First published online January 23, 2003; 10.1104/pp.014530
Plant Physiol, February 2003, Vol. 131, pp. 793-802
cor Gene Expression in Barley Mutants Affected in
Chloroplast Development and Photosynthetic Electron
Transport1
Cristina
Dal
Bosco,2
Marco
Busconi,2
Chiara
Govoni,
Paolo
Baldi,
A. Michele
Stanca,
Cristina
Crosatti,
Roberto
Bassi, and
Luigi
Cattivelli*
Istituto Sperimentale per la Cerealicoltura, Via S. Protaso 302, I-29017, Fiorenzuola d'Arda (PC), Italy (C.D.B., M.B., C.G., P.B.,
A.M.S., C.C., L.C.); Università di Verona, Facoltà di
Scienze Matematiche Fisiche Naturali; Biotecnologie Vegetali, Strada Le
Grazie, 37134, Verona, Italy (C.B.D., C.G., R.B.)
 |
ABSTRACT |
The expression of several barley (Hordeum
vulgare) cold-regulated (cor) genes during cold
acclimation was blocked in the albino mutant
an, implying a chloroplast control on mRNAs
accumulation. By using albino and xantha
mutants ordered according to the step in chloroplast biogenesis
affected, we show that the cold-dependent accumulation of
cor14b, tmc-ap3, and
blt14 mRNAs depends on plastid developmental stage.
Plants acquire the ability to fully express cor genes
only after the development of primary thylakoid membranes in their
chloroplasts. To investigate the chloroplast-dependent mechanism
involved in cor gene expression, the activity of a
643-bp cor14b promoter fragment was assayed in wild-type
and albino mutant an leaf
explants using transient -glucuronidase reporter expression assay.
Deletion analysis identified a 27-bp region between nucleotides 274
and 247 with respect to the transcription start point, encompassing a
boundary of some element that contributes to the cold-induced expression of cor14b. However, cor14b
promoter was equally active in green and in albino
an leaves, suggesting that chloroplast controls cor14b expression by posttranscriptional
mechanisms. Barley mutants lacking either photosystem I or II reaction
center complexes were then used to evaluate the effects of redox state of electron transport chain components on COR14b accumulation. In the
mutants analyzed, the amount of COR14b protein, but not the
steady-state level of the corresponding mRNA, was dependent on the
redox state of the electron transport chain. Treatments of the
vir-zb63 mutant with electron transport
chain inhibitors showed that oxidized plastoquinone promotes COR14b
accumulation, thus suggesting a molecular relationship between
plastoquinone/plastoquinol pool and COR14b.
 |
INTRODUCTION |
Plastid proteins are encoded by both
nuclear and plastid genomes. Interaction between the two genetic
systems is therefore needed for a coordinated response to environmental
factors affecting chloroplast biogenesis (Goldschmidt-Clermont,
1998 ). Impaired plastid function leads to a decline of many
mRNAs encoded in the nucleus, suggesting that plastid signals are
required for the nuclear gene expression (Oelmüller et
al., 1986 ). In barley (Hordeum vulgare), the
albostrians mutant, lacking plastid ribosomes, showed an
altered expression of many nuclear genes when compared with the
corresponding wild type, as shown by the decreased level of nuclear
gene transcripts encoding chloroplast as well as a few non-chloroplast
proteins. Thus, a role for plastid factors in the control of the
nuclear genome was inferred (Hess et al., 1994 ).
In the chloroplast membranes, environmental conditions (e.g. excess
light and/or low temperature) affect light-induced electron transport
rate, and thus the plastoquinone redox state reflects the balance
between light harvesting and energy use. Over-reduction of
plastoquinone pool causes photoinhibition of photosynthesis (Huner et al., 1996 ). The redox state of the
plastoquinone controls several functions involved in chloroplast
biogenesis: the transcription rate of the chloroplast psaB
gene (Tullberg et al., 2000 ), the transcription
(Escoubas et al., 1995 ) of nuclear genes encoding chloroplast proteins, and also posttranscriptional modification processes (Dickey et al., 1998 ).
Changes in plastoquinone redox state elicit stress response mechanisms
(Huner et al., 1996 ). In maize (Zea mays),
the cold/light-induced phosphorylation of CP29 is promoted by the
over-reduction of the plastoquinone pool (Bergantino et al.,
1995 ; Mauro et al., 1998 ). In winter rye
(Secale cereale), it has been suggested that photosystem II
(PSII) excitation pressure, rather than growth temperature per se,
regulates the expression of the low temperature-induced gene
wcs19 (Gray et al., 1997 ).
Exposure to low, nonfreezing temperatures induces a process known as
cold acclimation (hardening) that improves frost resistance of
over-winter plants through the expression of cold-responsive genes
(Thomashow, 1999 ). A number of genes triggered by cold
(cold-regulated [cor] genes) or by cold and dehydration
have been reported (Cattivelli et al., 2002 ). In barley,
many nuclear-encoded cor genes have been described, among
them are cor14b, blt14, and
tmc-ap3. Cor14b encodes a soluble
protein of unknown function localized in the stroma compartment of the
chloroplast (Crosatti et al., 1995 , 1999 ), whereas tmc-ap3 encodes a
putative channel protein of the chloroplast outer envelope selective
for amino acids (Baldi et al., 1999 ). Blt14
is a component of a gene family encoding proteins predicted to be
secreted into the apoplast (Phillips et al., 1997 ); at
least five different blt14-related sequences
(blt14.0, blt14.1, blt14.2, ao86, and ao29)
have been described (Phillips et al., 1997 ;
Grossi et al., 1998 ).
Previous studies have shown that the expression of
cor14b, blt14, and tmc-ap3
is affected by both light and chloroplast development. The expression
of cor14b in etiolated plants was enhanced by a short
exposure to red (but not far-red) or blue light before cold treatment
(Crosatti et al., 1999 ). Furthermore, the expression of
all three genes was impaired in the barley albino mutant
an, suggesting the involvement of a
chloroplast factor in the activation of these cor genes
(Grossi et al., 1998 ; Baldi et al., 1999 ;
Crosatti et al., 1999 ).
In this work, we report on the expression of cor genes in a
series of barley mutants altered either on chloroplast development or
photosynthetic activity. By using albino and
xantha mutants, we show that the cold-dependent accumulation
of cor14b, tmc-ap3, and
blt14 mRNAs depends on plastid developmental stage. This
effect reveals a chloroplast control on mRNA level. The study of
mutants blocked on photosynthetic electron transport revealed a further step of regulation: The amount of COR14b gene product was enhanced by
conditions leading to oxidized plastoquinone without influencing mRNA level.
