA7, RT-PCR was used to amplify the cDNA from RNA
isolated from a range of plant tissues and organs. We found that the
gene was expressed in all tissues examined, including old and young
leaves, roots, callus, and pollen. Some examples are shown in Figure
2.

View larger version (23K):
[in this window]
[in a new window]
|
Figure 2.
The expression of AtCSLA7 in different
plant tissues: analysis by RT-PCR using internal primers 1 and 4. 1 through 12, PCR products from RT-PCR reaction (approximately 1.5 kb);
13, PCR product from genomic amplification (approximately 2 kb). 1, Four-day-old callus; 2, 7-d-old callus; 3, 7-d-old plantlets; 4, roots;
5, leaves of rosettes; 6, young stems before flowering; 7, whole old
stems including flowers, siliques, and leaves; 8, stems alone; 9, leaves of stem; 10, flowers; 11, pollen; 12, young siliques; 13, genomic DNA.
|
|
Identification of an Insertion Mutant
The transposon insertion line SGT4425 was analyzed for potential
insertion in AtCSLA7. The position of the Ds
insertion in exon 7 (Fig. 1A) was confirmed by direct PCR amplification
of both ends of the Ds element and associated flanking
genomic DNA. Analysis of over 300 plants from seven generations showed
that all kanamycin-resistant (kanr) plants
contained the insert at this site, showing tight linkage between
kanamycin resistance and this insertion. We also screened these plants
for any homozygous individuals that would not yield PCR amplification
of the gene with a pair of gene-specific primers. However,
all the kanr plants were heterozygous for the
insertion. This indicated that the AtCSLA7 gene is an
essential gene.
Transmission of the Insertion in AtCSLA7
If homozygous plants die, we would expect a segregation ratio of
2:1 kanr:kanamycin-sensitive
(kans) plants in the surviving progeny of plants
heterozygous for the Ds insertion. However, plants from four
generations consistently produced progeny that segregated approximately
1.3:1 kanr:kans seedlings
(Table I), indicating reduced
transmission of the Ds insertion. This analysis also
demonstrated tight linkage of the Ds insertion and the
reduced transmission phenotype. The reduced genetic transmission of
Ds in SGT4425 suggested a gametophytic role for
AtCSLA7.
View this table:
[in this window]
[in a new window]
|
Table I.
Segregation of kanr and kans
progeny of SGT4425 plants heterozygous for a Ds insertion in AtCSLA7
Pooled data for sibling plants are shown for four successive
generations (F1-F4).
|
|
Male and female transmission of Ds was determined by
performing reciprocal test crosses with WT Arabidopsis Landsberg
erecta (Ler) and analyzing progeny on kanamycin
selection plates. The data from five separate experiments are shown in
Table II. Male transmission was reduced
to 29% of WT. In contrast, the female transmission efficiency (TE) was
not affected. These data suggested an important gametophytic role for
AtCSLA7 in pollen development or function.
View this table:
[in this window]
[in a new window]
|
Table II.
Segregation of kanr and
kans seedlings in reciprocal test crosses of SGT4425
heterozygotes and WT (Ler) in five separate experiments
|
|
Embryo Lethality of Homozygous Ds Insertion in AtCSLA7
Given the reduced, but significant, male transmission of the
Ds insertion in SGT4425, homozygous progeny were predicted
to occur at a frequency of 11%. However, as described above, no
homozygous progeny were detected. Moreover, no evidence was obtained
for a seedling lethal phenotype, suggesting that homozygotes might be
embryo lethal. Examination of developing seed in mature green siliques
of hemizygous SGT4425 mutants revealed that all siliques contained a
proportion of aborted seeds (Fig. 3A).
The proportion of aborted seeds was found to be 14.7% (total no. of
seeds scored = 2,301) in plants from several different
generations. Siliques of WT Ler did not show aborted seeds
and none were observed when SGT4425 pollen was used to pollinate
Ler pistils. When SGT4425 was used as the female parent in a
cross to Ler, aborted seeds were observed infrequently
(approximately 2%, n = 393). These data indicated that
the homozygous Ds insertion in AtCSLA7 is a
recessive seed lethal mutation.

View larger version (151K):
[in this window]
[in a new window]
|
Figure 3.
