Plant Physiol. Illumina
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via ISI Web of Science (94)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Perry, J. A.
Right arrow Articles by Parniske, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Perry, J. A.
Right arrow Articles by Parniske, M.
Agricola
Right arrow Articles by Perry, J. A.
Right arrow Articles by Parniske, M.

Plant Physiol, March 2003, Vol. 131, pp. 866-871

SCIENTIFIC CORRESPONDENCE

A TILLING Reverse Genetics Tool and a Web-Accessible Collection of Mutants of the Legume Lotus japonicus1


Jillian A. Perry, Trevor L. Wang, Tracey J. Welham, Sarah Gardner, Jodie M. Pike, Satoko Yoshida, and Martin Parniske*

The Sainsbury Laboratory (J.A.P., S.G., J.M.P., S.Y., M.P.), John Innes Centre (Tre.L.W., Tra.W.), Colney Lane, Norwich NR4 7UH, United Kingdom


    ARTICLE
TOP
ARTICLE
LITERATURE CITED

Reverse genetics aims to identify the function of a gene with known sequence by phenotypic analysis of cells or organisms in which the function of this gene is impaired. Commonly used strategies for reverse genetics encompass transposon mutagenesis (Tissier et al., 1999) and RNA-mediated gene silencing or RNA interference (Voinnet, 2002). We adopted a complementary strategy to set up a reverse genetics tool for the legume Lotus japonicus that identifies individuals carrying point mutations in any gene of interest within a large population of ethyl methanesulfonate (EMS)-mutagenized M2 plants. This strategy was first described by McCallum et al. (2000a,b) using the acronym TILLING (Targeted Induced Local Lesions in Genomes). The target sequence is PCR amplified from pooled M2 individuals. DNA with point mutations are detected by melting and re-annealing of the PCR products. This results in the formation of heteroduplex DNA in which one strand originates from the mutant and the other from the wild-type PCR product. A mismatch occurs at the site of the point mutation, which can be detected using mismatch-specific endonucleases such as CEL I from celery (Apium graveolens; Yang et al., 2000). This enzyme recognizes mismatches in heteroduplex DNA and cleaves DNA specifically at the mismatched site. The cleavage products can be separated by gel electrophoresis, typically sequencing-type denaturing PAGE. This method of mismatch detection is amenable to pooling strategies. In the Arabidopsis TILLING facility, DNA of eight M2 plants is mixed to form a pool (Colbert et al., 2001). At this pool size, a population of 768 individuals can be screened by PCR in a 96-well microtiter plate, and run on one 96-well gel, each well representing eight individuals. Individuals from pools yielding cleavage products are then PCR amplified individually to identify the mutation bearing plant, progeny of which will segregate the mutation of interest.

Although a high-throughput TILLING facility has been successfully established for Arabidopsis (Colbert et al., 2001), several aspects of plant biology cannot be studied in this model plant; for example, root symbiosis with rhizobia and arbuscular mycorrhiza fungi, compound leaf development, aspects of flower development, and perenniality. We chose the model legume L. japonicus (Handberg and Stougaard, 1992) to establish a legume reverse genetics tool. The genome of this plant is subject of a sequencing project (VandenBosch and Stacey, 2003).

One problem associated with EMS mutagenesis is the high frequency of infertile plants not only in the M1 but also in subsequent generations. Our aim was to assemble a general TILLING population that would ideally be composed of fertile individuals only, so that progeny of a plant carrying a mutant allele can be directly recovered. A general TILLING population of 3,697 independent M2 plants was established biased against the occurrence of severe developmental phenotypes to maximize M3 seed availability (Fig. 1). DNA was prepared in 96-well microtiter plate format and seed from each individual was collected.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 1.   Structure of the TILLING population. EMS-mutagenized seed of L. japonicus B-129 "Gifu" resulted in approximately 4,190 fertile M1 plants. M2 seed was harvested from individual M1 plants, and M2 families were grown individually. The families were kept separate to maximize diversity of point mutations represented in the TILLING population. Many M1 plants suffered from poor seed set. Dependent on availability, up to 30 seeds were sown per M2 family, and the resulting total of 45,600 plants were inoculated after 2 weeks with M. loti and scored after a total of 6 weeks for the development of symbiotic nitrogen-fixing root nodules, and screened for other developmental defects (Table I). A single healthy-looking plant was chosen for the general TILLING population and designated with the number SL n-1, where n is a sequential number representing the family, whereas the number behind the dash identifies the sibling. All interesting mutants identified in a family were recorded and designated with consecutive sibling numbers (SL n-2, n-3, etc.) and seed harvested individually. Seed from all remaining plants was collected in bulk so that each seed pack contained seeds from only one family. This seed was collected for the purpose of future forward screens and as a backup for the isolation of mutant alleles known to segregate in a particular family, in case the phenotypically interesting M2 mutants were infertile.

