First published online January 9, 2003; 10.1104/pp.012047
Plant Physiol, February 2003, Vol. 131, pp. 610-620
Recently Duplicated Maize R2R3 Myb Genes Provide
Evidence for Distinct Mechanisms of Evolutionary Divergence after
Duplication1
Anusha P.
Dias,2
Edward L.
Braun,2
Michael D.
McMullen, and
Erich
Grotewold*
Department of Plant Biology and Plant Biotechnology Center, Ohio
State University, Columbus, Ohio 43210 (A.P.D., E.G.); Department of
Zoology, University of Florida, Gainesville, Florida 32611 (E.L.B.);
and Plant Genetics Research and Plant Science Units, United States
Department of Agriculture-Agricultural Research Service, University of
Missouri, Columbia, Missouri 65211 (M.D.M.)
 |
ABSTRACT |
R2R3 Myb genes are widely distributed in the
higher plants and comprise one of the largest known families of
regulatory proteins. Here, we provide an evolutionary framework
that helps explain the origin of the plant-specific R2R3
Myb genes from widely distributed R1R2R3 Myb
genes, through a series of well-established steps. To understand the
routes of sequence divergence that followed Myb gene
duplication, we supplemented the information available on recently
duplicated maize (Zea mays) R2R3 Myb
genes (C1/Pl1 and
P1/P2) by cloning and characterizing
ZmMyb-IF35 and ZmMyb-IF25. These two
genes correspond to the recently expanded P-to-A group of maize
R2R3 Myb genes. Although the origins of
C1/Pl1 and
ZmMyb-IF35/ZmMyb-IF25 are associated with
the segmental allotetraploid origin of the maize genome, other gene
duplication events also shaped the P-to-A clade. Our analyses indicate
that some recently duplicated Myb gene pairs display
substantial differences in the numbers of synonymous substitutions that
have accumulated in the conserved MYB domain and the divergent
C-terminal regions. Thus, differences in the accumulation of
substitutions during evolution can explain in part the rapid divergence
of C-terminal regions for these proteins in some cases. Contrary to
previous studies, we show that the divergent C termini of these R2R3
MYB proteins are subject to purifying selection. Our results provide an
in-depth analysis of the sequence divergence for some recently
duplicated R2R3 Myb genes, yielding important
information on general patterns of evolution for this large family of
plant regulatory genes.
 |
INTRODUCTION |
Gene duplications have long been
viewed as a main source of evolutionary novelty (Ohno,
1970 ). The dramatic expansion of the R2R3 Myb
family of regulatory genes in the higher plants provides a striking
example of how gene amplifications followed by divergence may have
impacted plant evolution. Members of this gene family encode proteins
characterized by two 50- to 52-residue-long imperfect repeats. Each of
these MYB repeats contains three -helices, with the second and third
helices forming a helix-turn-helix structure when bound to DNA
(Ogata et al., 1994 ). Around 125 R2R3 Myb
genes are present in the Arabidopsis genome (Reichmann and
Ratcliffe, 2000 ; Stracke et al., 2001 ), and more
than 200 in maize (Zea mays) and related monocots (E.L.
Braun and E. Grotewold, unpublished data). This represents a sharp
contrast to the small number of genes encoding MYB homologs in the
animal and fungal kingdoms (Lipsick, 1996 ).
Plant R2R3 Myb genes originated from an ancestral gene
encoding a three-MYB repeat protein represented in animals today by c-myb and related genes (Lipsick, 1996 ), and
in plants by the small pc-Myb gene family (Braun and
Grotewold, 1999a ). After the loss of the R1 repeat, an
explosive amplification of the R2R3 Myb gene family occurred
250 to 400 million years ago (Mya) (Rabinowicz et al.,
1999 ). R2R3 Myb genes are more or less evenly
distributed throughout the plant genome without forming obvious
clusters, as found for plant resistance (R) genes, for
example (Bergelson et al., 2001 ).
R2R3 MYB proteins are characterized by the presence of a conserved MYB
domain and a longer divergent C-terminal region. Short conserved motifs
in the C-terminal region of these proteins have been identified and
were used to classify Arabidopsis R2R3 Myb genes into
subgroups (Kranz et al., 1998 ; Stracke et al.,
2001 ). The dramatic divergence of the C-terminal regions does
not appear to have a large influence in the regulatory function of the
corresponding proteins. For example, related R2R3 Myb genes
that act as regulators of anthocyanin biosynthesis in maize, petunia
(Petunia hybrida), and Arabidopsis (encoded by
C1, An2, and Pap1, respectively) show little or no detectable identity outside their MYB domains. Despite this C-terminal divergence, the maize C1 protein can complement petunia
An2 mutants, and vice versa (Quattrocchio et al.,
1999 , 1993 ). Similarly, the Arabidopsis GL1 and
WER proteins are interchangeable in their ability to regulate root hair
or trichome formation, despite sharing only 23% C-terminal identity
(Lee and Schiefelbein, 2001 ). Finally, domain-swapping
experiments involving maize P1 and C1 suggest regulatory specificity is
largely provided by the MYB domains of these proteins (Grotewold
et al., 2000 ).
The high degree of sequence divergence for the C-terminal regions of
many R2R3 Myb proteins, coupled with the apparent absence of functional
constraints upon these regions, suggests that they may be diverging at
the neutral rate. However, some blocks of C-terminal sequence identity
in specific plant R2R3 MYB proteins have persisted over very long
evolutionary times. The most compelling example is a block of >50
amino acids with >40% identity found in a moss (Physcomitrella
patens) MYB protein and the snapdragon (Antirrhinum
majus) MIXTA protein (Kranz et al., 1998 ). Detailed comparison of sequence divergence in the MYB domains and C-terminal regions of R2R3 MYB proteins might provide insights into these apparent
contradictions, and the first attempt to compare the evolution of
different regions in MYB proteins found substantial disagreement
between trees identified using different regions (Rosinski and
Atchley, 1998 ). This prompted the conclusion that MYB proteins
are polyphyletic (Rosinski and Atchley, 1998 ), a term
used for groups based upon shared characters that reflect evolutionary
convergence (for review, see Page and Holmes, 1998 ). The
conclusion that Myb genes are polyphyletic must be viewed with caution
because incongruence between phylogenetic trees estimated using
different regions of the same gene could reflect difficulties with the
alignment or analysis rather than genuine differences in tree topology.
In fact, it has been demonstrated that random data can show significant
incongruence with phylogenetically structured data (Dolphin et
al., 2000 ).
Previous studies have provided a number of specific hypotheses
regarding the patterns of evolution for different regions of R2R3 MYB
proteins, which differ regarding the rate of evolution and degree of
functional constraint upon the C-terminal regions (Braun and
Grotewold, 1999a ; Stracke et al., 2001 ).