Seed and embryo morphology in hemizygous SGT4425
plants. A, Dissected silique at cotyledonary stage showing WT (green)
and aborted (white) seeds. Aborted seeds (arrows) are unequally
distributed within the silique, biased toward the apical half. B and C,
Phenotype of a normal (B) and an aborted (C) seed from a cotyledonary
stage silique. The mutant embryo is arrested at globular stage and
peripheral free nuclear endosperm is still visible (arrowheads).
Bars = 50 µm in B and C.
|
|
Transformation of SGT24425 with a 4-kb genomic region including
AtCSLA7 allowed recovery of plants homozygous for the
Ds insertion in AtCSLA7. There was approximately
doubled male TE and one-half the proportion of aborted seeds in plants
hemizygous for the complementing DNA, indicating complementation of the
phenotypes by AtCSLA7 (not shown).
WT and aborted seeds from mature SGT4425 green siliques were examined
by differential interference contrast (DIC) microscopy. WT seeds
contained cotyledonary stage embryos (Fig. 3B), but all aborted seeds
(n = 76) contained small, undeveloped embryos with a
distinct suspensor that were arrested at globular stage, or were
elongated along the apical-basal axis (Fig. 3C). Mutant embryos were
globular or elongate structures showing no evidence of cotyledon development. Cell proliferation was severely reduced such that the
terminal phenotype of most mutant embryos was to arrest with 16 to 48 cells. Similarly, the endosperm remained uncellularized in aborted
seeds and peripheral free nuclear endosperm was clearly visible (Fig.
3C).
To investigate further the developmental progression, embryos from a
series of developing siliques of WT and hemizygous SGT4425 plants were
categorized into stages of development from four to 16 cells to
cotyledon. This revealed that embryo development was by and large
synchronous in WT siliques, with sibling embryos spanning two
successive stages (Fig. 4, A-D; Table
III). In contrast, SGT4425 siliques
contained embryos of a wider range of developmental stages. A
proportion (13%-23%) of embryos with delayed development (four-16-cell stage) was apparent when the majority of WT embryos (Fig. 4D) were at heart stage (Table III). This difference was already
apparent at globular stage with delayed embryos at the one- to 16-cell
stage.

View larger version (122K):
[in this window]
[in a new window]
|
Figure 4.
Embryo development in WT (A-D) and SGT4425 mutant
(E-H) embryos present within siliques of hemizygous SGT4425 plants at
different developmental stages. A and E, Sixteen-cell embryo proper
stage; B and F, mid-globular stage; C and G, late globular transition
stage; D and H, late heart stage of WT embryos. E, Abnormal eight-cell
embryo proper with altered axial and transverse divisions. F, Abnormal
early globular embryo. G and H, Abnormal embryos containing 28 to 46 cells showing abnormal transverse divisions and incomplete protoderm
formation. Bars = 10 µm in A through C and E through H. Bar = 20 µm in D.
|
|
View this table:
[in this window]
[in a new window]
|
Table III.
Embryo development in WT and SGT 4425
Embryo developmental stages correspond to the cell no. or morphology of
the embryo proper.
|
|
It was not possible to distinguish most WT and mutant embryos at one-
to eight-cell stages. However, some abnormal eight-cell embryos were
observed in which the axial and transverse division planes were rotated
by 45° (Fig. 4E). Delayed globular embryos also showed abnormal
division patterns that often involved an incomplete set of protoderm
divisions (Fig. 4F). In siliques containing WT embryos at the late
heart stage (Fig. 4D), mutant embryos were often elongated along the
apical basal axis (Fig. 4H). In most mutant embryos, the protoderm
layer was incomplete and aberrant cell division patterns were observed
in the basal region of the embryo (Fig. 4, E-H). A common phenotype
involved the formation of two additional cell tiers resulting from
additional transverse divisions (Fig. 4, G and H). Thus, SGT4425 mutant
embryos show delayed development and abnormal cell patterning. No
evidence was obtained for incomplete cell divisions. However, we cannot rule out subtle effects on cytokinesis not detectable with the DIC
microscopy procedure used.