A specific advantage of EMS mutagenesis is that a series of allelic mutations can be obtained, displaying a range of phenotypes that can serve as the basis of detailed structure function studies. This also has the potential to recover weak alleles with subtle changes in functionality of genes that would be lethal when more strongly affected. However, the recovery of strongly affected or knockout alleles will often be the primary interest in species for which no insertional knockout mutagenesis tool is established. To enrich for plants bearing functionally impaired mutant alleles of genes involved in a variety of developmental and metabolic processes, we scored approximately 45,600 M2 progeny of 4,190 EMS-mutagenized M1 plants, and isolated mutants affected in metabolism, morphology, and the root nodule symbiosis (Figs. 1 and 2; Table I). A database comprising information on individual mutant plants including photographs where appropriate is accessible at http://www.lotusjaponicus.org/finder.htm. This allows for the assembly of trait-specific or theme-based TILLING populations enriched for mutants affected in a particular developmental process.



View larger version (53K):
[in this window]
[in a new window]
 
Figure 2.   A selection of morphological mutants from M2 families of L. japonicus. A, SL1203-3 is a flower mutant bearing abnormal reiterated flower structures. B, SL5428 exhibits a fruit phenotype with curled pods and delayed senescence of the petals. This represents a dominant mutation that was manifest in the M1 plant. C, In SL2143-2, a single leaf replaces the normal five leaflets of the compound leaf. D, SL2112-4 is a leaf shape mutant that has rounded leaflets. E, SL189-2 shows chlorophyll variegation in the leaflets. F, SL1077-2 has abnormal flowers in which the petals do not expand fully. G, SL3534-2 is an extreme dwarf. H, SL2137-2 exhibits narrow leaflets.


                              
View this table:
[in this window]
[in a new window]
 
Table I.   Morphological, symbiotic and metabolic mutants of L. japonicus Gifu

Mutants in categories architecture, flower, leaf, root, and stem originate from scoring an initial 2415 M2 families (28,500 M2 plants). A total of 3843 M2 families (45,600 plants) were screened for nodulation mutants(a), and mutants with either no nodules, or small white nodules as well as plants with a reduced or increased nodule number (supernodulating mutants) were isolated. 1428 M2 families (17,100 plants) were screened for starch biosynthesis and breakdown (see supplementary materials)(b). The numbers recorded represent characters scored on individual plants and thus may be sibling aggregates. Furthermore, a single plant may be altered in more than one character and will be recorded in more than one section. A database comprising all the mutant information including photographs can be found at http://www.lotusjaponicus.org/finder.htm

A pilot experiment was performed in which the SYMRK gene was subjected to the TILLING procedure (Fig. 3). The SYMRK gene is required for the formation of root symbioses by L. japonicus, and previously identified mutations lead to a non-nodulating phenotype (Stracke et al., 2002). The genomic sequence of SYMRK from start to stop codon extends over 5,472 kb, but the maximum length of PCR products that can be conveniently resolved by sequencing-type PAGE is just over 1 kb. Therefore, we used the program CODDLE (Codons Optimized to Discover Deleterious Lesions; http://www.proweb.org/input/) to identify a region within the SYMRK gene that would have the highest likelihood to be functionally affected by EMS mutagenesis. EMS induces mostly G/C to A/T transitions (Anderson, 1995), and CODDLE uses this information to predict the EMS-induced changes in a coding sequence, and plots the probability of missense and nonsense mutations along the coding sequence (Fig. 3). Second, the program searches the predicted protein sequence under study for the occurrence of conserved amino acid sequence blocks, with the idea that changes in such conserved regions are less likely to be functionally neutral. Figure 3 shows part of a CODDLE output for the SYMRK gene. We confined the screen for mutant alleles to the region encoding the protein kinase domain. Primers for three overlapping PCR amplicons spanning the entire kinase domain were designed (Figs. 3 and 4) using CODDLE in combination with the PRIMER3 program (Rozen and Skaletsky, 2000) as set up on the CODDLE Web page (http://www.proweb. org/input/).