Examining the degree of functional constraint upon proteins using
evolutionary comparisons is typically accomplished by calculating the
ratio of non-synonymous (KA) to synonymous
(KS) substitutions, a value designated . If
there are no constraints upon the amino acid sequence, estimates of will equal one. In contrast, the purifying selection typical of most
proteins will result in estimates of < 1, whereas the rapid
fixation of non-synonymous substitutions that are selectively
advantageous will result in estimates of > 1 for those sites
or regions subject to positive selection. Estimates of will exhibit
a high variance when they are calculated using data from ancient gene
duplications because synonymous sites are expected to saturate rapidly
in plants (see Rabinowicz et al., 1999 ). However, the
identification of a group of R2R3 Myb genes that has
undergone a recent amplification in the grasses (Braun and
Grotewold, 1999b ; Rabinowicz et al., 1999 )
provides us with an excellent opportunity to investigate the patterns
of evolution of recently duplicated R2R3 Myb genes.
In this study, we establish an evolutionary framework to explain events
that followed the origin of R2R3 Myb genes from widely distributed c-Myb-like genes. To investigate patterns of
evolution responsible for the striking divergence that characterizes
plant R2R3 Myb genes, we focused upon recently duplicated
R2R3 Myb genes. Toward this goal, we characterized
ZmMyb-IF35 and ZmMyb-IF25, two maize R2R3
Myb genes that belong to a gene clade that expanded during the
evolution of the grasses (Rabinowicz et al., 1999 ). The
physical map positions of these genes were determined and found to be
consistent with an origin during the duplication of the maize genome.
Comparisons of these and related R2R3 Myb genes provided
evidence that MYB domains and C termini are both subject to purifying
selection. Furthermore, our analyses indicate substantial heterogeneity
in the number of non-synonymous and synonymous substitutions in
different regions of recently duplicated R2R3 Myb genes.
Together, these studies provide the first insights, to our
knowledge, into the possible mechanisms of divergence that
accompanied the dramatic expansion of the R2R3 Myb gene
family in the plants.
 |
RESULTS AND DISCUSSION |
An Evolutionary Framework for Plant R2R3 MYB Proteins
Plant MYB proteins are encoded by a very large and diverse gene
family (Braun and Grotewold, 1999a ; Rabinowicz et
al., 1999 ; Stracke et al., 2001 ),
with most plant Myb homologs characterized by two MYB
repeats and the insertion of a single amino acid (Leu) in the first
(R2) repeat, relative to animal Myb homologs (Fig. 1A). To provide a framework to examine
plant Myb gene evolution, we estimated the phylogeny of a
large number of Arabidopsis and selected monocot Myb proteins
representing all major groups. Two data sets were used, a small
alignment (45 sequences) and a large alignment (106 sequences; see
supplemental data at www.plantphysiol.org). The topology of the
trees obtained using these data sets, or by including additional plant
Myb proteins from our own collection or available from public
databases, were essentially the same with none of the well-supported
clade shown in Figure 1A rearranged (not shown). Analyses of both
alignments revealed two distinct types of plant Myb homologous that
lack the Leu insertion in the R2 repeat: (a) the three repeat pc-Myb
proteins (Braun and Grotewold, 1999a ), also described as
3Rmyb (Kranz et al., 2000 ); and (b) a subset of MYB
proteins designated the "atypical" R2R3 MYB proteins (Braun
et al., 2001 ). Surprisingly, some of these atypical R2R3 MYB
proteins (e.g. AtMyb22) have a Trp residue in the first helix of R3,
like the pc-Myb proteins but unlike the majority of plant MYB proteins
(Braun and Grotewold, 1999a ).

View larger version (32K):
[in this window]
[in a new window]
|
Figure 1.
Evolutionary relationships among plant MYB domain
proteins. A, An estimate of phylogeny obtained using weighted neighbor
joining of ML distance estimates obtained using the WAG+ model of sequence evolution (parameters are provided in "Materials
and Methods"). Sequences are from Arabidopsis (At),
Chlamydomonas reinhardtii (Cr), rice
(Oryza sativa; Os), P. patens (Pp), and maize
(Zm). An arrow indicates the position of the root discussed in the
text. The support for each of the branches is indicated by the
thickness of the lines. Estimates of phylogeny obtained using both
alignments were identical, with the exception of the C. reinhardtii R2R3 MYB, which shifted to a position outside of a
clade containing AtMyb1, AtMyb44, and AtMyb55 in analyses of the large
alignment. Branch lengths are proportional to the expected number of
amino acid substitutions per site under the WAG+ model. The
specific molecular changes that occurred during the evolution each of
the major phylogenetic groups are indicted by the structures of the MYB
domains on the right of the tree. Sequences included in the figure were
selected to sample the diversity of Mybs based upon C-terminal motifs.
B, Pattern of gene duplications for sequence duplication/divergence of
the groups of R2R3 Myb genes discussed in this study. The
pattern of gene duplications is shown as a reconciled tree, showing
genes that have been inferred but not identified in specific lineages
in light gray text. These genes have either been lost during evolution
or have not been sampled in the relevant lineages.
|
|
The root of the plant Myb phylogeny is likely to be between the pc-Myb
proteins and the R2R3 MYB proteins (indicated with an arrow in Fig.
1A). Three repeat MYB homologs are broadly distributed in animals,
plants, and slime molds (Lipsick, 1996 ; Braun and Grotewold, 1999a ), whereas typical R2R3 MYB proteins are
limited to the green plant lineage (Braun et al., 2001 ;
Stracke et al., 2001 ). Restricting our consideration to
plant MYB proteins, a three-step model for the origin for typical R2R3
MYB proteins is suggested (Fig. 1A). This model would involve loss of
the R1 repeat (branch ), mutation of the Trp residue in the first
helix of R3 to a Phe (branch ), and insertion of the Leu residue in R2 (branch ). Loss of the first repeat (branch ) occurred before divergence of land plants and chlorophyte algae because an atypical R2R3 Myb is present in C. reinhardtii (Fig. 1A). The Leu
insertion and diversification of the typical R2R3 MYB proteins occurred before the divergence of mosses and angiosperms because a typical R2R3
Myb (PpMyb2) is present in the moss P. patens (Leech
et al., 1993 ).
Previous analyses suggest that many gene duplications in the family
encoding typical R2R3 MYB proteins occurred early in the history of
land plants (Rabinowicz et al., 1999 ). This model of rapid diversification early in the history of land plants is consistent with the relatively short and poorly supported (by the bootstrap and
posterior probabilities in Bayesian analyses) branches at the base of
the typical R2R3 MYB group. Establishing the mechanisms by which the
plant R2R3 Myb gene family expanded and diverged is
complicated by the ancient nature of these duplications. However, several recently duplicated groups of R2R3 Myb genes have
been identified in maize (Braun and Grotewold, 1999b ),
and the analysis of members of one of these groups provides clues on
the possible mechanisms of evolutionary divergence after gene
duplication of R2R3 Myb genes.