 |
RESULTS |
Plastid Control on the Expression of Low Temperature-Specific
cor Genes
A differential display reverse transcriptase-PCR experiment was
initially carried out to compare the mRNA profile of green plants grown
at 20°C with those of green and albino plants exposed at
3°C. This search yielded two fragments whose expression, although dependent on cold treatment, was equally induced in wild-type and
albino plants, implying that their expression was
independent from the chloroplast. The first DNA fragment corresponded
to the dehydrin 8 (dhn8) sequence (Zhu et al.,
2000 ), whereas the second one, still unknown when originally
discovered, was used for the isolation of a full-length sequence by
screening a cDNA library. The full-length cDNA was 672 bp long and
contained a single open reading frame of 164 amino acids (18 kD). This
gene has been named cor18. The expression of dhn8
and cor18 was used to tag the chloroplast-independent cold
signal transduction pathway. Accumulation of dhn8 and
cor18 mRNAs was never affected by the mutation at the
an locus during either cold or dehydration
stress (Fig. 1, A and B). In both green and albino leaves, the cold-induction kinetic of
cor18 mRNA is characterized by a fast and transient
induction during the first 7 h, followed by a permanent induction
after 1 d. The expression pattern of cor18 and
dhn8 was then compared with that of three barley genes,
cor14b, tmc-ap3, and blt14,
previously suggested to be dependent on chloroplast function because
their expression was impaired in albino plants
(Grossi et al., 1998 ; Baldi et al., 1999 ;
Crosatti et al., 1999 ). In wild-type barley, cold
treatment in the presence of light induces the appearance of
cor14b, tmc-ap3, and blt14
transcripts, which is sustained during the treatment. On the contrary,
plants homozygous for the an gene, which
blocks the chloroplast development at a very early stage, show strong changes in the expression profile of the same genes. Albino
an plants had a minimal induction of
cor14b after 1 and 3 d, whereas longer exposure to low
temperature led to full repression of this gene. The expression of
tmc-ap3 in the leaves of the mutant exposed to
cold was similar to that of cor14b, except for the presence of a basal mRNA level. The expression of blt14-related mRNAs
was reduced and delayed (Fig. 1A).

View larger version (31K):
[in this window]
[in a new window]
|
Figure 1.
mRNA expression analysis of the
cold-regulated genes cor14b, tmc-ap3, blt14, dhn8, and cor18 in green
leaves of barley and in albino plants carrying the mutation
an. The same filter, loaded with 0.5 µg of
poly(A) RNA, was subsequently hybridized with all probes. Equal loading
was assessed through hybridization with the barley gene coding for the
ribosomal protein 12 of the large subunit (RPL12). A, Expression at low
temperature. Lanes 1 through 8, Green plants (winter barley cv Nure)
grown at 20°C/16°C (lane 1) and then hardened at 3°C/1°C from
7 h until d 15 (lanes 2-8). Lanes 9 through 16, albino
plants carrying the mutation an grown at
20°C/16°C (lane 9) and then hardened at 3°C/1°C from 7 h
until d 15 (lanes 10-16). B, Expression during dehydration. Lanes 1 through 3, Green plants (winter barley cv Nure) during the dehydration
from fully watered (control) until 7% water loss. Lanes 4 through 7, albino plants carrying the mutation
an during the dehydration from fully
watered (control) until 7% water loss.
|
|
When the expression of the cor genes was analyzed in both
albino and wild-type dehydrated plants, cor18 and
dhn8 responded to dehydration by increasing their mRNA
level, whereas cor14b, tmc-ap3 and
blt14 did not (Fig. 1B). On the basis of these results, we
suggest that chloroplast activity exhibits control on cor
gene expression only on sequences specifically induced by low
temperature. In fact, none of the sequences whose cold-induced
expression was impaired in the albino plants was also
expressed during the dehydration response (Fig. 1B). In the following,
we present a detailed analysis of the effects of mutations affecting
the chloroplast development on cor gene expression.
Plastid Developmental Transition to Primary Thylakoid State Is
Required for the Accumulation of Low Temperature-Specific
cor mRNAs
The expression of cor14b,
tmc-ap3, and blt14 was followed in a
collection of albino and xantha mutants of barley
previously characterized at biochemical and ultrastructural level
(Henningsen et al., 1993 ). A simplified plastid
development pathway showing the steps affected by the different
xantha and albino mutants of barley used in this
work (alb-e16, alb-f17,
xan-u21, xan-s46, xan-g45, xan-l35, and
xan-b12) is presented in Figure
2A. The mutants are ordered according to
the affected step in chloroplast biogenesis. Genotypes e16
and an are characterized by the absence of
pigments and of primary lamellae. The b12 genotype contains about 50% of chlorophyll and small grana discs. Genotypes
alb-f17, xan-u21,
xan-s46, xan-g45, and
xan-l35 are intermediate between e16
and b12, each representing a distinct step of increasing
development (Henningsen et al., 1993 ). The accumulation
of cor14b, blt14, and
tmc-ap3 mRNAs was evaluated in mutant seedlings
as compared with the corresponding wild type after 8 d of cold
treatment (Fig. 2B). A clear step enhancement in the accumulation of
cor14b and blt14 transcripts upon cold plus light
treatment was associated with the transition between xantha
mutants f-17 and s-46.
Accumulation of tmc-ap3 was partially induced in
the xantha mutant f-17 although the
full expression of the gene was obtained with the xantha
mutant s-46. Taken together, these results
suggest that a common, chloroplast mediated, mechanism is involved in
the cold-dependent accumulation of cor14b, blt14,
and tmc-ap3 mRNAs. This machinery is associated with the development of primary thylakoid membranes.

View larger version (31K):
[in this window]
[in a new window]
|
Figure 2.
Cold-dependent expression of cor14b, tmc-ap3, and
blt14 in a collection of barley albino and xantha mutants. A,
Simplified plastid development pathway showing the steps affected by
the different xantha and albino mutants of barley
used in this work (alb-e16,
alb-f17, xan-u21,
xan-s46, xan-g45,
xan-l35, and xan-b12).
Modified from Henningsen et al. (1993) . B, Accumulation
of cor14b, tmc-ap3, and blt14 mRNA in the mutants after 8 d at
3°C/1°C. The filter was loaded with 0.5 µg of poly(A) RNA. Lanes
1 and 2, Green plants (winter barley cv Nure) grown at 20°C/16°C or
hardened at 3°C/1°C. Lanes 3 and 4, albino plants
carrying the mutation an and the
corresponding wild type (wt) grown at 20°C/16°C. Lanes 5 through
20, albino and xantha mutants hardened at
3°C/1°C evaluated in comparison with the corresponding wild type
(wt). Equal loading was assessed through hybridization with the barley
gene coding for the ribosomal protein 12 of the large subunit (RPL12).
C, Accumulation of the protein COR14b in the mutants after 8 d at
3°C/1°C. Samples as in B. Top panels, The loading standard
represented by a polypeptide of 29 kD recognized by the COR14b
polyclonal antibody whose expression was not affected by either cold or
plastid development.
|
|
An immunoblot experiment was performed on the same mutant
collection to follow COR14b protein accumulation (Fig. 2C). After 8 d of exposure to low temperatures, mutants blocked in the early stages of the chloroplast biogenesis, at earlier steps than formation of primary thylakoid membranes (up to mutant
f-17), accumulated only traces of COR14b.
Nevertheless, the polypeptide identified by the antibody in these
samples showed the same apparent Mr in SDS-PAGE as the mature form of COR14b in wild-type plants, suggesting that the protein was correctly processed and imported into the plastids. The mutation at s-46 or later steps,
showing plastids with primary thylakoid membranes
(xantha-s46, -g45, -l35,
and -b12), showed a level of COR14b at least equal to that
of the corresponding wild type. Therefore the enhancement in COR14b
accumulation matches the parallel enhancement in mRNA expression.
A selection of mutants unable (albino
an and -e16) and able
(xantha-s46, -l35, and
-b12) to fully accumulate cor14b,
tmc-ap3, and blt14 mRNAs were
acclimated for 21 d and then tested for their frost tolerance in
comparison with wild-type green and etiolated plants (Fig.