View larger version (36K):
[in this window]
[in a new window]
 
Figure 3.   Effect of EMS mutagenesis on the SYMRK gene. A, Output of the CODDLE program for 5,472 bp of genomic sequence of SYMRK. Exons are represented by white boxes and introns by black lines. Regions encoding Leu-rich repeat (LRR), transmembrane domain (TM), and protein kinase region (PKR) are indicated by brackets. The CODDLE program was used to identify regions of the SYMRK gene in which G/C to A/T transitions are most likely to result in deleterious effects. Each point on the plot is the sum of scores calculated for a 500-bp window centered at that residue. A residue susceptible to a nonsense change scored +6, to a missense change scored 0, to a silent change scored -1, and to a splice junction scored +4 (McCallum et al., 2000b; http://www.proweb.org/glossary.html). B, Three amplicons (primer combination [forward and reverse[: 1, 25019 and 25027; 2, 25012 and 25013; and 3, 25020 and 25028) chosen to cover the protein kinase region. C, Sequence of the region covered by the amplicons 1, 2, and 3, delimited by dashed lines in A. The positions and family identifier of mutations are indicated by vertical arrows. In all identified mutants, a G residue was mutated to an A, which is consistent with the predominant G/C to A/T transitions induced by EMS (Anderson, 1995). Primer positions and orientations are indicated by horizontal arrows. Forward primers 25019 GCACACATGCTATGATCCAGA, 25012 TCAGAGCATCAAAATTCCCAAGAAACC, and 25020 GACTACAGGGGAACCTGCAA were labeled with 6-carboxyfluorescein (6-FAM). Reverse primers 25027 GCACACATGCTATGATCCAGA, 25013 TGCATGTTTGTTTGGAAATCCTTCTACA, and 25028 GCCTGCATGCGAAGTTATTT were labeled with 4,7,2',7'-tetrachloro-6-carboxy-fluorescein (TET).



View larger version (67K):
[in this window]
[in a new window]
 
Figure 4.   CEL1 mismatch detection. A, Fluorescence emission scans of a 96-well gel showing CEL1-treated PCR products (primer combination 25020 and 25028) that result in an uncut band (991 bp) and cleavage products from mismatched heteroduplexes. Emission scans for forward primer labeled with 6-FAM (left image) and reverse primer labeled with TET (right image) shows cleavage products of 300, 363, 628, and 691 bp, respectively. For clarity, the insets show schematic diagrams of the cleavage products observed in the original gels. The numbered lanes 1 to 6 correspond to six different 3x pools containing the following mutants (Table II): pool 1, SL1951-4; pool 2, SL1951-5; pool 3, SL1951-6 and SL160-4; pool 4, SL1951-7 and SL160-5; pool 5, SL160-6; and pool 6, SL1951-2 and SL160-3. B, Fluorescent traces of six individual lanes representing the pools above from the gel shown in A. The traces on the left show the scan for 6-FAM, which labels the top strand. Cleaved (300 and 363 bp) and non-cleaved (991 bp) products were detected, and fragment length could be estimated due to the inclusion of size standards (not shown). The right traces represent the scan for TET, which labels the bottom strand. Cleaved (628 and 691 bp) and non-cleaved products (991 bp) were detected. The CEL I assay was essentially performed as described by Colbert et al. (2001), but PCR was carried out in the absence of unlabeled primer. Instead of Sephadex filtration, reaction products were precipitated with ethanol and separated by PAGE using an ABI 377 sequencer.

A population of 117 non-nodulating plants from 75 families, 135 plants from 112 families carrying few or small or white nodules, and 23 plants from 21 families with abnormalities in root development were inspected for the occurrence of point mutations in the SYMRK kinase domain. Thirteen symbiosis-defective mutants that were isolated in an independent mutagenesis program in other laboratories were included as reference. Two of these (EMS34 and EMS61) had been assigned previously to the SYMRK (Ljsym2) complementation group (Szczyglowski et al., 1998; Stracke et al., 2002). These 288 mutants were screened at a pool size of three individuals per pool. In this preselected population, 15 homozygous mutants representing six different alleles were identified that carried missense mutations. Furthermore, a mutation in plant SL391-2 in the splice acceptor site of the 11th intron was found that is likely to affect splicing (Table II). The nonsense mutation in EMS61 published previously (Stracke et al., 2002) served as an internal reference control. All of these mutations were detected in individuals that did not produce root nodules upon inoculation with Mesorhizobium loti.