ZmMyb-IF25 and ZmMyb-IF35 Belong to a Group
of Recently Duplicated R2R3 Myb Genes
We previously have analyzed more than 80 sequences of
MybBRH and these studies provided evidence that
several groups of maize R2R3 Myb genes amplified within the
past 50 million years (Braun and Grotewold, 1999b ;
Rabinowicz et al., 1999 ). One of these groups corresponds to the P-to-A clade, united by the change of Pro-63 to Ala
(Fig. 1A) in the hinge region between the R2 and R3 MYB repeats
(Rabinowicz et al., 1999 ). The analysis of the
MybBRH sequences suggested two types of genes
within the P-to-A clade: (a) those diverging at a relatively low rate
(e.g. P1, a regulator of 3-deoxy flavonoid biosynthesis;
Grotewold et al., 1994 ); and (b) those diverging more
rapidly (e.g. ZmMyb-IF25 and ZmMyb-IF35; Rabinowicz et al., 1999 ).
To better understand the patterns of evolution of these recently
duplicated genes, we cloned ZmMyb-IF35 (accession no.
AF521880) and ZmMyb-IF25 (accession no. AF521881; see
"Materials and Methods"). A full-length cDNA clone for
ZmMyb-IF25 was obtained from a yeast
(Saccharomyces cerevisiae) one-hybrid screen, using the high-affinity P-binding sites present in the A1 gene
(Grotewold et al., 1994 ), in an effort to identify
additional proteins that recognize this binding site (M.-G. Kim and E. Grotewold, unpublished data). The molecular analysis of the genomic and
cDNA clones showed that the intron-exon structure of
ZmMyb-IF35 and ZmMyb-IF25 (Fig. 2A) was identical to that of the maize
P1, C1, and Pl1 genes (Paz-Ares et al., 1987 ; Grotewold et al., 1991 ;
Cone et al., 1993 ). Like in P1
(Grotewold et al., 1991 ), the second intron of
ZmMyb-IF35 and ZmMyb-IF25 is unusually long, more
than 2 kb for ZmMyb-IF35 and over 6 kb for
ZmMyb-IF25.

View larger version (88K):
[in this window]
[in a new window]
|
Figure 2.
Sequence comparisons of recently duplicated
R2R3 Myb genes. A, Amino acid sequence alignment in the MYB
domain. Comparison of amino acid sequences of the predicted proteins
encoded by ZmMyb-IF25, ZmMyb-IF35,
OsMyb-IF, OsMyb-P, P1, C1,
and Pl1. Dark-shaded boxes indicate identical amino acids
and lighter shaded boxes indicate similar amino acids. The positions of
the three helices forming the R2 and R3 MYB repeats are shown with the
clear boxes and the MYB domain interrupted by two introns are indicated
with arrows. The change from Pro to Ala that defines the
MybPtoA clade is marked with a star. B, Amino
acid sequence alignment for the C termini. Comparison of the predicted
C-terminal regions encoded by MybPtoA clade
members ZmMyb-IF25, ZmMyb-IF35, OsMyb-IF, OsMyb-P, and P1. Dashes
indicate gaps introduced to reflect insertions and deletions during
evolution.
|
|
We mapped the ZmMyb-IF35 and ZmMyb-IF25 loci
using polymorphisms in the 5' sequence. Primers designed from the 5'
region of ZmMyb-IF35 detected a direct size polymorphism
between B73 and Mo17, the parents of the intermated B73/Mo17 (IBM)
mapping population (Lee et al., 2002 ). Genotypes were
determined for the 94 core individuals of the IBM population and
ZmMyb-IF35 was placed against a framework map of 219 loci.
Primers designed from the 5' region of ZmMyb-IF25 detected a
direct size polymorphism between T218 and GT119, the parents of a
quantitative trait loci mapping population also used to map a
large number of the maize SSR loci (Sharopova et al.,
2002 ). Genotypes were determined for the 93 F2 individuals from this population and
ZmMyb-IF25 was mapped against a framework map of 96 loci.
The IBM and T218 X GT119 maps are available at MaizeDB
(http://www.agron.missouri.edu/maps.html). ZmMyb-IF35 mapped
to chromosome 3, bin 3.04 and ZmMyb-IF25 mapped to
chromosome 8, bin 8.03-8.04. These map positions correspond to
duplicated regions of the maize genome, based upon comparative mapping
analyses (Helentjartis et al., 1988 ; Gaut
and Doebley, 1997 ). Thus, similar to the maize regulators of
anthocyanin biosynthesis C1 and Pl1, ZmMyb-IF35 and ZmMyb-IF25 appear to have diverged
during the reversion of the segmental allotetraploid ancestor of maize
to disomic inheritance, an event that has been estimated to have
occurred approximately 11 Mya (Gaut and Doebley,
1997 ).
Patterns of Evolution of Recently Duplicated R2R3 Myb Genes
The origin of the P-to-A clade precedes the divergence of monocots
and eudicots. Evidence for this is provided by the presence of two
Arabidopsis sequences (AtMyb11 and AtMyb12) with a similar change of
Pro-63 to Ser, AtMyb111 with a change of Pro-63 to Arg, and the cotton
(Gossypium hirsutum) GhMyb-J that also has a Pro-63 to Ala substitution (Loguercio et al., 1999 ). Molecular
clock estimates indicated that the expansion of this group to yield a
large number of maize paralogs was an event unique to the grasses (Rabinowicz et al., 1999 ), a clade of plants that
diversified within the past 55 million years. Consistent with this
hypothesis, AtMyb11, AtMyb12, P1, ZmMyb-IF35, and ZmMyb-IF25 form a
well-supported clade, with AtMyb11 and AtMyb12 basal to a monophyletic
group of monocot P-to-A R2R3 Myb sequences (Fig. 1, A and B). However, two rice genes encoding P-to-A Mybs (accession nos. BAB64029 and
AAL84631) provided evidence that the ZmMyb-IF35 and ZmMyb-IF25 genes diverged from the P lineage,
characterized by the recently duplicated P1 and
P2 genes (Zhang et al., 2000 ).
The evidence for orthology of the rice P-to-A sequences and the maize
P1, ZmMyb-IF35, and ZmMyb-IF25 genes
was strengthened by finding substantial C-terminal identity between
these genes (Fig. 2B), prompting us to call the rice genes
OsMyb-P and OsMyb-IF. The genomic sequence of
OsMyb-P (accession no. AF474141) and OsMyb-IF
(accession no. AP002873) shows the presence of relatively long (>4 kb)
introns in the same position as the second intron in P1. The
OsMyb-IF gene lacks an intron in a position homologous to
the first intron in P1 (Fig. 2A), whereas other grass P-to-A Myb genes have short introns in this position.