3). All mutants were heavily damaged even
when frozen at 6°C, suggesting that the accumulation of the
chloroplast-dependent cor mRNAs per se is not sufficient to
confer frost tolerance. Etiolated plants showed a level of frost
resistance intermediate between those of green and
albino/xantha mutants, as previously reported
(Grossi et al., 1998 ).

View larger version (22K):
[in this window]
[in a new window]
|
Figure 3.
Frost resistance, measured as relative membrane
injury, of several albino and xantha barley
mutants in comparison with the corresponding wild types (WT) after
21 d of cold acclimation. Nonacclimated (N/A) and cold-acclimated
(A) samples of green and etiolated plants from the winter barley cv
Nure were also included. Plants have been frozen at 6°C (black
bars) or at 8°C (white bars).
LSD0.05 = 7.8.
|
|
Chlorophyll Precursors Levels Are Not Affected by Chloroplast
Development Mutations
Previous work has suggested that nuclear gene expression might be
controlled by the levels of the chlorophyll precursor protoporphyrin IX
(Lermontova and Grimm, 2000 ). To verify whether the
differences in cor14b accumulation among albino
and xantha mutants could be correlated with protoporphyrin
IX levels, we have determined protoporphyrin IX levels in xantha
f17 and xantha-s46 before and after cold
stress treatment by using the method of Lermontova and Grimm
(2000) . Protoporphyrin IX content of leaves was the same within
10% range.
The Promoter of cor14b Is Equally Active in Albino and
Wild-Type Leaves
Differential mRNA accumulation could either be due to
transcriptional or posttranscriptional regulation. Dunn et al.
(1994) and Phillips et al. (1997) have
previously shown that the accumulation of blt14
mRNAs is due to increase mRNA stability at low temperature rather than to gene induction. To clarify this point, we studied the
expression of a chimeric synthetic gene carrying the uidA coding region under the control of the cor14 promoter
sequence in leaves of green and albino plants.
A genomic clone, cor14b-G1, corresponding to the
cor14b cDNA was isolated and characterized. The structure of
cor14b-G1 was determined by comparing its
sequence with that of the corresponding cDNA. Determination of the
transcription start point was performed by a primer extension
experiment. Cor14b-G1 contains 643 bp upstream to
the transcription start point, 101 nucleotides (nts) of 5'-untranslated region (UTR), and a single intron between position +312 (nts from the
transcription start point) and position +466. The region upstream the
transcription start point shows a typical TATA-box (central position
32). To determine which region of the cor14b promoter contributes to the regulation of gene expression, a deletion series of
five chimeric reporter constructs, with varying lengths of promoter
fused to the -glucuronidase (GUS) reported gene, were initially
analyzed by transient expression in green leaves of the winter barley
cv Nure. Leaves grown at control temperature were bombarded with gold
particle coated with one of the construct and then transferred to
either 25°C or 2°C before assaying GUS expression by histochemical
staining. Average data from five experiments normalized using the rice
(Oryza sativa) ubiquitin promoter-uidA construct
as external standard are presented in Figure
4. All constructs showed very low, if
any, activity at 25°C and a clear cold induction at 2°C. GUS
activity at low temperature was not significantly different between
constructs B ( 349) and C ( 274) and between constructs D ( 247) and
E ( 156). The activity of B and C was significantly higher than that
of A ( 643), whereas the activity of D and E was significantly lower
than that of A, B, and C. Taken together, these data indicate that the
region between nts 274 and 247 (AGCTTACCCAAAGGTACGTGAGGTCGG)
contains sequences necessary for the low
temperature-dependent expression of cor14b. The
274/ 247 region notably contains the ACGT element, a cis-acting
motif recognized by basic Leu zipper proteins (Foster et al.,
1994 ). The reduced level of expression of constructs A, with
respect to construct B, indicates the presence of a negative regulatory
element between nts 643 and 349. The activity of the constructs A,
C, and D in leaves of plants carrying the mutation at the
an locus was similar to activity in wild
type. The activity of the 643-bp promoter fragment of cor14b
was, therefore, not affected by the albino mutation
affecting chloroplast development. Although the cor14b mRNA
steady-state level in the albino leaves is less than 5%
with respect to wild type, these plants are able to correctly activate
the responsive elements present in the cor14b promoter
fragment, thus suggesting that the chloroplast control on
cor14b expression does not act at the transcriptional
level.

View larger version (16K):
[in this window]
[in a new window]
|
Figure 4.
Transient reporter gene expression analysis of the
cor14b promoter sequences in leaves of green and albino plants. Five
promoter/GUS constructs (A-E, size in nts from the transcription start
point indicated) were generated as described in "Materials and
Methods" and delivered to barley leaf explants through particle
bombardment. Transient reporter gene expression in winter barley cv
Nure, albino an plants and corresponding
wild-type leaf explants. Expression (blue cell cluster count per
experiment) is shown as mean value of five experiments ± SE. In each experiment, about 12 cm2 of leaf explants were exposed to particle
bombardment.
|
|
Effects of the Chloroplast Redox State on cor14b
Expression
The redox state of the electron transport chain components is
known to affect gene expression (Escoubas et al., 1995 ;
Pfannschmidt et al., 1999 , 2001 ). Two
barley viridis mutants in which the synthesis of either
photosystem I (PSI; zb63; Skovgaard Nilsen et al.,
1996 ) or PSII (vir-115; Gamble and
Mullet, 1989 ) components was impaired thus leading to either reduction
or oxidation of the plastoquinone pool was analyzed by northern
blotting with a cor14b probe (Fig. 5A). It is shown that cor14b
mRNA accumulated to the same level in wild-type and mutant genotypes
upon cold treatment, regardless of the presence of a mutation affecting
the electron transport chain. These results imply that the changes in
the redox state of the electron transport chain components caused by
viridis mutations do not affect the steady-state mRNA level
of cor14b.

View larger version (23K):
[in this window]
[in a new window]
|
Figure 5.
Cold-dependent accumulation of cor14b in barley
viridis mutants. A, Accumulation of cor14b mRNA in the mutants after
8 d at 3°C/1°C. The filter was loaded with 0.5 µg of poly(A)
RNA. Lanes 1 through 5, mRNA isolated from winter barley Nure, two
viridis mutants and in the corresponding wild type grown at
20°C/16°C. Lanes 6 through 10, mRNA isolated from winter barley
Nure, two viridis mutants and in the corresponding wild type
hardened 8 d at 3°C/1°C. Equal loading was assessed through
hybridization with the barley gene coding for the ribosomal protein 12 of the large subunit (RPL12). B, Accumulation of the protein COR14b in
the mutants after 8 d at 3°C/1°C. Sample as in A. Top panels,
The loading standard represented by a polypeptide of 29 kD recognized
by the COR14b polyclonal antibody whose expression was not affected by
either cold or plastid development. C, Effects of DCMU and DBMIB
treatment on the accumulation of cor14b mRNA in the barley viridis
mutants vir-zb63 after 8 d of hardening. Lanes 1 and 2, Control
and hardened wild-type plants. Lanes 3 and 4, Wild-type and mutated
zb63 plants hardened in presence of 50 µM DCMU. Lanes 5 and 6, Wild-type and mutated
zb63 plants hardened in presence of 30 µM DBMIB. Equal loading was assessed through
hybridization with the barley gene coding for the ribosomal protein 12 of the large subunit (RPL12). D, Effects of DCMU and DBMIB treatment on
the accumulation of COR14b protein in the barley viridis mutants
vir-zb63 after 8 d of hardening. Samples as in C. Top panels, The
loading standard represented by a polypeptide of 29 kD recognized by
the COR14b polyclonal antibody whose expression was not affected by
either cold or plastid development.
