|
|
||||||||
|
First published online February 27, 2003; 10.1104/pp.102.007765 Plant Physiol, March 2003, Vol. 131, pp. 1496-1507 Carbon Export from Arbuscular Mycorrhizal Roots Involves the Translocation of Carbohydrate as well as LipidEastern Regional Research Center (U.S. Department of Agriculture/Agricultural Research Service), Wyndmoor, Pennsylvania 19038 (B.B., P.E.P., J.B., D.D.D.); Department of Chemistry and Biochemistry, New Mexico State University, Las Cruces, New Mexico 88003 (J.A., J.J., J.W.A., P.J.L., Y.S.-H.); and Plant Biology Department, Michigan State University, East Lansing, Michigan 48823 (J.W.A., Y.S.-H.)
Arbuscular mycorrhizal (AM) fungi take up photosynthetically fixed carbon from plant roots and translocate it to their external mycelium. Previous experiments have shown that fungal lipid synthesized from carbohydrate in the root is one form of exported carbon. In this study, an analysis of the labeling in storage and structural carbohydrates after 13C1 glucose was provided to AM roots shows that this is not the only pathway for the flow of carbon from the intraradical to the extraradical mycelium (ERM). Labeling patterns in glycogen, chitin, and trehalose during the development of the symbiosis are consistent with a significant flux of exported glycogen. The identification, among expressed genes, of putative sequences for glycogen synthase, glycogen branching enzyme, chitin synthase, and for the first enzyme in chitin synthesis (glutamine fructose-6-phosphate aminotransferase) is reported. The results of quantifying glycogen synthase gene expression within mycorrhizal roots, germinating spores, and ERM are consistent with labeling observations using 13C-labeled acetate and glycerol, both of which indicate that glycogen is synthesized by the fungus in germinating spores and during symbiosis. Implications of the labeling analyses and gene sequences for the regulation of carbohydrate metabolism are discussed, and a 4-fold role for glycogen in the AM symbiosis is proposed: sequestration of hexose taken from the host, long-term storage in spores, translocation from intraradical mycelium to ERM, and buffering of intracellular hexose levels throughout the life cycle.
The arbuscular mycorrhizal (AM)
symbiosis is important because it benefits most land plants. AM plants
show enhanced growth, increased resistance to biotic and abiotic
stresses, and greater ecological diversity (for review, see
Smith and Read, 1997 Rather little was known about the forms and pathways through which
carbon flows in the AM symbiosis until recently (Jennings, 1995 AM fungi obtain most or all of their carbon within the host root. Here,
they acquire hexose and transform it into trehalose and glycogen,
typical fungal carbohydrates (Shachar-Hill et al., 1995 The goal of this investigation was to determine whether all the carbon
exported from host roots is, in fact, in the form of lipid. There are
two reasons to investigate this. First, the conversion of carbohydrate
to lipid within the IRM followed by translocation to the ERM and
reconversion into carbohydrates for structural, storage, and
biosynthetic uses is inefficient (close to one-half of the carbon is
lost in converting hexose into TAG and back) and a highly unusual, if
not unique, transport strategy in biology. Although there may be
particular reasons for this strategy that stem from AM anatomy and the
high carbon and energy density of lipids (Bago et al.,
2002
Isotopic labeling in trehalose, glycogen, and chitin in the ERM
was analyzed after supplying
13C1 Glc to mycorrhizal
carrot (Daucus carota) roots to track the metabolism and
movement of carbohydrate from the IRM to the ERM. Figure
1 shows spectra of these carbohydrates
extracted from the ERM and, for glycogen and chitin, hydrolyzed to
their constituent hexose monomers. The intensity of the different peaks
reflects the levels of 13C in each of the carbon
positions of trehalose, Glc from glycogen, and N-acetyl glucosamine
(NAG) from chitin. The identities of the hydrolysis products were
confirmed by comparison with NMR and mass spectra of authentic samples.