                              
View this table:
[in this window]
[in a new window]
 
Table II.   Mutations in the region encoding the kinase domain of SYMRK

The base and amino acid change are listed in addition to the position of the mutation in genomic DNA sequence relative to the A of the start codon. Non-nodulating M2 plants homozygous for alleles SL605, SL391, SL 1951, and SL160 set seed, and the non-nodulating phenotype was stably inherited to the M3 generation, but the two non-nodulating individuals, SL140-2 and SL3472-2, did not set seed. We therefore tested M3 seed from the bulk harvested families SL140 and SL3472, but we could not identify non-nodulating plants in the sibling progeny.

An M1 plant EMS treated at the embryo stage represents a mosaic of differentially mutagenized cells. Because more than one cell of the embryo gives rise to the germ line, less than 75% of the M2 progeny are expected to segregate a particular mutant allele. Only one (SL1951) of the six novel mutant alleles was represented in a heterozygous state in the nodulating sibling of the general TILLING population.

The high number of functionally affected mutant alleles in the preselected mutants shows that, depending on the purpose of the resource, it might be advisable to include a phenotypic screen for the trait of interest when setting up TILLING in a particular organism.


    ACKNOWLEDGMENTS

We thank Paul Schulze-Lefert (Max-Planck Institute, Cologne , Germany), Noel Ellis (John Innes Centre, Norwich, UK, [JIC]), Brande Wulff (The Sainsbury Laboratory, Norwich, UK [SL]), and Bradley Till (Fred Hutchinson Cancer Research Center, Seattle, WA) for ideas and discussions; Steven Henikoff (Fred Hutchinson Cancer Research Center) for providing CEL I; and Jens Stougaard (University of Aarhus, Denmark) for supplying sufficient quantities of L. japonicus "Gifu" seed for mutagenesis We gratefully acknowledge Ruth Pothecary (JIC), Barry Robertson (JIC), Hugh Frost (JIC), Noel Ellis (JIC), Julie Hofer (JIC), Catherine Kistner (Deutsche Forschungsgemeinschaft, Bonn, Germany), Scott Coomber (SL), Max Gosling (JIC), Kevin Crane (JIC), Steve Johnson (JIC), Miriam Balcam (JIC), Sonia Hill (JIC), Rob Seale (JIC), Scott Taylor (JIC), Thilo Winzer (SL), and all in the JIC Horticultural Services department for help with plant handling. We thank Da Luo (Shanghai Institute of Plant Physiology, Shanghai, China) and Cathie Martin (JIC) for scoring flower and pigment mutants, and Mike Harvey (JIC) and Paul Bishop (JIC) for setting up the Web-accessible database. We thank David Baker (JIC) for operating the ABI377 sequencing machine.

    FOOTNOTES

Received November 7, 2002; returned for revision November 11, 2002; accepted December 19, 2002.

1 This work was supported by the Biotechnology and Biological Science Research Council (grant no. D15167 "A Reverse Genetics Tool for Legume Functional Genomics") and grant-in-aid by the John Innes Centre (interdepartmental research grant to T.L.W. and M.P.), and by the Gatsby Charitable Foundation (to the Sainsbury Laboratory).

* Corresponding author; e-mail martin.parniske{at}sainsbury-laboratory.ac.uk; fax 44-1603-450011.

www.plantphysiol.org/cgi/doi/10.1104/pp.102.017384.