|
|
The same viridis mutants were used to evaluate of the
effects of the redox state of electron transport components on COR14b. COR14b antibody reaction (Fig. 5B) showed that the protein is absent in
wild-type and mutant plants grown at 20°C, whereas after 8 d of
cold acclimation, COR14b accumulated to the same extent in
vir-zb63 (a mutant devoid of PSI activity and
therefore having plastoquinone and cytochrome [cyt]
b6/f complex in the reduced form) and in the corresponding wild type. A slight, but reproducible increase in COR14b protein accumulation was obtained in the
vir-115 mutant with defective PSII and therefore
characterized by oxidized electron transport chain components. These
results prompt us to the verify whether variation in the redox
state could affect the accumulation of COR14b. Because the
viridis mutant vir-zb63 exhibits only
2% of the wild-type electron transport rate (Skovgaard et al.,
1996 ), this genotype could represent a suitable tool to magnify any effects of chemical inhibitors of the electron transport chain. Wild-type and vir-zb63 plants were germinated and
cold acclimated for 8 d in presence of 50 µM
3-(3',4'-dichlorophenyl)-1,1-dimethylurea (DCMU) or 30 µM
2,5-dibromo-3-methyl-6-isopropyl-p-benzoquinone (DBMIB). None of these treatments altered the steady-state level of
cor14b mRNA (Fig. 5C). No effects were detected also at
protein level after the DBMIB treatment, an inhibitor that promotes the reduction of plastoquinone (a condition already present in
vir-zb63 plants as consequence of the mutation)
and the oxidation of cyt b6/f.
On the contrary, application of DCMU, leading to oxidized plastoquinone, promotes COR14b overaccumulation in the mutant (Fig.
5D). DCMU treatment in wild-type plants did not lead to an increase of
COR14b amount, suggesting that the non-physiological condition of the
chloroplast of viridis mutants is required to magnify the
effects of the chemical inhibitors.
 |
DISCUSSION |
Mutation analysis is a major tool for dissection of the molecular
mechanisms of biological processes. In this work, we used barley
mutants to clarify the regulatory mechanisms controlling the expression
of several cor genes. Barley genetic stocks offer a unique
collection of chloroplast-deficient mutants, most of them characterized
at genetic and biochemical levels; although these mutations are
generally lethal, the large endosperm of barley seeds support plant
growth for several weeks allowing the molecular analysis of the
mutants. We have previously shown that plants carrying a mutation
preventing chloroplast development, besides the expected
albino phenotype, are also impaired in the expression of
several cor genes (Grossi et al., 1998 ;
Baldi et al., 1999 ; Crosatti et al.,
1999 ). In the present study, a detailed analysis of
cor gene expression in albino, xantha,
and viridis barley mutants leads to the identification of
several chloroplast-dependent mechanisms involved in the accumulation
of cor mRNAs and proteins.
First, the analysis of the expression of drought- and/or cold-regulated
genes in albino barley plants demonstrates that different regulatory mechanisms are involved in the control of the low
temperature response with respect to the drought response. In fact,
whereas the expression of three unrelated cor genes
(cor14b, tmc-ap3, and
blt14) was severely inhibited in albino plants, the cold- and drought-dependent induction of dhn-like and of
cor18 sequences in the same genotype was normal, showing
that the corresponding signal transduction pathway is not affected by
chloroplast developmental state or photosynthetic activity. In
Arabidopsis, most cold-regulated genes respond to dehydration and,
conversely, most dehydration-induced genes also respond to cold stress,
suggesting that a common set of genes, although controlled by two
independent pathways, is responsible for both drought and cold
tolerance (for review, see Shinozaki and Yamaguchi-Shinozaki,
2000 ). In barley, at least three cor genes expressed
only upon exposure to low temperature (cor14b,
tmc-ap3, and blt14) are under the
control of a signal transduction pathway involving a chloroplast
component. This pathway acts independently from the pathway controlling
the expression of cold/drought-inducible genes.
The analysis of the chloroplast developmental mutant collection
suggests that a step in chloroplast development, associated to the
formation of the primary thylakoid membranes (corresponding to
condition of the xantha mutant s-46),
confers the ability of correctly expressing cor14b,
tmc-ap3, and blt14. Inability to accumulate the mRNAs of these genes has only been found in some albino and xantha mutants and it is not
reproducible in etiolated leaves. The induction of cor14b
was only partially reduced in etiolated seedlings (Crosatti et
al., 1999 ), whereas the expression of
tmc-ap3 and blt14 was respectively
unaffected and enhanced by etiolated conditions (Grossi et al.,
1998 ; Baldi et al., 1999 ).
The plastid signals may act either by enhancing transcription or by
increasing the mRNA stability. Plastid-dependent regulation of nuclear
genes has been previously described. In Chlamydomonas reinhardtii, the chlorophyll precursors act as intermediates in the light-regulated signaling pathway controlling the transcription rate of the nuclear heat shock genes hsp70a (cytosolic) and
hsp70b (chloroplastic; Kropat et al., 1997 ).
Light regulation of Fed-1 (chloroplastic
ferredoxin) mRNA abundance in leaves of green plants is
posttranscriptionally regulated. Fed-1 mRNAs are
stable when associated to ribosomes in illuminated leaves, but in
darkness ribosomes release the Fed-1 mRNAs, and
the transcripts are degraded by a process involving a CATT element in
5'-UTR of the mRNA (Dickey et al., 1998 ). In barley, it
has been demonstrated that both transcriptional ad posttranscriptional
mechanisms are involved in regulation of low temperature-responsive
genes (Dunn et al., 1994 ). It has been reported that the
low-temperature accumulation of blt14 transcripts results
from an increased mRNA stability due a low temperature-dependent protein factors (Phillips et al., 1997 ). On the other
hand, our results show that expression of cor14b involves an
increased gene expression in response to cold, and a 27-bp region
encompassing a boundary of some element that contributes to
cold-induced expression was identified in the cor14b
promoter. Therefore when the cold-dependent accumulation of
blt14 and cor14b transcripts is investigated in wild-type plants, the genes reveal two different regulatory mechanisms: The transcription of blt14 is constitutive and the mRNA
accumulation is due to a posttranscriptional process (Dunn et
al., 1994 ; Phillips et al., 1997 ), whereas
accumulation of cor14b transcripts is primarily due to
cold-induced gene transcription. Nevertheless, when blt14 and cor14b expression was assayed in the collection of
chloroplast development mutants, the same dependence on chloroplast
development was observed. Because the cor14b promoter was
equally active in transient expression experiments using both green and
albino an leaf explants, we suggest that a
posttranscriptional regulation depending on a chloroplast-deriving
factor may be also involved in the accumulation of the cor
transcripts examined in this work. Thus a two-step control could be
hypothesized to be active in the regulation of cor14b mRNA
level: A cold-dependent transcription effect might allow for mRNA
synthesis, whereas synthesis of the COR14b protein and its accumulation
at its chloroplast site are further controlled by light though a
functional chloroplast. Such a control mechanism would be consistent
with a possible function of COR14b in photoprotection/repair of
light-induced photoinhibition, which is enhanced by cold stress
(Bergantino et al., 1995 ; Huner et al.,
1996 ). We have, at present, no data for suggesting which is the
molecular identity of the chloroplast signal exiting the chloroplast.