There are more peaks in the Glc and NAG spectra compared with those of
trehalose because the latter compound exists in only one form in
solution (a symmetric 1, 1
Quantitatively, there are different labeling patterns in spectra of the three different carbohydrates, although some features are qualitatively the same. Thus, the labeling is consistently higher in positions 1 and 6 and lower in 2 through 5, but the relative intensities in C1 and C6 differ among the three carbohydrates and for the same carbohydrate at different times after labeling. The ratio of labeling in C1 and C6 is important for deducing the metabolic history of carbohydrate in the ERM (see "Discussion"), and these values are plotted in Figure 2. There are no statistically significant changes in the 13C1:13C6 ratio in trehalose or chitin with time, however, a 1.5-fold decrease in that ratio was observed in glycogen from young compared with mature mycelium, and an additional 1.7-fold decrease from mature to old mycelium. When 13C6 Glc was supplied to the colonized roots for 6 weeks, the C6 of trehalose in the ERM was more labeled than the C1 position and was significantly higher than the labeling measured in C1 when 13C1 Glc was supplied (spectra not shown).
Spectra such as those in Figure 1 yield relative labeling levels. Absolute percentages of 13C levels were determined from 1H NMR spectra (not shown): After supplying 13C1 Glc, labeling in C1 of trehalose was 16% ± 2%, it was 21% ± 2% in glycogen C1, and it was 16% ± 2% in C1 of chitin. (Here and elsewhere, values are quoted as mean ± SE of the mean for three to six independent replicates.) Labeling was much lower, 8% ± 1%, in the methyl carbon of the acetyl moiety of chitin. There were no statistically significant trends in labeling levels as a function of labeling time in the C1 or methyl carbons of the carbohydrates. Labeling in C5 of glycogen and trehalose was 1.5 times lower than in the C6 position 3 to 12 weeks after supplying 13C1 Glc, and 1.3 times lower after 16 weeks. When 13C1,2 (double-labeled) Glc was supplied to the mycorrhizal roots, labeling in C1 positions of carbohydrates in the ERM after 10 to 13 weeks was close to 1.5 times higher than when 13C1 was used and splittings in the C1 signals in 13C NMR spectra revealed that C1 singly labeled and C1,2 doubly labeled hexose molecules were present (spectra not shown). Because storage lipid is a precursor for carbohydrate production via
the glyoxylate cycle (Lammers et al., 2001 These results show that the origin of carbohydrates in the ERM is only partly from lipid (see "Discussion"). How far then do fluxes through gluconeogenesis and the glyoxylate cycle contribute to the different carbohydrate pools in the ERM? 13C2 acetate or 13C1,3 glycerol was supplied to the ERM for 6 to 8 weeks to address this question. Substantial labeling was observed in trehalose in the ERM, with 11% ± 2% labeling in C1 when 13C1,3 glycerol was provided, and 33% ± 6% when 13C2 acetate was used. The 13C1:13C6 ratio for trehalose was 0.6 ± 0.1 for both substrates. Labeling in C1 of glycogen was substantial but lower, being 18% ± 3% when 13C2 acetate was supplied and too low to quantify reliably by NMR in experiments with labeled glycerol. The ratio of C1:C6 labeling in glycogen and in chitin was approximately 0.5. The 13C1:13C6 ratios for trehalose and glycogen in the ERM are much lower than found when 13C1 Glc was provided to the mycorrhizal roots (Fig. 2). To confirm whether the glycogen and NAG are synthesized in the ERM and
presymbiotic fungal tissue (hereafter referred to as germinating
spores, see "Materials and Methods") by the usual metabolic
pathways, we obtained Glomus intraradices cDNA sequences for
genes encoding enzymes highly similar to other fungal enzymes catalyzing unique steps in these pathways. The glycogen synthase sequence was obtained by PCR from cDNA template derived from
germinating spores. The primers were degenerate and designed by reverse
translation of two highly conserved regions of fungal glycogen synthase
sequences. A fragment of the predicted size was cloned and sequenced
and was found to share sequence similarity with the fungal genes. Specific primers were then designed from the sequence and a RACE kit
was used to obtain full-length sequences (see "Materials and Methods"). Figure 3 shows the deduced
amino acid sequence of the G. intraradices glycogen synthase
together with multiple alignments for glycogen synthase sequences from
other organisms. The highest degree of homology to a known glycogen
synthase is to that from N. crassa, which has 66% identity
and 78% similarity to the G. intraradices enzyme at the
amino acid level. Regions of high conservation are indicated, and the
known phosphorylation sites are also labeled. The G. intraradices GS protein is identical to the yeast protein sequence over a 13-amino acid region that has been shown to be responsible for the allosteric effect of Glc-6-P on GS activity (Pederson et al., 2000
A putative glycogen-branching enzyme (BE) cDNA was discovered in random expressed sequence tag (EST) sequencing efforts. A full-length cDNA was obtained by RACE methodology and was sequenced in full. Figure 4 shows the deduced amino acid sequence of this clone in alignment with other glycogen BEs. BE from Aspergillus oryzae was very similar to the G. intraradices enzyme at the amino acid level (69% identity and 81% similarity).
