|
Plant Physiol, March 2003, Vol. 131, pp. 866-871
SCIENTIFIC CORRESPONDENCE
A TILLING Reverse Genetics Tool and a Web-Accessible Collection
of Mutants of the Legume Lotus
japonicus1
Jillian A.
Perry,
Trevor L.
Wang,
Tracey J.
Welham,
Sarah
Gardner,
Jodie M.
Pike,
Satoko
Yoshida, and
Martin
Parniske*
The Sainsbury Laboratory (J.A.P., S.G., J.M.P., S.Y., M.P.),
John Innes Centre (Tre.L.W., Tra.W.), Colney Lane, Norwich NR4 7UH,
United Kingdom
 |
ARTICLE |
Reverse genetics aims to
identify the function of a gene with known sequence by phenotypic
analysis of cells or organisms in which the function of this gene is
impaired. Commonly used strategies for reverse genetics encompass
transposon mutagenesis (Tissier et al., 1999 ) and
RNA-mediated gene silencing or RNA interference (Voinnet,
2002 ). We adopted a complementary strategy to set up a reverse
genetics tool for the legume Lotus japonicus that identifies
individuals carrying point mutations in any gene of interest within a
large population of ethyl methanesulfonate (EMS)-mutagenized
M2 plants. This strategy was first described by
McCallum et al. (2000a ,b ) using the acronym
TILLING (Targeted Induced Local Lesions in Genomes). The target
sequence is PCR amplified from pooled M2
individuals. DNA with point mutations are detected by melting and
re-annealing of the PCR products. This results in the formation of
heteroduplex DNA in which one strand originates from the mutant and the
other from the wild-type PCR product. A mismatch occurs at the site of
the point mutation, which can be detected using mismatch-specific
endonucleases such as CEL I from celery (Apium
graveolens; Yang et al., 2000 ). This enzyme
recognizes mismatches in heteroduplex DNA and cleaves DNA specifically
at the mismatched site. The cleavage products can be separated by gel
electrophoresis, typically sequencing-type denaturing PAGE. This method
of mismatch detection is amenable to pooling strategies. In the
Arabidopsis TILLING facility, DNA of eight M2
plants is mixed to form a pool (Colbert et al., 2001 ). At this pool size, a population of 768 individuals can be screened by
PCR in a 96-well microtiter plate, and run on one 96-well gel, each
well representing eight individuals. Individuals from pools yielding
cleavage products are then PCR amplified individually to identify the
mutation bearing plant, progeny of which will segregate the mutation of interest.
Although a high-throughput TILLING facility has been successfully
established for Arabidopsis (Colbert et al., 2001 ),
several aspects of plant biology cannot be studied in this model plant; for example, root symbiosis with rhizobia and arbuscular mycorrhiza fungi, compound leaf development, aspects of flower development, and
perenniality. We chose the model legume L. japonicus
(Handberg and Stougaard, 1992 ) to establish a legume
reverse genetics tool. The genome of this plant is subject of a
sequencing project (VandenBosch and Stacey, 2003 ).
One problem associated with EMS mutagenesis is the high
frequency of infertile plants not only in the M1
but also in subsequent generations. Our aim was to assemble a general
TILLING population that would ideally be composed of fertile
individuals only, so that progeny of a plant carrying a mutant allele
can be directly recovered. A general TILLING population of 3,697 independent M2 plants was established biased
against the occurrence of severe developmental phenotypes to maximize
M3 seed availability (Fig. 1). DNA was prepared in 96-well
microtiter plate format and seed from each individual was
collected.