Previous works have suggested that protoporphyrin IX may act as a
possible diffusing compound reaching the cytoplasm through an
envelope-localized ABC transporter (Kropat et al., 1997 ;
Moller et al., 2001 ). However, we did not observe
changes in protoporphyrin IX levels in barley mutants impaired in
chloroplast-dependent cor gene expression.
Chloroplast control on cor mRNA accumulation affects nuclear
genes encoding chloroplast-localized proteins (i.e. cor14b
and tmc-ap3); although evidence suggests that the
cold-dependent expression of several genes encoding non-chloroplast
proteins may also be chloroplast regulated. In fact, the
blt14 gene family encodes proteins that are predicted to be
secreted (Phillips et al., 1997 ). This is consistent
with the recent report that the cold-dependent up-regulation of the
elongation factor 1B and of the ribosomal protein S7 and L7A
transcripts is controlled by a chloroplast-related pathway impaired in
albino mutants (Baldi et al., 2001 ). It can be hypothesized that cor genes whose expression is
controlled by a chloroplast factor are coordinately expressed in
different cell compartments to prevent/repair light-induced damages
from the oxidative stress deriving from the operation of the
photosynthesis at low temperature. Analysis of the biochemical function
of individual cor genes is required to confirm this hypothesis.
A distinct mechanism was disclosed through the analysis of barley
viridis mutants, controlling the level of COR14b protein on
the basis of redox state of the photosynthetic electron transport chain
components. Chloroplast redox state is known to influence gene
expression at different levels. The transcription rate of the nuclear
genes coding for the light-harvesting complex II (Lhc; Escoubas et al., 1995 ) and for PSI subunits
(PsaD and PsaF; Pfannschmidt et al.,
2001 ) as well as of the chloroplast genes encoding the reaction center apoproteins of PSI and PSII (Pfannschmidt et
al., 1999 ) is controlled by the redox state of the
plastoquinone. A posttranscriptional redox state-dependent regulation
has been shown for the chloroplast gene petB encoding the
cyt b6 protein (Tullberg et al.,
2000 ). Changes in the environmental conditions affect the redox
state of the chloroplast, whereas exposure to low temperature under
light conditions leads to an over-reduction state of the PSII
(Gray et al., 1996 , 1998 ). It is
therefore not surprising that a number of stress-responsive mechanisms
are controlled by the chloroplast redox state. In the case of COR14b,
the effect of the chloroplast redox state does not influence the
steady-state transcript level but does affect protein accumulation.
This effect might thus be due to either a control of the protein
degradation rate or changes on mRNA translational efficiency. The
amount of COR14b protein was slightly enhanced in the
viridis-115 mutant characterized by oxidized
electron transport chain components. Treatments with electron transport
chain inhibitors (DCMU and DBMIB) at low temperature suggest that, at
least in the vir-zb63 chloroplast (a mutant
exhibiting only 2% of the wild-type electron transport rate;
Skovgaard Nilsen et al., 1996 ), oxidized plastoquinone promotes COR14b overaccumulation. These results, although obtained in
plant with non-physiological chloroplast conditions, suggest a possible
molecular relationship between plastoquinone and COR14b. Photoinhibition deriving for light plus cold conditions is mediated by
plastoquinone over-reduction (Gray et al., 1996 ,
1998 ; Huner et al., 1996 ) thus apparently
contrasting with the increased cor14b levels observed in
condition of oxidized plastoquinone. The biochemical function of
cor14b in the chloroplast stroma compartment is still unknown: We suggest that it might be involved in a detoxification mechanism involving its own degradation to explain the reverse relationship with photoinhibitory conditions.
Taken together, the experimental data describing the expression of
cor14b depict a multiple-level regulation system where different environmental cues and chloroplast factors act together to
fine tune the amount of COR14b protein into the chloroplast.
 |
MATERIALS AND METHODS |
Genetic Materials, Growth Conditions, and Freezing Test
The analyses were performed using winter barley (Hordeum
vulgare cv Nure) and a collection of albino,
xantha, and viridis mutants. The
albino mutants alb-e16 and
alb-f17 and the xantha mutants xan-u21,
xan-s46,
xan-g45,
xan-l35, and
xan-b12 were described by
Henningsen et al. (1993) and located in the chloroplast
biogenesis pathway as reported in Figure 2A. The albino
mutant an was reported by
Burnham et al. (1971) and also in our previous work
(Crosatti et al., 1999 ). The viridis
mutants vir-zb63, a PSI-type mutant with
the electron transport components in a reduced state, and
vir-115, a PSII-type mutant with electron
transport components in a oxidized state, were previously characterized (Gamble and Mullet, 1989 ; Skovgaard Nilsen et
al., 1996 ). All mutants, but albino
an, were obtained after chemical mutagenesis,
in the genetic background of barley cv Bonus (Simpson and von
Wettstein, 1991 ). Albino an is
a spontaneous mutation found in Hordeum
distichum nigrinudum (Burnham et al., 1971 ). Mutants were maintained as heterozygous, and after
germination, a 3:1 segregation was observed. Because mutagenized
genotypes can carry an unpredictable number of mutations besides that
responsible for chloroplast phenotype, green plants segregating from
each of the genetic stock containing the mutation were used as the most
appropriate wild type for each mutant.
Hardening experiments were performed on barley plants grown for 7 d in peat at 20°C/16°C, 9 h of light (200 µmol
m 2 s 1)/15 h of dark. Plants were then
hardened for different times from 7 h to 15 d at 3°C/1°C,
9 h of light (200 µmol m 2 s 1)/15 h
of dark.
Plants were also treated with chemical inhibitors of the electron
transport chain: 30 µM DBMIB and 50 µM
DCMU. DBMIB binds the cyt
b6/f complex, preventing the
electron transfer from plastoquinone, so that it is constitutively
reduced (Schoepp et al., 1999 ). DCMU binds the D1
protein of PSII at the binding site of the quinone B, preventing
electron transfer to plastoquinone leading to oxidation of the electron
transport chain components downstream (Zer and Itzhak,
1995 ).
Barley seeds sterilized with 4% (w/v) sodium hypochlorite grown
on filter paper (20°C/16°C, 9 h of light/15 h of dark) were used for dehydration experiments. Fully expanded first leaves were cut
and air desiccated after Grossi et al. (1995) . The
progress of drought stress was followed measuring water loss.
The frost resistance of some chloroplast developmental mutants was
tested in comparison with green and etiolated plants after 21 d of
cold-acclimation, measuring the relative membrane injury through the
rate increase in ion release according to Rizza et al.
(1994) . Cold-acclimated plants were stored at 3°C for
16 h and then subjected to a gradual 2°C h 1
lowering of the temperature down to 6°C or 8°C; the plants were
kept in these conditions for 18 h in the dark. After gradual thawing, a sample of 35 leaf segments of about 0.5 cm for each replication (four replications in total) were placed in a vial containing 25 mL of de-ionized water, degassed under vacuum for 20 min,
and stirred at 25°C for 2 h and 30 min. Ion release was measured
by a digital conductivity meter, and membrane damage was determined as
the percentage of maximum possible injury induced by autoclaving of
samples. Data were subjected to ANOVA.