Random sequencing of a cDNA library from germinating spores also yielded cDNA with homology to Gln fructose-6-P aminotransferase (GFAT), which catalyzes the first committed metabolic step in glucosamine synthesis. The EST fragment had 59% identity over a 202-amino acid region to the Saccharomyces cerevisiae protein. The nucleotide sequences of these and other putative metabolic genes have been deposited in GenBank (GFAT, BE603749; BE, AF503447; and GS, BE603748), and may also be seen at http://darwin.nmsu.edu/~plammers/glomus/. We used quantitative real-time PCR to measure the number of copies of
mRNA for GS,
The detection of significant GS expression in the ERM, and the labeling
of glycogen and trehalose when 13C-labeled
permeant metabolic precursors were provided, demonstrate significant
glycogen synthesis in the ERM. This suggests the possibility that
carbohydrates synthesized in the ERM might be translocated back to the
IRM as was shown for TAG (Bago et al., 2002 Levels of stored carbohydrate decrease during spore germination
(Bécard et al., 1991
Evidence for the Export of Carbohydrate as well as Lipid to the ERM The spectra in Figure 1 show that supplying AM colonized roots
with Glc labeled in C1 results in labeling of trehalose, glycogen, and
chitin in the ERM. This labeling is consistent with the previous report
of labeling in trehalose in the ERM (Bago et al., 1999 The finding that carbohydrates in the ERM are labeled in C5 is
consistent with a significant flux through this route. C5 labeling is
particularly indicative of the glyoxylate cycle and gluconeogenesis operating from 13C2-labeled
acetyl-coenzyme A (CoA) as it is not expected to become labeled via the
other pathways shown to operate in this tissue (Lammers et al.,
2001
However, synthesis from lipid cannot fully account for the labeling
pattern in carbohydrates. Thus labeling in C3 and C4 positions, as
previously observed (Bago et al., 1999 The observation of greater labeling in C1 than in C6 in trehalose and glycogen at shorter and intermediate times when 13C1 Glc is provided (Fig. 2) also indicates that a significant proportion of carbohydrate in the ERM is derived from a nonlipid source. Higher labeling in C6 than in C1 of trehalose in the ERM when 13C6 Glc is provided is consistent with this. Label from lipids that reaches hexose via the formation of labeled triose in the ERM and gluconeogenesis from triose would label C1 and C6 equally (Fig. 5C). The subsequent action on hexose of other pathways such as recycling between hexose and triose pools or cyclical flux through the pentose phosphate pathway cannot account for greater labeling in C1 than in C6 starting from 13C1 hexose (Fig. 5, B and D). A
13C1:13C6
ratio greater than one in extraradical fungal carbohydrates suggests
the export of
13C1-labeled
carbohydrate from the IRM to the ERM because carbohydrate in the IRM is
labeled almost exclusively in C1 when
13C1 Glc is provided
(Shachar-Hill et al., 1995 The Identity of Exported Carbohydrate What form(s) of carbohydrate is involved in the export from IRM to
ERM? Glycogen is the most likely candidate because it is found in
significant amounts in AM fungi (Bonfante et al., 1994 Because chitin is not water soluble, and because its C1 percentage
labeling and
13C1:13C6