The sister group to the P-to-A clade includes several anthocyanin
regulators (e.g. the products of the maize C1 and the
petunia An2 genes). Interestingly, we found limited support
for a clade containing AtMyb123 and C1/Pl1 from maize, but excluding
AtMyb75 (Pap1; Borevitz et al., 2000 ) and An2
from petunia. Based upon the exchangeability of C1 and An2
(Quattrocchio et al., 1993 , 1999 ) and
clustering in previous phylogenetic analyses (Braun and
Grotewold, 1999b ; Rabinowicz et al., 1999 ),
AtMyb75, petunia An2, and maize C1 had been thought to be orthologous.
However, C1, Pl1, and AtMyb123 have two short boxes of identity in the C-terminal region. One of these boxes is a nine-amino acid signature previously reported (Stracke et al., 2001 ) and the
second is a 15-amino acid signature starting with amino acid 172 in C1
(E.L. Braun, unpublished data). These conserved motifs in the divergent C-terminal regions of these proteins, together with our phylogenetic analyses (Fig. 1), provide additional evidence that C1 and AtMyb123 are
orthologs. Interestingly, AtMyb123 (TT2) was characterized to be a
regulator of proanthocyanidin accumulation in developing seed
(Nesi et al., 2001 ). It is likely that C1 and An2 are
paralogs related by a duplication event before the divergence of
monocots and eudicots, although they have clearly retained similar
functions (Quattrocchio et al., 1999 ).
Taken together, these findings provide evidence for a model in which:
(a) the origin of the P-to-A clade precedes the divergence of monocots
and eudicots; (b) this group of R2R3 Myb genes underwent a
recent expansion in the grasses; and (c) this expansion involved genome
duplication (e.g. ZmMyb-IF35 and ZmMyb-IF25),
tandem gene duplication (e.g. P1 and P2;
Zhang et al., 2000 ), and a more ancient duplication
(e.g. the P1/P2 and
ZmMyb-IF35/ZmMyb-IF25 lineages). The study of the
divergence patterns of R2R3 Myb genes that duplicated recently by diverse mechanisms provides a unique opportunity to understand the general evolutionary patterns of plant R2R3
Myb genes.
Divergence of the Conserved MYB Domains and Variable C-Terminal
Regions
A general characteristic of plant R2R3 Myb genes is the
high conservation of the MYB domains coupled with the dramatic
divergence of C-terminal regions. Does this divergence difference
reflect functional constraints upon the MYB domain with the
C-terminal regions evolving at the neutral rate? Or are MYB domains
and C-terminal regions both subject to purifying selection? To
investigate the constraints upon the MYB and C-terminal regions of
recently duplicated R2R3 Myb genes, the numbers of
KS and KA substitutions
were estimated for pairs of recently duplicated R2R3 Myb
genes (Table I). As expected, separate
estimates of (KA/KS)
from the MYB and C-terminal regions indicated more constraints upon MYB
domains than upon C-terminal regions. However, estimates of for
C-terminal regions were lower than expected under the neutral model
(Table I), suggesting the existence of moderate purifying selection for
these regions.
View this table:
[in this window]
[in a new window]
|
Table I.
Synonymous (KS) and non-synonymous
(KA) distances between the pairs of recently duplicated
R2R3 Myb genes examined for this study
|
|
As a heuristic to examine which regions of these recently duplicated
pairs of R2R3 Myb genes had accumulated more non-synonymous substitutions, we conducted a "sliding window" analysis (Fig. 3). These analyses
provided evidence for functional constraints upon the MYB domain,
consistent with the key role of MYB domains in DNA binding (for review,
see Lipsick, 1996 ) and protein-protein interactions
(Grotewold et al., 2000 ). However, the C-terminal regions of all pairs examined also show regions exhibiting very limited
non-synonymous divergence (Fig. 3).


View larger version (43K):
[in this window]
[in a new window]
|
Figure 3.
Sliding window analysis of duplicated pairs of
R2R3 Myb genes. Numbers of synonymous and non-synonymous
substitutions in 15 codon windows were estimated using the YN00 model
of sequence evolution (constraining nuisance parameters as described in
"Materials and Methods"). Bars in gray indicate the three
-helices in MYB repeat 1 (H1, 22-33 amino acids; H2, 36-45 amino
acids; and H3, 51-60 amino acids) and MYB repeat 2 (H1, 75-86 amino
acids; H2, 88-97 amino acids; and H3, 102-111 amino acids), where the
second and third helices form a helix-turn-helix (HTH) structure when
bound to DNA. The TAD in ZmMyb-C1/ZmMyb-Pl1 is shown in light
gray.
|
|
Estimates of KS were substantially
higher for the segments of C1/Pl1 and
AtMyb11/AtMyb12 that encode the C-terminal regions of these
gene products than for the segments encoding the MYB domains of these
proteins (Table I; Fig. 3). The divergent C-terminal regions of
AtMyb75/AtMyb90 have accumulated slightly fewer synonymous differences than the highly similar MYB domains. However, the difficulty in estimating numbers of synonymous substitutions suggests that it is reasonable to conclude that any differences in
KS for the MYB domain and the C terminal of both
ZmMyb-IF35/ZmMyb-IF25 and AtMyb75/AtMyb90 are extremely modest.
These findings provide strong evidence that the C-terminal
regions of all pairs of R2R3 Myb genes studied here are
subject to moderate purifying selection and confirm the fact that MYB domains are subject to strong purifying selection. The existence of
moderate purifying selection upon C-terminal regions is surprising because the R2R3 Myb genes examined here are members of
clades for which experiments have demonstrated limited functional roles for the C-terminal domains (Goff et al.,
1991 ; Sainz et al., 1997 ; Grotewold et
al., 2000 ). However, based on the evolutionary analyses presented here, we propose that the C termini of these proteins are
likely to play a more important role in the function of R2R3 MYB
transcription factors than previously anticipated.
These data also provide evidence that
KA and KS values exhibit a
positive intragenic correlation in some genes, extending the results of
studies using mammalian sequences (Alvarez-Valin et al.,
1998 ; Smith and Hurst, 1999 ) to the flowering
plants. Clearly, these results challenge the use of
KS values to provide a time scale for evolution,
and question the biological basis for the observed intragenic
KA-KS correlation.
Understanding the Divergence of C-Terminal Regions between
R2R3 Myb Genes
Although sliding window analyses did show some regions
with = 1, consistent with specific regions evolving under a
neutral model, there were no regions where estimates of greatly
exceeded values consistent with the neutral or purifying selection
models of evolution. These observations suggest that recently
duplicated R2R3 Myb genes related to P1 and
C1 in maize have not diverged because of the action of
positive selection, suggested as a possible model for the evolution of
specific MADS box transcription factors in species of the
genera Argyroxiphium, Dubautia, and
Wilkesia, a group known as the Hawaiian silverswords
(Barrier et al., 2001 ). Thus, our results suggest that
the observed non-synonymous acceleration does not represent a general
feature of transcription factor genes in polyploids, because this study
did not show evidence for accelerated accumulation of non-synonymous
substitutions in maize, an ancient polyploid (Gaut and Doebley,
1997 ).