Gene Isolation and Northern Analysis
The cor18 gene and a sequence identical to
published dhn8 gene (Zhu et al., 2000 )
were isolated by differential display comparing the mRNAs isolated from
leaves of green plants grown at 20°C/16°C (control) with those
isolated from leaves of either green or albino cold-treated (3 d at 3°C) plants. Differential display reverse transcriptase-PCR was performed as described by Baldi et al.
(1999) . Cor18 full-length clone (accession no.
AJ291295) was isolated from a custom Uni-Zap XR cDNA library
(Stratagene, La Jolla, CA). All other clones used in this work
blt14, cor14b, and
tmc-ap3, were previously described
(Grossi et al., 1998 ; Baldi et al., 1999 ;
Crosatti et al., 1999 ). blt14 represents
a cold-regulated gene family; in the present work, expression analysis
of blt14-corresponding mRNAs was assessed using the ao86
cDNA as probe. Under the condition used in the present work, the signal
detected by this probe summarizes the expression of all gene families
(Grossi et al., 1998 ).
Poly(A) RNAs were isolated from frozen leaves, ground in liquid
nitrogen, and suspended in 0.05 M Tris, 0.01 M
EDTA, 0.1 M NaCl, and 2% (w/v) SDS. After
phenol-chloroform extractions, the poly(A) RNAs were isolated by
chromatography on oligo(dT)-cellulose (Roche Diagnostics, Mannheim,
Germany) according to published methods (Sambrook et al.,
1989 ). Equal amounts of poly(A) RNAs for each sample (usually
0.2-0.5 µg) were separated on an agarose formaldehyde gel and were
transferred to a positively charged nylon filter (Hybond
N+, Amersham Biosciences AB, Uppsala). Radioactive probes
were obtained by oligolabeling of cDNA clones, and the hybridization
was performed at 65°C in 6× SSC, 2× Denhardt's solution
(Sambrook et al., 1989 ), 0.1% (w/v) SDS, and
100 g mL 1 denatured herring sperm DNA. Filters were
then washed at 65°C with 0.5 × SSC and 0.1% (w/v) SDS.
For each northern experiment, a single filter was produced and
subsequently hybridized with all the probes required. DNA probes were
removed from filters by washing them in 0.5% (w/v) SDS at 100°C. To
control the amount of poly(A) RNA loaded in each lane, the filters were
hybridized with a barley cDNA probe coding for the protein 12 of the
ribosomal large subunit (RPL12) whose expression was proven to be
unaffected by low temperature (Baldi et al.,
2001 ).
Isolation of the Genomic Clone and Promoter Analysis
A genomic library of the barley cv Aurea was constructed in the
-vector EMBL4 and screened using the cor14b cDNA as
probe. The cor14b genomic clone was purified to
homogeneity with a subsequent round of screening and designed
cor14b-G1. A 1.4-kb
BglII-BglII fragment (accession no.
AJ512944) was subcloned in pBluescipt II KS and sequenced in both
directions using Big Dye Terminator Cycle Sequencing Kit and ABI 310 capillary sequencer (Applied Biosystems, Foster City, CA) following the
instruction manuals. The transcription start point was determined with
a primer extension experiment performed according to Sambrook et
al. (1989) using a 20-mer primer (5'-AGGGAGCTGAATCTATCAGT-3')
corresponding to position 59 to 40 of the cor14b cDNA
clone. Chimeric genes were constructed using a pUC19 vector containing
the uidA (GUS) gene together with nopaline synthase
(nos) gene 3'-non-coding region obtained as
EcoRI-HindIII fragment from pBI101.3
(Jefferson et al., 1987 ). Five
cor14b-G1 fragments containing 643, 349, 274, 247, and 156 bp upstream the transcription start point and 49 bp
of the 5'-UTR were cloned in the
pUC19-uidA-nos vector
using either existing or PCR-generated restriction sites. Identity of all constructs was confirmed by DNA sequence.
Activity of cor14b promoter-uidA
constructs after microprojectile bombardment was assayed on leaf
segments dissected from the winter barley cv Nure from albino plants
an and from the corresponding wild
type. Seeds were surface sterilized with household bleach for 35 min,
rinsed well with de-ionized water, planted on 1% (w/v) agar,
and grown for 6 d (until the first true leaf appeared) at
25°C/20°C in 12 h of light (100 µmol m 2
s 1)/12 h of dark.
Microprojectile bombardment was performed using the Biolistic Particle
Delivery System PDS1000/He (Bio-Rad, Hercules, CA; Lemaux et
al., 1996 ). Barley leaf explants (2 cm long) were dissected from control tissue and placed on Murashige and Skoog medium containing 3% (w/v) maltose and 0.4% (w/v) Phytagel in 90-mm-diameter petri dishes. Four leaf explants were arranged in the center of each dish.
Microcarriers gold (1 µm diameter) were prepared according to
Lemaux et al. (1996) ; 35 µL of resuspended
microcarrier (60 mg mL 1 ethanol) was mixed with 25 µL
of plasmid DNA (1 µg µL 1), 250 µL of 2.5 M CaCl2, and 50 µL of 0.1 M
spermidine. The microcarrier-DNA mixture was vortexed for 1 h and
spun for 5 min in a microfuge. The supernatant was then removed, and
gold particles were resuspended in 600 µL of ethanol, briefly
vortexed, and spun again. The microcarriers were finally resuspended in
36 µL of ethanol and three 12-µL aliquots were load onto
macrocarriers and delivered to barley leaves for each construct in each
experiment. A petri dish containing the plant tissue was placed 6 cm
below the microcarrier launch assembly, and the particles were fired
using 900-psi rupture discs (Bio-Rad) with a partial vacuum of 28 mm Hg.
After bombardment, petri dishes were incubated for 48 h either at
+2°C or at 25°C. Histochemical detection of GUS activity was
performed using 5-bromo-4-chloro-3-indoyl glucuronide (Inalco, Milano)
as described by Jefferson et al. (1987) .
UidA expression was scored by counting blue spots under
a dissection microscope. Each experiment was repeated five times, and
values were normalized using the rice (Oryza sativa)
ubiquitin promoter fused to uidA as a biolistic control
in parallel bombardment. This control was used in preference to
internal standard according to Dunn et al. (1998) and
Brown et al. (2001) , to avoid differences in expression that may arise by differential posttranscription processing of different transcripts at low temperatures.
Protein Extraction and Western Analysis
Protein extraction and western analysis was as previously
described (Crosatti et al., 1999 ). Barley leaves were
ground to a fine powder in liquid nitrogen. The powder was washed
several times with acetone containing 0.07% (v/v)
-mercaptoethanol and dried completely under a vacuum. Five
milligrams of dried powder was solubilized using 280 µL of loading
buffer (4% [w/v] SDS, 12% [w/v] glycerol, 50 mM Tris,
pH 6.8, 2% [v/v] -mercaptoethanol, and 0.01% [w/v] bromphenol
blue), Twenty microliters of supernatant was loaded onto a 10%
(w/v) Tricine-SDS-PAGE gel overlaid with a 4% (w/v) stacking
gel, according to the method of Schagger and von Jagow
(1987) . Proteins were electroblotted onto a nitrocellulose membrane (BA83, Schleicher & Schuell, Dassel, Germany) according to the
method of Szewczyk and Kozloff (1985) and probed with
the COR14 polyclonal antibody. The preparation of the antibody was previously described (Crosatti et al., 1995 ).