ratio are lower than those of glycogen or trehalose, it is likely that
the glucosamine from which NAG and then chitin are made derive from
hexose in the ERM rather than being exported from the IRM. The putative
gene sequences for GFAT and chitin synthase suggest that
the usual pathway of chitin synthesis is active in the ERM. Ubalijoro
et al. (2001) The 13C-labeling levels in C1 of glycogen, trehalose, and chitin are two to three times higher at all time points than expected in hexose made from lipid; and with the exception of glycogen at the first time point, the same is true of C6 labeling. This indicates that carbohydrate movement from IRM to ERM plays a significant role in AM fungal metabolism in the symbiosis. Quantifying the relative contributions of carbohydrate and lipid to total carbon export would require additional information on the labeling in ERM carbohydrates and on the relative proportions of carbohydrate and lipid that are directed to other metabolic fates (protein, nucleic acids, respiration, and secondary metabolites) in the ERM. Synthesis, Turnover, and Regulation of Glycogen through the Fungal Life Cycle Small-scale random sequencing of cDNAs from germinating spores
(Jun et al., 2002 The quantification of significant expression levels for glycogen
synthase (Table I), together with the substantial levels of labeling in
glycogen observed after adding labeled glycerol or acetate, confirm
active glycogen synthesis at this stage of the life cycle. Labeling
data indicate that glycogen synthesis is active in IRM
(Shachar-Hill et al., 1995 The finding that the deduced amino acid sequence of glycogen synthase
contains putative phosphorylation and Glc-6-P allosteric regulatory
sites (Fig. 4), together with the absence of dramatic differences in
expression levels in the different tissues during symbiosis, is
consistent with the idea that posttranslational regulation governs
glycogen turnover in G. intraradices as in other organisms
(Skurat et al., 1996 Fungal lipid within the root becomes labeled when
13C-glycerol was supplied to the ERM (Bago
et al., 2002 The fact that labeling is higher in C6 of glycogen and trehalose than
in C5 in the ERM when 13C1
Glc was supplied to the colonized roots suggests that there is also a
significant bidirectional flux between hexose and triose in the ERM
that increases the labeling in C6 by transferring label between C1 and
C6 (Fig. 5B). Together with glycogen turnover, triose/hexose recycling
is consistent with the observed drop in the
13C1:13C6
ratio at longer time points (Fig. 2). This hexose/triose recycling is
in contrast to the situation in the IRM, where no scrambling of label
was observed between C1 and C6 (Shachar-Hill et al., 1995 We conclude that the flux of carbon from within mycorrhizal roots to the ERM is in the form of carbohydrate and lipid, and that glycogen is probably the predominant carbohydrate moved within the fungus. The dual pathways of carbon movement are illustrated in Figure 6. Turnover of glycogen and the expression of glycogen synthase are consistent with a 4-fold role for glycogen in the AM symbiosis: sequestration of hexose taken from the host, long-term storage in spores, translocation from IRM to ERM, and buffering of intracellular hexose levels throughout the life cycle.