The C-terminal regions of R2R3 MYB proteins also accumulate a number of
insertion and deletion changes (e.g. Fig. 2), making it difficult to
align these regions for proteins that diverged more than 100 Mya. The
difficulty in aligning these regions could be largely responsible for
the observed incongruence in the evolution rate between different
regions of R2R3 MYB proteins. This model cannot be excluded by the
results of this study, unlike the neutral model that was excluded by
the values of <1 for R2R3 MYB protein C-terminal regions that we
observed. The notion that much of the incongruence between the MYB
domain and C-terminal regions reflects difficulty in alignment
represents an excellent alternative to the polyphyly model of Rosinski
and Atchley (1998) , and it is consistent with the
observation that many R2R3 MYB clades identified by analyses of the MYB
domain share C-terminal motifs. It remains possible that domain
shuffling have contributed to the divergence of specific Myb
genes. In fact, some alleles of the P1 gene have a putative
Cys-containing metal binding domain at their C terminus that could have
arisen by domain shuffling (Chopra et al., 1996 ). However, there is no evidence that this pattern of evolution is more
common than divergence at different rates coupled with substantial numbers of insertion-deletion mutations.
A surprising aspect of the current study is the fact that regions of
R2R3 Myb genes that encode the divergent C-terminal regions often exhibit higher KS values than the regions
encoding the MYB domains (see the comparisons of C1/Pl1 and
AtMyb11/AtMyb12; Table I). The observation in
this study is difficult to reconcile with neutral models, which
postulate that different regions of the genome show different rates of
mutation. Likewise, we believe that models that invoke selection for
specific mRNA structures (e.g., Eyre-Walker and Bulmer,
1993 ) represent an unlikely explanation for the observations in
this study. The GC-content of genes should have a strong impact upon
RNA structure, so it is likely that selection on synonymous sites
because of mRNA structure would be stronger and more consistent in the
GC-rich genes of grasses. However, the higher apparent rate of
synonymous substitution was observed for one pair of genes in maize and
one pair of genes in Arabidopsis, despite the very different
GC-contents of genes in these organisms.
There are two potential models consistent with all of the available
data from paralogous R2R3 Myb genes. It is possible that there are differences in the rate of mutation in different regions of
transcription units, a plausible hypothesis considering the involvement
of some proteins in both transcription and in DNA repair
(Lehmann, 1998 ). However, we believe a simpler model
might be the impact of gene conversions in the conserved regions
corresponding to the MYB domains of these regions. This model would
explain the more limited divergence of these regions at both synonymous and non-synonymous sites without invoking different rates of mutation. This model would also explain the loss of introns in the conserved region of some R2R3 Myb genes, including OsMYB-IF and
ZmMyb-B2 (Rabinowicz and Grotewold, 2000 ), because this
loss could involve gene conversion with the products of reverse
transcription after splicing.
Although a general characteristic of the R2R3 Myb gene
family is the striking divergence of C-terminal regions, this feature is by no means unique to R2R3 Myb genes. For example, MADS
box genes, another large family of genes encoding transcriptional regulators in the green plants (Theissen et al., 1996 ;
Purugganan, 1997 ), also show extreme sequence divergence
in the C termini. Unlike the R2R3 MYB proteins where the C-terminal
region can be very large, the divergent C-terminal region of MADS-box
proteins usually corresponds to less than one-third of the
entire protein. Extending these types of studies to either to a
genome-wide scale for Myb genes or other gene families
should provide more power to test among distinct evolutionary models.
However, detailed analyses of specific genes, such as those conducted
here, may provide information that can be difficult to find when
conducting large-scale comparative genomic studies.
 |
CONCLUSIONS |
The expansion of the R2R3 Myb genes early in the
history of plants makes it one of the largest families of regulatory
proteins known. Evolutionary studies of this gene family have been
hindered by the ancient nature of gene duplications. Here, we took
advantage of several recently duplicated R2R3 Myb genes to
establish some basic patterns of R2R3 Myb gene evolution. We
established a pathway that explains the origin of plant specific
R2R3 Myb genes from widely distributed three-MYB repeat
genes. We established that the divergent C-terminal regions of R2R3 MYB
proteins are subject to purifying selection and found that these
regions sometimes show higher numbers of synonymous substitutions than
the MYB domain. In fact, sliding window analyses indicated the
substantial heterogeneity in the accumulation synonymous and
non-synonymous substitutions across the coding regions of all pairs of
R2R3 MYB proteins investigated. Together, our studies provide the most
in-depth analysis of the sequence divergence of recently duplicated
R2R3 Myb genes and suggest novel models for the function and
evolution of these genes.
 |
MATERIALS AND METHODS |
Screening of Bacterial Artificial Chromosome (BAC)
Libraries
The expressed sequence tag (EST) clone corresponding to
ZmMyb-IF35 was obtained by searching a proprietary EST
database at Pioneer Hi-Bred International (Johnston, IA). After
completely sequencing the EST, we established that the 1,577-bp
full-length clone encoded a putative protein of 344 amino acids with an
amino-terminal R2R3 MYB domain. A probe corresponding to the
carboxyl-terminal region of ZmMyb-IF35 cDNA and
excluding the amino-terminal MYB domain region was used to screen a
maize (Zea mays) B73 inbred BAC library (Incyte Genomics
Inc., Palo Alto, CA). Four BAC clones were recovered (91c08, 235g24,
165j16, and 145c17) and were restriction digested to isolate
full-length genomic clones. EcoRI was used to digest
165j16 BAC clone and a 6-kb fragment was subcloned into pBluescript II
SK (Stratagene, La Jolla, CA), and the presence of the
full-length MYB domain was verified by PCR. Sequencing was carried out
using primers flanking the two introns of ZmMyb-IF35. A
full-length genomic clone of ZmMyb-IF25 in pBluescript
II SK (Stratagene) was generated by digesting the 145c17
BAC clone with XbaI and inserting a 9-kb fragment into
the vector.
Mapping of ZmMyb-IF35 and
ZmMyb-IF25
The following primers were designed from the 5' sequences of
ZmMyb-IF25 and ZmMyb-IF35: IF25, forward,
TTTGGTCTGGTGATCAAATCAATG; IF25, reverse, AGGTGCAACTGCAAGAAATGC; IF35,
forward, GCAATCCCTTCTCGCCCTTT; and IF35, reverse,
CTGCTTGGGAGAGGAGATCGAG. These primer pairs were used to amplify the
corresponding regions from genomic DNA of 12 inbred lines: B73, Mo17,
GT119, T218, sm1-stock, A619, Mp708, W23c2whp1, NC7A, Tx501, CO159, and Tx303. The PCR
reaction conditions were: 1× PCR buffer, 0.4 mM dNTPs, 50 ng each of SSR primers (forward and reverse), 0.3 units of AmpliTaq
Gold (Perkin-Elmer Applied Biosystems, Foster City, CA), and 50 ng of genomic DNA, in a total volume of 15 µL. Thermocycling
conditions were: 95°C, 1'; 65°C, 1'; and 72°C, 30' for one cycle
and then a 1°C decrement for the annealing temperature, each repeated
once, until the annealing temperature is 55°C followed by 95°C 1',
55°C 1', and 72°C 30' for 30 cycles. The amplification products
were resolved on 3.5% (w/v) agarose gels. Genotypes for mapping
ZmMyb-IF35 were determined using a size polymorphism of
the amplification products between B73 and Mo17; likewise, genotypes
for mapping ZmMyb-IF25 were determined using a size
polymorphism between T218 and GT119. Linkage maps for placing
ZmMyb-IF25 and ZmMyb-IF35 were
constructed using MAPMAKER/EXP (version 3.0, Whitehead Institute,
Cambridge, MA). Starting with a framework map for each
population, the "assign" and "build" commands were used to
identify the chromosome and place the locus within the framework order.