    LITERATURE CITED
TOP
ARTICLE
LITERATURE CITED

© 2003 American Society of Plant Biologists



This article has been cited by other articles:


Home page
J. Mol. Diagn.Home page
K. Voskarides and C. Deltas
Screening for Mutations in Kidney-Related Genes Using SURVEYOR Nuclease for Cleavage at Heteroduplex Mismatches
J. Mol. Diagn., July 1, 2009; 11(4): 311 - 318.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
T. Welham, J. Pike, I. Horst, E. Flemetakis, P. Katinakis, T. Kaneko, S. Sato, S. Tabata, J. Perry, M. Parniske, et al.
A cytosolic invertase is required for normal growth and cell development in the model legume, Lotus japonicus
J. Exp. Bot., May 27, 2009; (2009) erp169v1.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
M. Maekawa-Yoshikawa, J. Muller, N. Takeda, T. Maekawa, S. Sato, S. Tabata, J. Perry, T. L. Wang, M. Groth, A. Brachmann, et al.
The Temperature-Sensitive brush Mutant of the Legume Lotus japonicus Reveals a Link between Root Development and Nodule Infection by Rhizobia
Plant Physiology, April 1, 2009; 149(4): 1785 - 1796.
[Abstract] [Full Text] [PDF]


Home page
The Plant GenomeHome page
C. Dong, J. Dalton-Morgan, K. Vincent, and P. Sharp
A Modified TILLING Method for Wheat Breeding
The Plant Genome, March 1, 2009; 2(1): 39 - 47.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. Yano, S. Yoshida, J. Muller, S. Singh, M. Banba, K. Vickers, K. Markmann, C. White, B. Schuller, S. Sato, et al.
From the Cover: CYCLOPS, a mediator of symbiotic intracellular accommodation
PNAS, December 23, 2008; 105(51): 20540 - 20545.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
M. Charpentier, R. Bredemeier, G. Wanner, N. Takeda, E. Schleiff, and M. Parniske
Lotus japonicus CASTOR and POLLUX Are Ion Channels Essential for Perinuclear Calcium Spiking in Legume Root Endosymbiosis
PLANT CELL, December 1, 2008; 20(12): 3467 - 3479.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Gherbi, K. Markmann, S. Svistoonoff, J. Estevan, D. Autran, G. Giczey, F. Auguy, B. Peret, L. Laplaze, C. Franche, et al.
From the Cover: SymRK defines a common genetic basis for plant root endosymbioses with arbuscular mycorrhiza fungi, rhizobia, and Frankiabacteria
PNAS, March 25, 2008; 105(12): 4928 - 4932.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. Li, R. Berbeco, R. J. Distel, P. A. Janne, L. Wang, and G. M. Makrigiorgos
s-RT-MELT for rapid mutation scanning using enzymatic selection and real time DNA-melting: new potential for multiplex genetic analysis
Nucleic Acids Res., June 9, 2007; 35(12): e84 - e84.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
M. K. Udvardi, K. Kakar, M. Wandrey, O. Montanari, J. Murray, A. Andriankaja, J.-Y. Zhang, V. Benedito, J. M.I. Hofer, F. Chueng, et al.
Legume Transcription Factors: Global Regulators of Plant Development and Response to the Environment
Plant Physiology, June 1, 2007; 144(2): 538 - 549.
[Full Text] [PDF]


Home page
Plant Physiol.Home page
S. Sato, Y. Nakamura, E. Asamizu, S. Isobe, and S. Tabata
Genome Sequencing and Genome Resources in Model Legumes
Plant Physiology, June 1, 2007; 144(2): 588 - 593.
[Full Text] [PDF]


Home page
Plant Physiol.Home page
I. Horst, T. Welham, S. Kelly, T. Kaneko, S. Sato, S. Tabata, M. Parniske, and T. L. Wang
TILLING Mutants of Lotus japonicus Reveal That Nitrogen Assimilation and Fixation Can Occur in the Absence of Nodule-Enhanced Sucrose Synthase
Plant Physiology, June 1, 2007; 144(2): 806 - 820.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
E. Cuppen, E. Gort, E. Hazendonk, J. Mudde, J. van de Belt, I. J. Nijman, V. Guryev, and R. H.A. Plasterk
Efficient target-selected mutagenesis in Caenorhabditis elegans: Toward a knockout for every gene
Genome Res., May 1, 2007; 17(5): 649 - 658.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
A. B. Heckmann, F. Lombardo, H. Miwa, J. A. Perry, S. Bunnewell, M. Parniske, T. L. Wang, and J. A. Downie
Lotus japonicus Nodulation Requires Two GRAS Domain Regulators, One of Which Is Functionally Conserved in a Non-Legume
Plant Physiology, December 1, 2006; 142(4): 1739 - 1750.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
R. Benlloch, I. d'Erfurth, C. Ferrandiz, V. Cosson, J. P. Beltran, L. A. Canas, A. Kondorosi, F. Madueno, and P. Ratet
Isolation of mtpim Proves Tnt1 a Useful Reverse Genetics Tool in Medicago truncatula and Uncovers New Aspects of AP1-Like Functions in Legumes
Plant Physiology, November 1, 2006; 142(3): 972 - 983.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
B. J. Till, T. Zerr, E. Bowers, E. A. Greene, L. Comai, and S. Henikoff
High-throughput discovery of rare human nucleotide polymorphisms by Ecotilling
Nucleic Acids Res., August 7, 2006; 34(13): e99 - e99.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
D. Maeda, K. Ashida, K. Iguchi, S. A. Chechetka, A. Hijikata, Y. Okusako, Y. Deguchi, K. Izui, and S. Hata
Knockdown of an Arbuscular Mycorrhiza-inducible Phosphate Transporter Gene of Lotus japonicus Suppresses Mutualistic Symbiosis
Plant Cell Physiol., July 1, 2006; 47(7): 807 - 817.
[Abstract] [Full Text] [PDF]