Production and Labeling of Fungal Material Fungal material for NMR experiments was obtained as previously
published (Bago et al., 1999 To label the fungal material, 99% (atom%) 13C-enriched
substrates dissolved in 0.5 to 1 mL of water were added (through a
sterile 0.2-µm filter) to the compartment containing the mycorrhizal
roots or the ERM (approximately 12 mL of media in each compartment) 1 to 2 weeks after the fungus had crossed the plastic barrier (Pfeffer et al., 1999 To perform germinating spores experiments, fungal tissue from
12-week-old (after crossing over) ERM was recovered as explained above
except for blending for 45 s at high speed (Bago et al., 1999 Carbohydrate Extraction, Enzymatic Digestions, and NMR Sample Preparation To obtain the different fractions of fungal carbon molecules studied, sequential extraction of soluble carbohydrates, neutral lipids, glycogen, and chitin were performed. Soluble carbohydrate and neutral lipid extracts were prepared as
previously described (Pfeffer et al., 1999 Solid residues from lipid extraction were treated enzymatically for glycogen breakdown to Glc. This was accomplished by resuspending samples in a sodium acetate buffer (50 mM, pH 4.5) and adding five units of an amyloglucosidase (EC 3.2.1.3; reference no. 10115; Fluka, Buchs, Switzerland) solution (in deionized water) per sample. Samples were then incubated at 50°C with continuous stirring for 3 h. After decanting, supernatants were acquired with a Pasteur pipette and were further centrifuged to completely remove solid particles. The aqueous solution was then freeze dried and kept at 4°C until NMR analysis. Labeling patterns in chitin were characterized in solids obtained from
glycogen digestions. First samples were pretreated for 20 min in
boiling water with a KOH solution (1 M) to remove proteins
and other material coating the fungal cell wall (Ruiz-Herrera, personal
communication). After decanting, KOH was removed and solids were washed
in deionized water, and then soaked in a potassium phosphate buffer
(200 mM, pH 6.0). One unit of chitinase (EC 3.2.1.14; reference no. C-1525; Sigma, St. Louis), 1 unit of chitosanase (EC
3.2.1.132; reference no. C-9830; Sigma), and 0.1 unit of For NMR analysis, carbohydrate extracts as well as glycogen and chitin digestions were dissolved in 750 µL of deuterated water. Lipid extracts were dissolved in 750 µL of deuterated chloroform. In all cases, insoluble matter was removed by centrifugation. NMR Spectroscopy and Quantification of 13C Labeling Spectra were obtained using a spectrometer (UnityPlus 400 MHz;
Varian, Palo Alto, CA) with an superconducting magnet (9.4T; Oxford
Instruments, Oxford), although several 1H extract spectra
were acquired at 750 MHz on spectrometers (Bruker, Billerica, MA). A
5-mm broadband probe was used for 13C spectra, whereas a
5-mm 1H, inverse detection probe with Z gradient and
broadband decoupling coil was used for 1H spectra.
13C spectra were accumulated with 80° pulse angles,
WALTZ-1H decoupling, and with recycle times of 4.2 s
for aqueous samples and 13.2 s for samples dissolved in
chloroform. For 1H spectra, 80° pulses and recycle times
of 4.5 s were used, and when necessary, 12-s recycle times were
used to prevent distortion of the relative intensities of the
1H-12C and 1H-13C
signals (London, 1988 The identification of peaks in 13C and 1H
spectra was made from literature values (Fan, 1995 C1:C6 and C6:C5 ratios were obtained from integrals of the respective peaks. 