Sequence Analysis
The analyses of the sequences obtained were conducted using the
Oxford Molecular MacVector 6.0 (Accelrys Inc., San Diego) and MacDNAsis
(version 2.0, Hitachi Ltd., San Bruno, CA). Sequences used to examine
the evolution of MYB domains were aligned using ClustalW
(Thompson et al., 1994 ) and trimmed to exclude sequences outside of the MYB domain. Phylogenetic analyses of these sequences were conducted by weighted neighbor joining (Bruno et al.,
2000 ) of distance estimates obtained using the WAG model of
sequence evolution (Whelan and Goldman, 2001 ). Previous
analyses have suggested significant variance in rates across sites for
MYB domains (Rabinowicz et al., 1999 ), and this variance
was accommodated using a distribution with a shape parameter ( )
estimated from the data by maximum likelihood ( = 0.74 for the 46-taxon alignment and = 0.74 for the 127-taxon
alignment). Addition of this parameter resulted in a highly significant
improvement to model fit using the likelihood ratio test
(Goldman and Whelan, 2000 ).
We examined confidence in clades using the bootstrap
(Felsenstein, 1985 ), applying "seqboot" from the
PHYLIP package (http://evolution.genetics.washington.edu). Distance
estimates were calculated using TREE-PUZZLE 5.0 (http://www.tree-puzzle.de) and trees were identified using
weighbor 1.2 (http://www.t10.lanl.gov/billb/weighbor/index.html). Bayesian analyses were also conducted to examine confidence in clades,
using a version of MrBayes 2.01 (Huelsenbeck and Ronquist, 2001 ; http://morphbank.ebc.uu.se/mrbayes/) that had been
modified to allow use of the WAG+ model of amino acid evolution
(specific modifications available upon request from E.L. Braun). The
Bayesian analyses used four Markov chains with default heating and were run for 106 generations. The Markov chains appeared to
converge rapidly, and the first 2 × 105 generations
were discarded as "burn-in."
Reconciled trees, which show gene duplications given a specific species
tree (Goodman et al., 1979 ), were displayed using GeneTree 1.3.0 (Page, 1998 ; available from
http://taxonomy.zoology.gla.ac.uk/rod/genetree/genetree.html).
All of the R2R3 Myb genes from grasses examined by this
study show the extreme codon bias characteristic of other nuclear encoded genes in grasses (Murray et al., 1989 ), with a
third codon position GC content of >80%. In contrast, the Arabidopsis
R2R3 Myb genes investigated show a much more limited
codon bias, as is generally the case for eudicot genes (Murray
et al., 1989 ). For this reason, KS and
KA were calculated using the YN00 model of coding sequence
evolution (Yang and Nielsen, 2000 ) because this model
accommodates compositional bias and variable transition to transversion
ratios. The YN00 program distributed with the PAML package
(http://abacus.gene.ucl.ac.uk/software/paml.html) was used for these
calculations. When estimates of KS and KA were calculated for short segments of the R2R3 Myb coding
regions, the transition-transversion parameter and the base composition at each codon position were fixed at the values estimated from the
complete sequences. This was accomplished by modifying the YN00 program
to allow input of these values from a data file.
 |
ACKNOWLEDGMENTS |
We are grateful to J. Marcela Hernandez and Katherine Houchins
for excellent technical assistance and Rob Fields for assistance in the
assembly of data sets for computer analyses. Anusha P. Dias
acknowledges Rasil Warnakulasooriya for helpful discussions. We thank
Pioneer Hi-Bred International and Dr. Wes Bruce for the ZmMyb-IF35 cDNA. We also appreciate the comments and
suggestions of the two anonymous reviewers.
 |
FOOTNOTES |
Received August 1, 2002; returned for revision September 22, 2002; accepted October 19, 2002.
1
This work was supported in part by the National
Science Foundation (grant nos. MCB-9974474 and MCB-9896111 to
E.G.), by the U.S. Department of Agriculture (postdoctoral fellowship
no. USDA 1999-01582 to E.L.B.), and by the U.S. Department of
Agriculture-Agricultural Research Service (research funds to
M.D.M.).
2
These authors contributed equally to the paper.
*
Corresponding author; e-mail grotewold.1{at}osu.edu; fax
614-292-5379.
Article, publication date, and citation information can be found at
www.plantphysiol.org/cgi/doi/10.1104/pp.012047.
 |
LITERATURE CITED |
-
Alvarez-Valin F, Jabbari K, Bernardi G
(1998)
Synonymous and nonsynonymous substitutions in mammalian genes: intragenic correlations.
J Mol Evol
46: 37-44[CrossRef][Web of Science][Medline]
-
Barrier M, Robichaux RH, Purugganan MD
(2001)
Accelerated regulatory gene evolution in an adaptive radiation.
Proc Natl Acad Sci USA
98: 10208-10213[Abstract/Free Full Text]
-
Bergelson J, Kreitman M, Stahl EA, Tian D
(2001)
Evolutionary dynamics of plant R-genes.
Science
292: 2281-2285[Abstract/Free Full Text]
-
Borevitz JO, Xia Y, Blount J, Dixon RA, Lamb C
(2000)
Activation tagging identifies a conserved MYB regulator of phenylpropanoid.
Plant Cell
12: 2383-2394[Abstract/Free Full Text]
-
Braun EL, Grotewold E
(1999a)
Newly discovered plant c-myb-like genes rewrite the evolution of the plant myb gene family.
Plant Physiol
121: 21-24[Free Full Text]
-
Braun EL, Grotewold E
(1999b)
Diversification of the R2R3 Myb gene family and the segmental allotetraploid origin of the maize genome.
Maize Genet Coop Newsl
73: 26-27
-
Braun EL, Matulnik T, Dias AP, Grotewold E
(2001)
Transcription factors and metabolic engineering: novel applications for ancient tools.
Rec Adv Phytochem
35: 79-109
-
Bruno WJ, Socci ND, Halpern AL
(2000)
Weighted neighbor joining: a likelihood-based approach to distance-based phylogeny reconstruction.