Western blotting was performed after Crosatti et al.
(1999) with enhanced chemiluminescence kits (ECL, Amersham
Biosciences AB), and the working dilution of the antibody was 1:3,500.
In addition to the COR14 proteins, the COR14 polyclonal antibody cross-reacted with an additional polypeptide of about 29 kD, the expression of which was not affected by either cold or chloroplast development. This anonymous protein was used as a loading control for
all western experiments. In all analyses, filters were exposed to Kodak
X-Omat film (Eastman Kodak, Rochester, NY) for a few minutes.
Densitometric scanning of films after antibody exposure was performed
with Molecular Analyst software (v1.5, Bio-Rad).
Protoporphyrin IX Determination
Protoporphyrin IX determination was performed by HPLC
analysis of the methanol-acetone leaf extract according to
Lermontova and Grimm (2000) . Peak identification was
carried on using absorption spectra detected on-line by a diode array
Beckman 168 unit connected to a System Gold HPLC system. Separation was
performed on a reversed-phase C-18 column ODS-1.
 |
ACKNOWLEDGMENTS |
We acknowledge Dr. Antonella Portesi (Istituto Sperimentale per
la Cerealicoltura, Fiorenzuela, Italy) for her helpful collaboration during the isolation of the genomic clone. Tomas Morosinotto
(Universita Di Verona, Italy) is thanked for performing Protoporphyrin
IX determination. We thank Prof. Diter von Wettstein (Washington State University, Pullman) and Dr. David Simpson (Carlsberg Research Laboratory, Copenhagen) for the kind gift of barley mutants.
 |
FOOTNOTES |
Received September 12, 2002; returned for revision October 17, 2002; accepted November 5, 2002.
1
This work was supported by Consiglio
Nazionale delle Ricerche Agenzia 2000 and Ministero dell'Istruzione
dell'Universitá e della Ricerca Progetto Fondo Investimenti
Ricerca di Base (no. RBAU01E3CX).
2
These authors contributed equally to the paper.
*
Corresponding author; e-mail l.cattivelli{at}iol.it; fax
39-0523-983750.
Article, publication date, and citation information can be found at
www.plantphysiol.org/cgi/doi/10.1104/pp.014530.
 |
LITERATURE CITED |
-
Baldi P, Grossi M, Pecchioni N, Valè G, Cattivelli L
(1999)
High expression level of a gene coding for chloroplastic amino acid selective channel protein is correlated to cold acclimation in cereals.
Plant Mol Biol
41: 233-243[CrossRef][Web of Science][Medline]
-
Baldi P, Valè G, Mazzucotelli E, Govoni C, Faccioli P, Stanca AM, Cattivelli L
(2001)
The transcripts of several components of the protein synthesis machinery are cold regulated in a chloroplast-dependent manner in barley and wheat.
J Plant Physiol
158: 1541-1546[CrossRef]
-
Bergantino E, Dainese P, Cerovic Z, Sechi S, Bassi R
(1995)
A post-transcriptional modification of the photosystem II subunit CP29 protect maize from cold stress.
J Biol Chem
265: 8474-8481
-
Brown APC, Dunn MA, Goddard NJ, Hughes MA
(2001)
Identification of a novel low-temperature-response element in the promoter of the barley (Hordeum vulgare L) gene blt101.1.
Planta
213: 770-780[Medline]
-
Burnham CR, Eslick RF, Haus TE, Hockett EA, Jarvi AJ, McProud WL, Tsushiya T
(1971)
Description of genetic stocks in the barley genetic stock center at Fort Collins, Colorado.
Barley Genet News
1: 103-193
-
Cattivelli L, Baldi P, Crosatti C, Di Fonzo N, Faccioli P, Grossi M, Mastrangelo AM, Pecchioni N, Stanca AM
(2002)
Chromosome regions and stress-related sequences involved in resistance to abiotic stress in Triticeae.
Plant Mol Biol
48: 649-665[CrossRef][Web of Science][Medline]
-
Crosatti C, Polverino de Laureto P, Bassi R, Cattivelli L
(1999)
The interaction between cold and light controls the expression of the cold-regulated barley gene cor14b and the accumulation of the corresponding protein.
Plant Physiol
119: 671-680[Abstract/Free Full Text]
-
Crosatti C, Soncini C, Stanca AM, Cattivelli L
(1995)
The accumulation of a cold-regulated chloroplastic protein is light-dependent.
Planta
196: 458-463[Web of Science][Medline]
-
Dickey LF, Petrackek ME, Nguyen TT, Hansen ER, Thompson WF
(1998)
Light regulation of Fed-1 mRNA requires an element in the 5'untranslated region and correlates with differential polyribosome association.
Plant Cell
10: 475-484[Abstract/Free Full Text]
-
Dunn MA, Goddard NJ, Zhang L, Pearce RS, Hughes MA
(1994)
Low-temperature-responsive barley genes have different control mechanisms.
Plant Mol Biol
24: 879-888[CrossRef][Web of Science][Medline]
-
Dunn MA, White AJ, Vural S, Hughes MA
(1998)
Identification of promoter elements in a low-temperature-responsive gene (blt4.9) from barley (Hordeum vulgare L.).
Plant Mol Biol
38: 551-564[CrossRef][Web of Science][Medline]
-
Escoubas JM, Lomas M, LaRoche J, Falkowski PG
(1995)
Light intensity regulation of cab gene transcription is signaled by the redox state of the plastoquinone pool.
Proc Natl Acad Sci USA
92: 10237-10241[Abstract/Free Full Text]
-
Foster R, Izawa T, Chua NH
(1994)
Plant bZIP proteins gather at ACGT elements.
FASEB J
8: 192-200[Abstract]
-
Gamble PE, Mullet JE
(1989)
Translation and stability of proteins encoded by the plastid psbA and psbB genes are regulated by a nuclear gene during light-induced chloroplast development in barley.
J Biol Chem
264: 7236-7243[Abstract/Free Full Text]
-
Goldschmidt-Clermont M
(1998)
Coordination of nuclear and chloroplast gene expression in plant cells.
Int Rev Cytol
177: 155-180
-
Gray GR, Chauvin LP, Sarhan F, Huner NPA
(1997)
Cold acclimation and freezing tolerance: a complex interaction of light and temperature.
Plant Physiol
114: 467-474[Abstract]
-
Gray GR, Ivanov AG, Krol M, Huner NPA
(1998)
Adjustment of thylakoid plastoquinone content and photosystem I electron donor pool size in response to growth temperature and growth irradiance in winter rye.
Photosynth Res
56: 209-221
-
Gray GR, Savitch LV, Ivanov AG, Huner NPA
(1996)
Photosystem II excitation pressure and development of resistance to photoinhibition: II. Adjustment of photosynthetic capacity in winter wheat and winter rye.
Plant Physiol
110: 61-71[Abstract]
-
Grossi M, Giorni E, Rizza F, Stanca AM, Cattivelli L
(1998)
Wild and cultivated barleys show differences in the expression pattern of a cold-regulated gene family under different light and temperature conditions.