13C-isotopic abundance (atom percentage of 13C) of the labeled positions of a given compound was calculated by measurement of the 13C-1H satellites of 1H signals in proton spectra. To be specific, the satellites of the 1H signals coupled to (i) the C1 and 1' of trehalose, 1H signal at 5.18 ppm for MeOH/H2O extracts; (ii) C1 of Glc, 1H signal at 5.22 ppm for digested glycogen samples, and (iii) the methyl carbon of NAG, 1H signal for chitin digestions were used. Gene Cloning, Sequencing, and Quantification of Gene Expression Glycogen Synthase and Glycogen BE Gene Isolation The glycogen synthase gene from G. intraradices was isolated using degenerate PCR primers designed from conserved sequence motifs in a series of fungal glycogen synthase amino acid sequences. These were aligned using ClustalW program, and degenerate PCR primers were designed based on regions of high sequence conservation as follows: forward: 5'-CAYGARTTYCARAAYYTNCA-3'; and reverse: 5'-GTRTANCCCCANGGYTCRTA-3'. cDNA from 11-d germinating spores of G. intraradices served as template along with no-template negative control. The PCR product of the expected size was gel isolated and cloned into Topo vector (Invitrogen, Carlsbad, CA). Plasmid DNA from random clones was isolated and sequenced as described previously (Lammers et al., 2001Obtaining Full-Length Sequences by RACE Full-length cDNA sequences were obtained using the SMART RACE cDNA amplification kit (CLONTECH, Palo Alto, CA). Two hundred-fifty nanograms of total RNA was used to synthesize each 5'- and 3'-RACE-ready cDNA. The sequences of gene-specific primers used for RACE were based on the sequences of gene fragments obtained from PCR-based amplification (GS) or from random EST sequence data (glycogen BE). Primers were synthesized by IDT (Coralville, IA). Primer sequences were as follows: GS 5'-RACE gene-specific primer (GSP): 5'-GCCCCAAGGTTCATAATAACTTGGGAACACGCC-3'; nested GSP: 5'-TGAAATATCACCACCCGTATAGCGTGCAGC-3'; GS 3'-RACE GSP: 5'-GCGGCAACTCAATCATTTGCTGTGGAAGC-3'; NGSP2: 5'-TTTGTTCGTGGTTGCCATCTTGGCGTGTTCC-3'; RACE primers for glycogen BE: 5'-RACE GSP1: 5'-CCAGGCTGGAAGACGATCGATACATTCG-3'; NGSP1: 5'-CAATCAAACTTGCAGCAACGGCATTAGGTGCC-3'; 3'-RACE GSP: 5'-ATATACCGCGAATGGGCACCTAATGCC-3'; NGSP2: 5'-GACTACACCAGAAGGCGAATGTATCGATCG-3'. The resulting RACE fragments for each gene were cloned into the pGEM-T Easy vector (Promega, Madison, WI) and were sequenced with M13 forward and reverse primers. Real-Time RT-PCR Quantification of Gene Expression RNA was extracted from the ERM, germinating spores, and
colonized and uncolonized root tissue using the method of Lammers et
al. (2001) To prepare template for Taq-Man RT-PCR assays, 100 ng of total RNA was treated with RNase-free DNase-I (DNA free; Ambion, Austin, TX) for 1 h followed by DNase-I removal as specified by the manufacturer. Duplicate assays used 5-ng aliquots of the DNase-treated RNA preincubated for 15 min at 95°C then placed on ice to remove any potential interfering secondary structures. The reverse amplification primer served as the primer for reverse transcription. Each RT-PCR assay was run in 50 mL of total volume using One-Step RT-PCR Master mix containing AmpliTaq Gold DNA polymerase to which 12.5 units of MultiScribe enzyme was added (all from Applied Biosystems, Foster City, CA). The reactions were incubated at 48°C for 60 min for reverse transcription, followed by a 10-min incubation at 95°C to activate the AmpliTaq Gold polymerase and 45 cycles of 15 s at 95°C, and 1 min at 60°C. MultiScribe enzyme was omitted from the no-RT control reactions. GS Amplicon 74-bp Amplicon Forward primer: 5'-AACAGCTTGACCTTTCAGTGCTT-3'; reverse primer: CCGTTGTTGCATTTATTGTCATG; Taq-Man Probe: 5'-FAM-CACAGCAAATGATTGAGTTGCCGCA-3'-TAMRA-3'.
Forward primer: 5'-AGAAAGTCTACCACGGAAAATAGTAGCT-3'; reverse primer: 5'-TTCACGTAATATGATGGCTGCAT-3'; Taq-Man Probe: 5'-FAM-CGGTCAAATATCTTCCATGACGAGGATCG-3'-TAMRA-3'. 18S rRNA 76-bp Amplicon Forward primer: 5'-CCGTGAATCATCGAATCTTTGAA-3'; reverse primer: 5'-CACTGACCCTCAAACAGGCATA-3'; Taq-Man Probe: 5'-FAM-TGCACTCTCTGGCAACCCGGG-3'-TAMRA-3'
We wish to thank Aisha Abdul-Wakeel and Dr. Daniel Schwartz (U.S. Department of Agriculture-Agricultural Research Service) for technical assistance.
Received May 7, 2002; returned for revision July 31, 2002; accepted November 26, 2002. 1 Present address: CIDE, Cami de la Marjal s.n., 46470-Albal, Valencia, Spain.
* Corresponding author; e-mail yairhill{at}msu.edu; fax 240-352-8021.
Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.102.007765.
This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|