Home page
MycologiaHome page
K. Lamour and L. Finley
A strategy for recovering high quality genomic DNA from a large number of Phytophthora isolates.
Mycologia, May 1, 2006; 98(3): 514 - 517.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
C. Kistner, T. Winzer, A. Pitzschke, L. Mulder, S. Sato, T. Kaneko, S. Tabata, N. Sandal, J. Stougaard, K. J. Webb, et al.
Seven Lotus japonicus Genes Required for Transcriptional Reprogramming of the Root during Fungal and Bacterial Symbiosis
PLANT CELL, August 1, 2005; 17(8): 2217 - 2229.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
N. D. Young, S. B. Cannon, S. Sato, D. Kim, D. R. Cook, C. D. Town, B. A. Roe, and S. Tabata
Sequencing the Genespaces of Medicago truncatula and Lotus japonicus
Plant Physiology, April 1, 2005; 137(4): 1174 - 1181.
[Full Text] [PDF]


Home page
Plant Physiol.Home page
E. L. Davis and M. G. Mitchum
Nematodes. Sophisticated Parasites of Legumes
Plant Physiology, April 1, 2005; 137(4): 1182 - 1188.
[Full Text] [PDF]


Home page
Plant Physiol.Home page
Z.-c. Dong, Z. Zhao, C.-w. Liu, J.-h. Luo, J. Yang, W.-h. Huang, X.-h. Hu, T. L. Wang, and D. Luo
Floral Patterning in Lotus japonicus
Plant Physiology, April 1, 2005; 137(4): 1272 - 1282.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Yoshida and M. Parniske
Regulation of Plant Symbiosis Receptor Kinase through Serine and Threonine Phosphorylation
J. Biol. Chem., March 11, 2005; 280(10): 9203 - 9209.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
K. Forslund, M. Morant, B. Jorgensen, C. E. Olsen, E. Asamizu, S. Sato, S. Tabata, and S. Bak
Biosynthesis of the Nitrile Glucosides Rhodiocyanoside A and D and the Cyanogenic Glucosides Lotaustralin and Linamarin in Lotus japonicus
Plant Physiology, May 1, 2004; 135(1): 71 - 84.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
E. Wienholds, F. van Eeden, M. Kosters, J. Mudde, R. H.A. Plasterk, and E. Cuppen
Efficient Target-Selected Mutagenesis in Zebrafish
Genome Res., December 1, 2003; 13(12): 2700 - 2707.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
D. P. Lohar and D. McK. Bird
Lotus japonicus: A New Model to Study Root-Parasitic Nematodes
Plant Cell Physiol., November 15, 2003; 44(11): 1176 - 1184.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
K. A. VandenBosch and G. Stacey
Summaries of Legume Genomics Projects from around the Globe. Community Resources for Crops and Models
Plant Physiology, March 1, 2003; 131(3): 840 - 865.
[Full Text] [PDF]


This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via ISI Web of Science (94)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Perry, J. A.
Right arrow Articles by Parniske, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Perry, J. A.
Right arrow Articles by Parniske, M.
Agricola
Right arrow Articles by Perry, J. A.
Right arrow Articles by Parniske, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY® THE PLANT CELL
Copyright © 2003 by the American Society of Plant Biologists