Mol Biol Evol
17: 189-197[Abstract/Free Full Text]
-
Chopra S, Athma P, Peterson T
(1996)
Alleles of the maize P gene with distinct tissue specificities encode Myb-homologous proteins with C-terminal replacements.
Plant Cell
8: 1149-1158[Abstract]
-
Cone KC, Cocciolone SM, Burr FA, Burr B
(1993)
Maize anthocyanin regulatory gene pl is a duplicate of c1 that functions in the plant.
Plant Cell
5: 1795-1805[Abstract]
-
Dolphin K, Belshaw R, Orme CDL, Quicke DLJ
(2000)
Noise and incongruence: interpreting results of the incongruence length difference test.
Mol Phylogenet Evol
17: 401-406[CrossRef][Web of Science][Medline]
-
Eyre-Walker A, Bulmer M
(1993)
Reduced synonymous substitution rate at the start of enterobacterial genes.
Nucleic Acids Res
21: 4599-4603[Abstract/Free Full Text]
-
Felsenstein J
(1985)
Confidence-limits on phylogenies: an approach using the bootstrap.
Evolution
39: 783-791[CrossRef][Web of Science]
-
Gaut BS, Doebley JF
(1997)
DNA sequence evidence for the segmental allotetraploid origin of maize.
Proc Natl Acad Sci USA
94: 6809-6814[Abstract/Free Full Text]
-
Goff SA, Cone KC, Fromm ME
(1991)
Identification of functional domains in the maize transcriptional activator C1: comparison of wild-type and dominant inhibitor proteins.
Genes Dev
5: 298-309[Abstract/Free Full Text]
-
Goldman N, Whelan S
(2000)
Statistical tests of gamma-distributed rate heterogeneity in models of sequence evolution in phylogenetics.
Mol Biol Evol
17: 975-978[Free Full Text]
-
Goodman M, Czelusniak J, Moore GW, Romero-Herrera AE, Matsuda G
(1979)
Fitting the gene lineage into its species lineage: a parsimony strategy illustrated by cladograms constructed from globin sequences.
Syst Zool
28: 132-168[CrossRef]
-
Grotewold E, Athma P, Peterson T
(1991)
Alternatively spliced products of the maize P gene encode proteins with homology to the DNA-binding domain of Myb-like transcription factors.
Proc Natl Acad Sci USA
88: 4587-4591[Abstract/Free Full Text]
-
Grotewold E, Drummond B, Bowen B, Peterson T
(1994)
The Myb-homologous P gene controls phlobaphene pigmentation in maize floral organs by directly activating a flavonoid biosynthetic gene subset.
Cell
76: 543-553[CrossRef][Web of Science][Medline]
-
Grotewold E, Sainz MB, Tagliani L, Hernandez JM, Bowen B, Chandler VL
(2000)
Identification of the residues in the Myb domain of C1 that provide the specificity of the interaction with the bHLH cofactor R.
Proc Natl Acad Sci USA
97: 13579-13584[Abstract/Free Full Text]
-
Helentjartis T, Weber D, Wright S
(1988)
Identification of the genomic locations of duplicate nucleotide sequences in maize by analysis of restriction fragment length polymorphisms.
Genetics
118: 353-363[Abstract/Free Full Text]
-
Huelsenbeck JP, Ronquist F
(2001)
MRBAYES: Bayesian inference of phylogenetic trees.
Bioinformatics
17: 754-755[Abstract/Free Full Text]
-
Kranz H, Scholtz K, Weisshaar B
(2000)
c-MYB oncogene-like genes encoding three MYB repeats occur in all major plant lineages.
Plant J
21: 231-235[CrossRef][Web of Science][Medline]
-
Kranz HD, Denekamp M, Greco R, Lin H-L, Leyva A, Meissner R, Petroni K, Urzainiqui A, Bevan M, Martin C, et al
(1998)
Towards the functional characterization of the members of the R2R3-MYB gene family from Arabidopsis thaliana.
Plant J
16: 263-276[CrossRef][Web of Science][Medline]
-
Lee M, Sharopova N, Beavis WD, Grant D, Katt M, Blair, Hallauer A
(2002)
Expanding the genetic map of maize with the intermated B73 × Mo17 (IBM) population.
Plant Mol Biol
48: 453-461[CrossRef][Web of Science][Medline]
-
Lee MM, Schiefelbein J
(2001)
Developmentally distinct MYB genes encode functionally equivalent proteins in Arabidopsis.
Development
128: 1539-1546[Abstract]
-
Leech MJ, Kammerer W, Cove DJ, Martin C, Wang TL
(1993)
Expression of myb-related genes in the moss, Physcomitrella patens.
Plant J
3: 51-61[CrossRef][Web of Science][Medline]
-
Lehmann AR
(1998)
Dual functions of DNA repair genes: molecular, cellular, and clinical implications.
Bioessays
20: 146-155[CrossRef][Web of Science][Medline]
-
Lipsick JS
(1996)
One billion years of Myb.
Oncogene
13: 223-235[Web of Science][Medline]
-
Loguercio LL, Zhang J-Q, Wilkins TA
(1999)
Differential regulation of six novel MYB-domain genes defines two distinct expression patterns in allotetraploid cotton (Gossypium hirsutum L.).
Mol Gen Genet
261: 660-671[CrossRef][Web of Science][Medline]
-
Murray EE, Lotzer J, Eberle M
(1989)
Codon usage in plant genes.
Nucleic Acids Res
17: 477-498[Abstract/Free Full Text]
-
Nesi N, Jond C, Debeaujon I, Caboche M, Lepiniec L
(2001)
The Arabidopsis TT2 gene encodes an R2R3 Myb domain protein that acts as a key determinant for proanthocyanidin accumulation in developing seed.
Plant Cell
13: 2099-2114[Abstract/Free Full Text]
-
Ogata K, Morikawa S, Nakamura H, Sekikawa A, Inoue T, Kanai H, Sarai A, Ishii S, Nishimura Y
(1994)
Solution structure of a specific DNA complex of the Myb DNA-binding domain with cooperative recognition helices.
Cell
79: 639-648[CrossRef][Web of Science][Medline]
-
Ohno S
(1970)
Evolution by Gene Duplication. Springer-Verlag, Berlin
-
Page RDM
(1998)
GeneTree: comparing gene and species phylogenies using reconciled trees.
Bioinformatics
14: 819-820[Abstract/Free Full Text]
-
Page RDM, Holmes EC
(1998)
Molecular Evolution: A Phylogenetic Approach. Blackwell Science Ltd., Oxford
-
Paz-Ares J, Ghosal D, Weinland U, Peterson PA, Saedler H
(1987)
The regulatory c1 locus of Zea mays encodes a protein with homology to myb proto-oncogene products and with structural similarities to transcriptional activators.