We investigated whether the effects of insertion in AtCSLA7
were restricted to the embryo or were also seen in endosperm
development. The mean number of endosperm nuclear divisions was
determined in whole-mount seeds by DIC microscopy. Seeds containing
mutant embryos at approximately the 16-cell stage contained 60.9 nuclei per seed, which was comparable with 52.9 in WT seeds containing embryos
at the 16-cell stage (number of nuclei > 600). In terminally arrested seeds, endosperm nuclei showed a small increase to 76.4 nuclei
per seed, whereas nuclei in seeds containing WT globular embryos
continued to increase beyond 175 nuclei per seed, when the number of
nuclei could be reliably counted. Thus, endosperm proliferation is not
maintained in mutant SGT4425 seeds and is associated with failure of
the endosperm to cellularize. The nuclei present in the endosperm of
the arrested mutant seeds were relatively uniform and of comparable
size with those in WT seeds at the coenocytic endosperm stage (see Fig.
3C). However, in some mutant seeds, larger nuclei were observed at the
micropylar pole (Fig. 4G), suggesting continued cycles of
endoreduplication after failed cellularization.
AtCSLA7 Is Important for Pollen Tube Growth
The reduced male transmission indicated a role for AtCSLA7 in
pollen development or during pollen function. We used fluorescein diacetate, Alexander, and 4',6-diamino-phenylindole staining to test pollen for plasma membrane integrity, cytoplasmic density, and
nuclear constitution, respectively. In all tests, we found that pollen
development and viability appeared normal in SGT4425 (data not shown).
To investigate whether pollen tube growth was affected, the
distribution of aborted seeds in siliques was examined in an in vivo
competition experiment. If mutant pollen grew more slowly than WT, less
transmission would be expected in ovules fertilized toward the base of
the silique (Meinke, 1982
). Siliques were divided into
equal halves, and the proportion of aborted seeds counted in the basal
and apical halves (Fig. 3A; Table IV). In
selfed SGT4425, the proportion of aborted seeds in the apical half was close to the expected maximum of 25% (Table IV), supporting the notion
that pollen development and germination were not significantly affected. However, in the basal half, there were significantly fewer
aborted seeds (8.2%, a 3-fold decrease), indicating that further
growth of the AtCSLA7 mutant pollen tubes was
impaired.
View this table:
[in this window]
[in a new window]
|
Table IV.
In vivo pollen competition
The no. of aborted seeds was determined in the apical and basal halves
of the siliques of selfed SGT4425 from different generations of plants.
|
|
 |
DISCUSSION |
We have isolated an insertional mutant of
AtCSLA7, a gene predicted to encode a processive
-glycosyltransferase. The mutant shows embryo
lethality and pollen tube growth is impaired. The results suggest
that a cell wall polysaccharide synthesized by AtCSLA7 is essential for
aspects of growth and development in Arabidopsis.
AtCSLA7 Is a Member of the Superfamily of Processive
-Glycosyltransferases
AtCSLA7 is a member of the large GT2 family of inverting
processive
-glycosyltransferases that includes hyaluronan and
cellulose synthases (Henrissat and Davies, 2000
;
Saxena and Brown, 2000
; Nobles et al.,
2001
). Like the other members of this family, AtCSLA7 is
predicted to contain several transmembrane domains. In comparison with
other members of the family, we predict a topology with six transmembrane domains (Fig. 1B). The large cytosolic loop would contain
the conserved glycosyltransferase domain, often known as the
D,D,D,QXXRW motif (Saxena and Brown, 2000
; Nobles
et al., 2001
). The first and second D residues correspond to
the DDS and DAD motifs, respectively (Fig. 1B), both conserved in all
the CSLA members. These residues are thought to be important in binding the donor NDP-sugar and Mn2+ (Wiggins and
Munro, 1998
; Karnezis et al., 2000
). The third
Asp and the QXXRW motif are found in the acceptor domain of CSLA7 and
these residues are conserved in all the processive glycosyltransferases (Davies and Henrissat, 2002
). By aligning AtCSLA7 with
CELA, CESA, and CSL proteins from different organisms, we found that
the Asp and the QXXRW motif lie within a widely conserved
sequence:
G(X)8ED(X)10G[W/Y/F](X)23-25QXXRW(X)2G (Fig. 1B), suggesting that these residues are essential for the activity of the proteins. There are also further conserved regions in
all members of the CSLA subfamily. Therefore, AtCSLA7 contains all the
characteristics expected of the processive
-glycosyltransferases.