Plant Mol Biol
38: 1061-1069[CrossRef][Web of Science][Medline]
-
Grossi M, Gulli M, Stanca AM, Cattivelli L
(1995)
Characterization of two barley genes that respond rapidly to dehydration stress.
Plant Sci
105: 71-80
-
Henningsen KW, Boyton JE, von Wettstein D
(1993)
Mutants at xantha and albino Loci in Relation to Chloroplast Biogenesis in Barley (Hordeum vulgare L.). The Royal Danish Academy of Sciences and Letters, Copenhagen
-
Hess WR, Muller A, Nagy F, Borner T
(1994)
Ribosome-deficient plastids affect transcription of light-induced nuclear genes: genetic evidence form a plastid-derived signal.
Mol Gen Genet
242: 305-312[CrossRef][Web of Science][Medline]
-
Huner NPA, Maxwell DP, Gray GR, Savitch LV, Krol M, Ivanov AG, Falk S
(1996)
Sensing environmental temperature change through imbalances between energy supply and energy consumption: redox state of photosystem II.
Physiol Plant
98: 358-364[CrossRef]
-
Jefferson RA, Kavanagh T, Bevan M
(1987)
GUS fusion:
-glucuronidase as a sensitive and versatile gene fusion marker in higher plants.
EMBO J
6: 3901-3907[Web of Science][Medline] -
Kropat J, Oster U, Rudiger W, Beck CF
(1997)
Chlorophyll precursors are signals of chloroplast origin involved in light induction of nuclear heath-shock genes.
Proc Natl Acad Sci USA
94: 14168-14172[Abstract/Free Full Text]
-
Lemaux PG, Cho M-J, Louwerse JD, Williams R, Wan Y
(1996)
Bombardment mediated transformation methods for barley.
BioRad US/EG Bulletin
2007: 1-6
-
Lermontova I, Grimm B
(2000)
Overexpression of plastidic protoporphyrinogen IX oxidase leads to resistance to the diphenyl-ether herbicide acifluorfen.
Plant Physiol
122: 75-83[Abstract/Free Full Text]
-
Mauro S, Dainese P, Lannoye R, Bassi R
(1998)
Cold-resistant and cold-sensitive maize lines differ in the phosphorylation of the photosystem II subunit, CP29.
Plant Physiol
115: 171-180[Abstract]
-
Moller SG, Kunkel T, Chua NH
(2001)
A plastidic ABC protein involved in the intercompartmental communication of light signaling.
Genes Dev
15: 90-103[Abstract/Free Full Text]
-
Oelmüller R, Levitan I, Bergfeld R, Rajasekhar VK, Mohr H
(1986)
Expression of nuclear genes as affected by treatments acting on plastids.
Planta
168: 482-492[CrossRef][Web of Science]
-
Pfannschmidt T, Nilsson A, Allen JF
(1999)
Photosynthetic control of chloroplast gene expression.
Nature
397: 625-628[CrossRef]
-
Pfannschmidt T, Schutze K, Brost M, Oelmüller R
(2001)
A novel mechanism of nuclear photosynthesis gene regulation by redox signal from the chloroplast during photosystem stoichiometry adjustment.
J Biol Chem
276: 36125-36130[Abstract/Free Full Text]
-
Phillips JR, Dunn MA, Hughes MA
(1997)
mRNA stability and localisation of the low-temperature-responsive barley gene family blt14.
Plant Mol Biol
33: 1013-1023[CrossRef][Web of Science][Medline]
-
Rizza F, Crosatti C, Stanca AM, Cattivelli L
(1994)
Studies for assessing the influence of hardening on cold tolerance of barley genotypes.
Euphytica
75: 131-138[CrossRef]
-
Sambrook J, Fritsch EF, Maniatis T
(1989)
Molecular Cloning: A Laboratory Manual, Ed 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
-
Schagger H, von Jagow G
(1987)
Tricine-sodium dodecyl sulphate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa.
Anal Biochem
166: 368-379[CrossRef][Web of Science][Medline]
-
Schoepp B, Brugna M, Riedel A, Nitschke A, Kramer DM
(1999)
The Q(o)-site inhibitor DBMIB favours the proximal position of the chloroplast reiske protein and induces a pK-shift of the redox-linked proton.
FEBS Lett
450: 245-250[CrossRef][Web of Science][Medline]
-
Shinozaki K, Yamaguchi-Shinozaki K
(2000)
Molecular responses to dehydration and low temperature: differences and cross-talk between two stress signalling pathways.
Curr Opin Plant Biol
3: 217-223[Web of Science][Medline]
-
Simpson DJ, von Wettstein D
(1991)
Coodinator's report: nuclear genes affecting the chloroplast. Stock list of mutants kept at the Carlsberg Laboratory.
Barley Genet News
21: 102-108
-
Skovgaard Nilsen V, Vibe Scheller H, Lindberg Moller B
(1996)
The photosystem I mutant viridis-zb-63 of barley (Hordeum vulgare) contains low amounts of active but unstable photosystem I.
Physiol Plant
98: 637-644[CrossRef]
-
Szewczyk B, Kozloff LM
(1985)
A method for the efficient blotting of strongly basic proteins from sodium dodecyl sulfate-polyacrylamide gels to nitrocellulose.
Anal Biochem
148: 403-407
-
Thomashow MF
(1999)
Plant cold acclimation: freezing tolerance genes and regulatory mechanisms.
Annu Rev Plant Physiol Plant Mol Biol
50: 571-599[CrossRef][Web of Science]
-
Tullberg A, Alexciev K, Pfannschmidt T, Allen JF
(2000)
Photosynthetic electron flow regulates transcription of the psaB gene in pea (Pisum sativum L.) chloroplast through the redox state of plastoquinone.
Plant Cell Physiol
41: 1045-1054[Abstract/Free Full Text]
-
Zer H, Itzhak O
(1995)
Photoinactivation of photosystem II induces changes in the photochemical reaction centre II abolishing the regulatory role of the Q-B site in the D1 protein degradation.
Eur J Biochem
231: 448-453[Web of Science][Medline]
-
Zhu B, Choi D-W, Fenton R, Close TJ
(2000)
Expression of the barley dehydrin multigene family and the development of freezing tolerance.
Mol Gen Genet
264: 145-153[CrossRef][Web of Science][Medline]
© 2003 American Society of Plant Biologists
This article has been cited by other articles:

|
 |

|
 |
 
K. Nakayama, K. Okawa, T. Kakizaki, T. Honma, H. Itoh, and T. Inaba
Arabidopsis Cor15am Is a Chloroplast Stromal Protein That Has Cryoprotective Activity and Forms Oligomers
Plant Physiology,
May 1, 2007;
144(1):
513 - 523.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. T. Svensson, C. Crosatti, C. Campoli, R. Bassi, A. M. Stanca, T. J. Close, and L. Cattivelli
Transcriptome Analysis of Cold Acclimation in Barley Albina and Xantha Mutants
Plant Physiology,
May 1, 2006;
141(1):
257 - 270.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. V. Savitch, G. Allard, M. Seki, L. S. Robert, N. A. Tinker, N. P. A. Huner, K. Shinozaki, and J. Singh
The Effect of Overexpression of Two Brassica CBF/DREB1-like Transcription Factors on Photosynthetic Capacity and Freezing Tolerance in Brassica napus
Plant Cell Physiol.,
September 1, 2005;
46(9):
1525 - 1539.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|