EMBO J
6: 3553-3558[Web of Science][Medline]
-
Purugganan MD
(1997)
The MADS-box floral homeotic gene lineages predate the origin of seed plants: phylogenetic and molecular clock estimates.
J Mol Evol
45: 392-396[CrossRef][Web of Science][Medline]
-
Quattrocchio F, Wing J, van der Woude K, Souer E, de Vetten N, Mol J, Koes R
(1999)
Molecular analysis of the anthocyanin2 gene of petunia and its role in the evolution of flower color.
Plant Cell
11: 1433-1444[Abstract/Free Full Text]
-
Quattrocchio F, Wing JF, Leppen HTC, Mol JNM, Koes RE
(1993)
Regulatory genes controlling anthocyanin pigmentation are functionally conserved among plant species and have distinct sets of target genes.
Plant Cell
5: 1497-1512[Abstract]
-
Rabinowicz PD, Braun EL, Wolfe AD, Bowen B, Grotewold E
(1999)
Maize R2R3 Myb genes: sequence analysis reveals amplification in higher plants.
Genetics
153: 427-444[Abstract/Free Full Text]
-
Rabinowicz PD, Grotewold E
(2000)
A novel reverse-genetic approach (SIMF) identifies Mutator insertions in new Myb genes.
Planta
211: 887-893[Medline]
-
Reichmann JL, Ratcliffe OJ
(2000)
A genomic perspective on plant transcription factors.
Curr Opin Plant Biol
3: 423-434[CrossRef][Web of Science][Medline]
-
Rosinski JA, Atchley WR
(1998)
Molecular evolution of the Myb family of transcription factors: evidence for polyphyletic origin.
J Mol Evol
46: 74-83[CrossRef][Web of Science][Medline]
-
Sainz MB, Goff SA, Chandler VL
(1997)
Extensive mutagenesis of a transcriptional activation domain identifies single hydrophobic and acidic amino acids important for activation in vivo.
Mol Cell Biol
17: 115-122[Abstract]
-
Sharopova N, McMullen MD, Schultz L, Schroeder S, Sanchez-Villeda H, Gardiner J, Bergstrom D, Houchins K, Melia-Hancock S, Musket T, et al
(2002)
Development and mapping of SSR markers for maize.
Plant Mol Biol
48: 463-481[CrossRef][Web of Science][Medline]
-
Smith NG, Hurst LD
(1999)
The effect of tandem substitutions on the correlation between synonymous and nonsynonymous rates in rodents.
Genetics
153: 1395-1402[Abstract/Free Full Text]
-
Stracke R, Werber M, Weisshaar B
(2001)
The R2R3-MYB gene family in Arabidopsis thaliana.
Curr Opin Plant Biol
4: 447-456[CrossRef][Web of Science][Medline]
-
Theissen G, Kim JT, Saedler H
(1996)
Classification and phylogeny of the MADS-box multigene family suggest defined roles of MADS-box gene subfamilies in the morphological evolution of eukaryotes.
J Mol Evol
43: 484-516[Web of Science][Medline]
-
Thompson JD, Higgins DG, Gibson TJ
(1994)
CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice.
Nucleic Acids Res
11: 4673-4680
-
Whelan S, Goldman N
(2001)
A general empirical model of protein evolution derived from multiple protein families using a maximum-likelihood approach.
Mol Biol Evol
18: 691-699[Abstract/Free Full Text]
-
Yang Z, Nielsen R
(2000)
Estimating synonymous and nonsynonymous substitution rates under realistic evolutionary models.
Mol Biol Evol
17: 32-43[Abstract/Free Full Text]
-
Zhang P, Chopra S, Peterson T
(2000)
A segmental gene duplication generated differentially expressed myb-homologous genes in maize.
Plant Cell
12: 2311-2322[Abstract/Free Full Text]
© 2003 American Society of Plant Biologists
This article has been cited by other articles:

|
 |

|
 |
 
M. Chen, Z. Xu, L. Xia, L. Li, X. Cheng, J. Dong, Q. Wang, and Y. Ma
Cold-induced modulation and functional analyses of the DRE-binding transcription factor gene, GmDREB3, in soybean (Glycine max L.)
J. Exp. Bot.,
January 1, 2009;
60(1):
121 - 135.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Yilmaz, M. Y. Nishiyama Jr., B. G. Fuentes, G. M. Souza, D. Janies, J. Gray, and E. Grotewold
GRASSIUS: A Platform for Comparative Regulatory Genomics across the Grasses
Plant Physiology,
January 1, 2009;
149(1):
171 - 180.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Alandete-Saez, M. Ron, and S. McCormick
GEX3, Expressed in the Male Gametophyte and in the Egg Cell of Arabidopsis thaliana, Is Essential for Micropylar Pollen Tube Guidance and Plays a Role during Early Embryogenesis
Mol Plant,
July 1, 2008;
1(4):
586 - 598.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Punwani, D. S. Rabiger, and G. N. Drews
MYB98 Positively Regulates a Battery of Synergid-Expressed Genes Encoding Filiform Apparatus Localized Proteins
PLANT CELL,
August 1, 2007;
19(8):
2557 - 2568.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. B. Lai, J. A. Nadeau, J. Lucas, E.-K. Lee, T. Nakagawa, L. Zhao, M. Geisler, and F. D. Sack
The Arabidopsis R2R3 MYB Proteins FOUR LIPS and MYB88 Restrict Divisions Late in the Stomatal Cell Lineage
PLANT CELL,
October 1, 2005;
17(10):
2754 - 2767.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. J. Davidson, R. Tirouvanziam, L. A. Herzenberg, and J. S. Lipsick
Functional Evolution of the Vertebrate Myb Gene Family: B-Myb, but Neither A-Myb nor c-Myb, Complements Drosophila Myb in Hemocytes
Genetics,
January 1, 2005;
169(1):
215 - 229.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. F. Heine, J. M. Hernandez, and E. Grotewold
Two Cysteines in Plant R2R3 MYB Domains Participate in REDOX-dependent DNA Binding
J. Biol. Chem.,
September 3, 2004;
279(36):
37878 - 37885.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Elomaa, A. Uimari, M. Mehto, V. A. Albert, R. A.E. Laitinen, and T. H. Teeri
Activation of Anthocyanin Biosynthesis in Gerbera hybrida (Asteraceae) Suggests Conserved Protein-Protein and Protein-Promoter Interactions between the Anciently Diverged Monocots and Eudicots
Plant Physiology,
December 1, 2003;
133(4):
1831 - 1842.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
C. O. Marian, S. J. Bordoli, M. Goltz, R. A. Santarella, L. P. Jackson, O. Danilevskaya, M. Beckstette, R. Meeley, and H. W. Bass
The Maize Single myb histone 1 Gene, Smh1, Belongs to a Novel Gene Family and Encodes a Protein That Binds Telomere DNA Repeats in Vitro
Plant Physiology,
November 1, 2003;
133(3):
1336 - 1350.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|