Mutants in the Processive
-Glycosyltransferase Family
The best studied Arabidopsis mutants in processive
-glycosyltransferases are those in the cellulose synthase CESA
family (Saxena and Brown, 2000
; Williamson et
al., 2001
). Interestingly, despite the existence of 12 CESA genes, often expressed in the same tissue, single-gene
defects have been found to lead to clear phenotypic alterations.
However, unlike the Atcsla7 mutant, none have yet been found
to be essential. A model has been proposed in which the cellulose
synthase subunits are active as a protein complex, and an absence of
one subunit might inhibit the function of all the subunits of the
complex (Taylor et al., 2000
; Dhugga, 2001
). There may be some overlap in expression and function of the different cellulose synthase complexes, such that some cellulose is
synthesized in the absence of any one complex.
Very few mutants in any CSL gene have been
described yet. Two groups have recently characterized a mutant in
AtCSLD3 (Favery et al., 2001
; Wang et
al., 2001
). The plants have weakened root hair walls
because they burst as they begin to extend. Despite the expression of
this gene in every tissue examined, the phenotype was observed only in
the root hairs. This suggests that some redundancy may exist among the
five AtCSLD genes. The only other previously discussed
CSL mutant is rat4, which contains an insertional
disruption in AtCSLA9 (described in a review by
Richmond and Somerville, 2001
). The rat4
mutant is resistant to Agrobacterium tumefaciens transformation. This bacterium binds to plant cell walls at an early
stage of the infection (Nam et al., 1999
).
Interestingly, rat4 is dominant, suggesting the heterozygous
mutant has insufficient of a certain cell wall component that is
essential for A. tumefaciens infection. The recessive embryo
lethality of the Atcsla7 mutation demonstrates that
AtCSLA7 is not redundant to the other 14 family members, at
least in early embryos. Thus, the AtCSLA7 protein might work
in a complex with other CSLA family members, as has been suggested in
the CESA family. Alternatively, it might synthesize a variant of a
polysaccharide with a specific function, or be part of the only CSLA
complex expressed in pollen and in seed development.
AtCSLA7 Is Required for Normal Pollen Tube Growth
Mutant Atcsla7 pollen developed normally, but its TE
was reduced by 71% compared with the WT. This suggested a defect
during progamic (postpollination) development, which involves a number of distinct steps including adhesion, cell polarization and
germination, pollen tube growth, guidance, and fertilization
(Franklin-Tong, 1999
; Wilhelmi and Preuss,
1999
). The efficient fertilization of ovules positioned toward
the apical end of the pistil suggests that early events are not
affected and that mutant pollen tubes are correctly guided. Similarly,
defects in fertilization can be excluded because failed ovules that
could result from occupancy of the micropyle by mutant pollen tubes
were not observed in Atcsla7 siliques. However, mutant
pollen tubes clearly do not compete effectively with WT pollen tubes in
the basal region of the pistil. This suggests a late defect in either
in the rate of pollen tube growth, or termination of pollen tube
extension resulting in pollen tubes being unable to reach the most
basal ovules. The incomplete penetrance of the Atcsl7
mutation on pollen tube growth could support a role for other family
members, or may suggest that glycans synthesized by AtCSL7 have a
quantitative role in pollen tube extension.
The specialized tip growth mechanism of the pollen tube is associated
with dynamic changes in cell wall structure and composition (Hepler et al., 2001
). The pollen tube wall has an inner
callosic layer and an outer fibrillar layer containing predominantly
pectic polysaccharides, cellulose, xyloglucan, and arabinogalactan
(Li et al., 1999
). During pollen tube extension,
calcium-mediated cross-linking of de-esterified pectins in the flanks
of the apical pollen tube wall is thought to reinforce the pollen tube
wall and focus cell expansion at the apex (Franklin-Tong,
1999
). The defect in pollen tube growth in Atcsl7
could result from changes in cell wall properties, including its
extensibility and/or stability as a result of the absence of a specific
polysaccharide. Alternatively, AtCSLA7 could affect pollen tube growth
though disruption of signaling events that are wall mediated. Such
interactions between the stylar environment and the pollen tube are
clearly significant in tube growth and guidance. For example,
nonclassical AGPs present in the transmitting tissue of the style have
been shown to be important for pollen tube growth (Cheung et
al., 1995
; Wu et al., 2000
).
AtCSLA7 Is Required for Embryo Development and Endosperm
Proliferation
By studying the development of mutant and sibling WT seeds in
individual siliques, we found that the rate of development of AtcslA7 mutant embryos was severely impaired, and that
simultaneously the endosperm failed to proliferate. Although the
embryos continued to increase in cell number throughout the normal
developmental period, they finally arrested with terminal phenotypes
that were morphologically pro-embryo or early globular. Patterning was
generally normal until the octant stage, but early defects were
observed in the orientation of the first or second axial divisions. The most common phenotype involved defects at the dermatogen stage, when
octant embryos undergo eight asymmetric periclinal cell divisions to
form the protoderm layer. The protoderm was frequently incomplete and
abnormal transverse divisions in the basal region of the pro-embryo resulted in axially elongated globular embryos.
In Atcsla7, both embryonic cell patterning and cell
proliferation are affected, yet in many mutants these phenotypes are
not linked. In mutants that act early during embryogenesis to disturb embryo patterning such as ton/fass, keule, and
knolle (Torres-Ruiz and Jurgens, 1994
;
Assaad et al., 1996
; Lukowitz et al.,
1996
), abnormal embryos continue to develop. Similarly, the
cell wall Hyp-rich glycoprotein RSH is essential for determination of
division planes and cell shape in the embryo, but the cells continue to proliferate (Hall and Cannon, 2002
). Second, a number of
mutants including rsp1-3 (Yadegari et al.,
1994
) and edd1 (Uwer et al., 1998
)
arrest with terminal globular phenotypes, yet these mutants show normal
globular embryo patterning, including a complete protoderm layer. The
defects in Atcsla7 of both cell proliferation and cell patterning might result from the metabolic dysfunction and chaotic failure of individual cells. However, given the prediction that AtCSLA7
is involved in cell wall synthesis, we favor a model where the
phenotype arises from disturbed cell signaling that normally regulates
cell proliferation and cell division patterning in the embryo. Although
little is known about the role of cell wall components in signaling in
embryos of higher plants, studies in fucus show that
localized deposition of a sulfated polysaccharide is required to
establish polarity of the egg cell, and this cell wall polysaccharide can determine cell fate (Belanger and Quatrano,
2000
).
The effects of the Atcsla7 mutation on seed development were
not restricted to the embryo. Detailed analysis of the developing seeds
revealed arrested proliferation of the endosperm nuclei without
cellularization. This may reflect a shared requirement for AtCSLA7 in
the embryo and the endosperm. Alternatively, AtCSLA7 may have a primary
role in either, with defects in signaling between the two being
responsible for the associated delay in embryo and endosperm
development. Such signals could come from the embryo itself or the
endosperm. The role of the endosperm in seed development is thought to
involve the provision of both nutrients and signals to the developing
embryo (Berger, 1999
). In the medea
fis, and fie mutants, endosperm development can
proceed independently of embryo development (Vinkenoog et al.,
2000
). However, complete development of the endosperm does not
occur, and it may depend on the presence of a normal embryo.
Conversely, embryo development can occur in the absence of the
endosperm during somatic embryogenesis (Berger, 1999
),
but the requirement of a secreted type IV endochitinase (EP3) derived
from nonembryogenic cells may reflect a signaling role of the endosperm
in embryogenesis (van Hengel et al., 1998
, 2002
). The nature of potential signals that control
embryo development are unknown, although the involvement of
oligosaccharides derived from chitin containing AGPs that are released
by EP3 has been suggested (van Hengel et al., 1998
,
2002
; Berger, 1999
).
The Function of AtCSLA7
The CSLs are likely to be
-glycosyltransferases that synthesize
the backbones of cell wall polysaccharides. There are at least eight
classes of
-glycan backbone-like chains in the dicot cell wall:
cellulose, callose, mannans, xylans, the glucan of xyloglucan, the
-1,4-galactan of RG-I, and the
-1,3- and
-1,6-galactans of
AGPs. Because cellulose synthase and callose synthases have been
described, the six CSL families (CSLA-E, CSLG) identified in
Arabidopsis on the basis of sequence similarity (Richmond and Somerville, 2000
) could synthesize the six remaining classes. Two further families (F and H) have been identified in rice
(Oryza sativa; Hazen et al., 2002
),
and one of these might synthesize the mixed-linkage glucan not found in
dicots. It is also important to consider that one family as defined by
sequence similarity could make more than one polysaccharide, and
conversely, two families may synthesize the same polysaccharide.
Indeed, it has been proposed that the CSLD family might be cellulose
synthases (Doblin et al., 2001
).
Which polysaccharide does AtCSLA7 synthesize? We clearly do not yet
know. Cell wall polysaccharides have structural and signaling roles. We
believe that the AtcslA7 embryo phenotype is more consistent with a signaling role, and is more severe than that because of cellulose deficiency (Gillmor et al., 2002
). A signaling
role would suggest that xyloglucan or AGPs are possible candidates. AtCSLA7 is ubiquitously expressed, and these polysaccharides
are present in most cell types. The structural xylans are thought to be
essentially secondary wall polysaccharides, and, therefore, are likely
to be essential only at a later developmental stage. The
cyt1 mutant, unable to synthesize GDP-Man, is likely to be deficient in mannans, glycoproteins, and GPI-anchored cell wall proteins (Lukowitz et al., 2001
). This mutant has a less
severe embryo development phenotype than AtcslA7; therefore,
mannan synthesis is unlikely. In contrast, the
-1,4-glucan backbone
of xyloglucan is a good candidate because the bacterial
-1,4-glucan
(cellulose) synthases are more closely related to the CSLA subfamily
than other plant glycosyltransferases. Alternatively, a clue may come from rat4, a mutant in AtCSLA9 (described in a
review by Richmond and Somerville, 2001
). This mutant is
resistant to Agrobacterial infection, like the AGP mutant
rat1 (Nam et al., 1999
). Therefore, could the
CslA family be involved in AG glycan synthesis? AGPs contain both
-1,3- and
-1,6-galactan backbones that could be synthesized by
processive glycosyltransferases. Intriguingly, AGPs have been
implicated both in embryo development and pollen tube growth. Because
arabinogalactan glycosylation is predicted in a wide range of cell wall
proteins (Borner et al., 2002
), any defect leading to
reduced AG glycosylation could impair the cell wall function of many
proteins, leading to a broad spectrum of phenotypic changes including
defective cell signaling during embryogenesis and pollen tube growth.
We are currently investigating these possibilities.
 |
MATERIALS AND METHODS |
Plant Materials and Growth Conditions
The SGT4425 line (Ds insertion, Parinov et
al., 1999
) in Arabidopsis ecotype Ler was
provided by the Nottingham Arabidopsis Stock Centre (UK). Mutants were
selected on solid medium containing Murashige and Skoog salts and 35 µg mL
1 kanamycin. After 3 weeks, plants were
transferred to soil:sand (3:2 [v/v]) or Murashige and Skoog liquid
medium and grown at 20°C under fluorescent white light in
16-h-light/8-h-dark cycles. The mutant line was backcrossed to WT
Ler grown in soil under identical conditions.
Arabidopsis ecotype Columbia (Col0) liquid callus cultures were grown
as described previously (Prime et al., 2000
).
Mutant Screen
Primer 1 (TGTAGTTGTAC CTGTCTTCAAG), primer 2 (TGCAGGAACTGCTGGCGTCTG), primer 3 (AGCCCATTTCG GAACTGTGAC), primer
4 (CTGAAACATAT TGAGACTCTATG), primer 5 (GGTTCCCGTCC GATTTCGACT), and
primer 6 (ACGGTCGGGAA ACTAGCTCTAC) were used to screen by PCR for
plants with insertions using DNA prepared from a single leaf according to Weigel and Glazebrook (2002)
. Primers 1 to 4 are gene
specific and primers 5 and 6 are Ds specific.
Cloning of a Full-Length cDNA
Total RNA samples were prepared from WT Arabidopsis ecotype Col0
callus as described previously (Brusslan and Tobin,
1992
). The RT-PCR reaction was performed using Superscript II
(Life Technologies/Gibco-BRL, Cleveland) as described by the
manufacturer in two steps. In the first step, primer 4 was used with 5 µg of total RNA in a total volume of 20 µL. The cDNA (1 µL of
RT-PCR solution) was amplified by PCR using primers 4 and 7 (CACTTGGCCGA TTGAAAGA). The sequence was deposited in EMBL/GenBank
(accession no. AJ488284). The AGI annotation number for this gene is At2g35650.
Expression of CSLA7
RNA samples were prepared from tissues of Col0 or
Ler plants using a protocol described previously
(Brusslan and Tobin, 1992
). Callus (4 and 7 d old),
7-d-old plantlets, roots produced from liquid growth of old plants,
leaves of rosettes (2, 4, 6, 8, and 10 weeks old), all parts of floral
stems (before or after flowering), stems alone, leaves of stems,
flowers (including flower buds), pollen, and siliques (young and old)
were used. Duplicate samples of RNA were prepared, except for pollen
and roots. In all cases, at least three plants at a similar stage of
development were used to make the RNA sample.
RT-PCR and PCR were as described above except that primers 1 and 4 were
used to amplify the cDNA from an aliquot of 0.1 to 5 µL of the RT
reaction. The quantity used for different tissues in the PCR was
equivalent to 10 to 500 ng of RNA. Controls without RT were performed.
DNA Sequencing and Sequence Analysis
The DNA sequence analysis was performed at the sequencing
facility of the Department of Biochemistry (University of Cambridge, UK) using sequencers (models 377 and 373, Applied Biosystems, Foster
City, CA) and big dye termination reactions. Sequences were analyzed by
the Wisconsin package version 10.3 (Accelrys Inc., San Diego) and
hydrophobic sequences determined using the program Protscale
(http://www.expasy.org).
Phenotypic Analysis of Pollen and Embryos
Analysis of mature pollen with 4',6-diamino-phenylindole
was carried out as previously described (Park et al.,
1998
). Pollen was treated with aniline blue solution to detect
callose staining as previously described (Park and Twell,
2001
). Fluorescein diacetate staining was carried out by
incubation of freshly isolated pollen in 0.3 M mannitol
solution containing 2 µg mL
1 fluorescein diacetate
according to Heslop-Harrison and Heslop-Harrison (1970)
.
Alexander staining of pollen was carried out on pollen released from
flowers fixed in ethanol:acetic acid (3:1 [v/v]) for 30 min. After
washing flowers in 50 mM Tris-HCl buffer (pH 6.8), released
pollen grains were mixed directly with Alexander stain
(Alexander, 1969
).
For phenotypic characterization of mutant embryos, siliques of
different lengths were dissected on a slide using a syringe needle
(0.4 × 12 mm) under a STEMI SV8 dissecting microscope (Zeiss, Jena, Germany) and embryos were cleared with a drop of clearing solution (240 g of chloral hydrate and 30 g of glycerol in 90 mL
of water) for 30 min at room temperature. Preparations were examined
with a microscope (model BHS, Olympus, Tokyo) equipped for DIC
microscopy. Images were captured and processed as described previously
(Park et al., 1998
).
Genetic Transmission Analysis
To determine gametophytic transmission of the transposon
insertion, reciprocal test crosses were performed between the WT (Ler) and mutant SGT4425. Harvested seed from individual
siliques was sown on kanamycin-containing plates and the resistance
phenotype was scored. The TE of the T-DNA through each gamete (TE male
and TE female) was calculated as described previously (Howden et
al., 1998
).
Complementation of the CslA7 Mutant
The gene including 1,300 bp upstream of the start codon and
approximately 500 bp downstream of the stop codon was amplified by PCR
using the primers ACGCGTCGACA AGTTGATGATT AGTTGCTTAG and CGGAATTCAGC
AGAACAGACA TGGCCACG. The approximately 4,000-bp fragment was cloned
into the BinAR vector (a BIN19 derivative conferring hygromycin
resistance in plants, and a gift of L. Willmitzer, MPI, Golm,
Germany), and transformed into Agrobacterium
tumefaciens C58C1. The mutant plants were transformed by the
floral dipping protocol of Clough and Bent (1998)
. Seeds
were sown on Murashige and Skoog agar plates containing kanamycin (35 µg mL
1) and hygromycin B (20 µg
mL
1).
We thank the Nottingham Arabidopsis Stock Centre (UK) for
providing mutant seeds. We thank Thomas Martin (Department of Plant Biology, University of Cambridge, UK) for helping us with some plant
crosses and our colleagues for their helpful discussions.
Received September 13, 2002; returned for revision October 25, 2002; accepted November 14, 2002.
Article, publication date, and citation information can be found at
www.plantphysiol.org/cgi/doi/10.1104/pp.014555.