View larger version (24K):
[in this window]
[in a new window]
|
Figure 1.
Structure of the TILLING population.
EMS-mutagenized seed of L. japonicus B-129 "Gifu"
resulted in approximately 4,190 fertile M1
plants. M2 seed was harvested from individual
M1 plants, and M2 families
were grown individually. The families were kept separate to maximize
diversity of point mutations represented in the TILLING population.
Many M1 plants suffered from poor seed set.
Dependent on availability, up to 30 seeds were sown per
M2 family, and the resulting total of 45,600 plants were inoculated after 2 weeks with M. loti and scored
after a total of 6 weeks for the development of symbiotic
nitrogen-fixing root nodules, and screened for other developmental
defects (Table I). A single healthy-looking plant was chosen for the
general TILLING population and designated with the number SL n-1, where
n is a sequential number representing the family, whereas the number
behind the dash identifies the sibling. All interesting mutants
identified in a family were recorded and designated with consecutive
sibling numbers (SL n-2, n-3, etc.) and seed harvested individually.
Seed from all remaining plants was collected in bulk so that each seed
pack contained seeds from only one family. This seed was collected for
the purpose of future forward screens and as a backup for the isolation
of mutant alleles known to segregate in a particular family, in case
the phenotypically interesting M2 mutants were
infertile.
|
|
A specific advantage of EMS mutagenesis is that a series of allelic
mutations can be obtained, displaying a range of phenotypes that can
serve as the basis of detailed structure function studies. This also
has the potential to recover weak alleles with subtle changes in
functionality of genes that would be lethal when more strongly
affected. However, the recovery of strongly affected or knockout
alleles will often be the primary interest in species for which no
insertional knockout mutagenesis tool is established. To enrich for
plants bearing functionally impaired mutant alleles of genes involved
in a variety of developmental and metabolic processes, we scored
approximately 45,600 M2 progeny of 4,190 EMS-mutagenized M1 plants, and isolated
mutants affected in metabolism, morphology, and the root nodule
symbiosis (Figs. 1 and 2; Table I). A database
comprising information on individual mutant plants including
photographs where appropriate is accessible at
http://www.lotusjaponicus.org/finder.htm. This allows for the
assembly of trait-specific or theme-based TILLING populations enriched
for mutants affected in a particular developmental process.

View larger version (53K):
[in this window]
[in a new window]
|
Figure 2.
A selection of morphological mutants from
M2 families of L. japonicus. A,
SL1203-3 is a flower mutant bearing abnormal reiterated flower
structures. B, SL5428 exhibits a fruit phenotype with curled pods and
delayed senescence of the petals. This represents a dominant mutation
that was manifest in the M1 plant. C, In
SL2143-2, a single leaf replaces the normal five leaflets of the
compound leaf. D, SL2112-4 is a leaf shape mutant that has rounded
leaflets. E, SL189-2 shows chlorophyll variegation in the leaflets. F,
SL1077-2 has abnormal flowers in which the petals do not expand fully.
G, SL3534-2 is an extreme dwarf. H, SL2137-2 exhibits narrow
leaflets.
|
|
View this table:
[in this window]
[in a new window]
|
Table I.
Morphological, symbiotic and metabolic mutants
of L. japonicus Gifu
Mutants in categories architecture, flower, leaf, root, and stem
originate from scoring an initial 2415 M2 families (28,500 M2 plants).
A total of 3843 M2 families (45,600 plants) were screened for
nodulation mutants(a), and mutants with either no nodules,
or small white nodules as well as plants with a reduced or increased
nodule number (supernodulating mutants) were isolated. 1428 M2 families
(17,100 plants) were screened for starch biosynthesis and breakdown
(see supplementary materials)(b). The numbers recorded
represent characters scored on individual plants and thus may be
sibling aggregates. Furthermore, a single plant may be altered in more
than one character and will be recorded in more than one section. A
database comprising all the mutant information including photographs
can be found at http://www.lotusjaponicus.org/finder.htm
|
|
A pilot experiment was performed in which the SYMRK gene was
subjected to the TILLING procedure (Fig.
3). The SYMRK gene is required
for the formation of root symbioses by L. japonicus, and previously identified mutations lead to a non-nodulating phenotype (Stracke et al., 2002 ). The genomic sequence of
SYMRK from start to stop codon extends over 5,472 kb, but
the maximum length of PCR products that can be conveniently resolved by
sequencing-type PAGE is just over 1 kb. Therefore, we used the program
CODDLE (Codons Optimized to Discover Deleterious Lesions;
http://www.proweb.org/input/) to identify a region within the
SYMRK gene that would have the highest likelihood to be
functionally affected by EMS mutagenesis. EMS induces mostly
G/C to A/T transitions (Anderson, 1995 ), and CODDLE uses this information to predict the EMS-induced changes in a
coding sequence, and plots the probability of missense and nonsense
mutations along the coding sequence (Fig.
3). Second, the program searches the
predicted protein sequence under study for the occurrence of conserved
amino acid sequence blocks, with the idea that changes in such
conserved regions are less likely to be functionally neutral. Figure 3
shows part of a CODDLE output for the SYMRK gene. We
confined the screen for mutant alleles to the region encoding the
protein kinase domain. Primers for three overlapping PCR amplicons
spanning the entire kinase domain were designed (Figs. 3 and
4) using CODDLE in combination with the
PRIMER3 program (Rozen and Skaletsky, 2000 ) as set up on
the CODDLE Web page (http://www.proweb. org/input/).

View larger version (36K):
[in this window]
[in a new window]
|
Figure 3.
Effect of EMS mutagenesis on the SYMRK gene.
A, Output of the CODDLE program for 5,472 bp of genomic sequence of
SYMRK. Exons are represented by white boxes and introns by
black lines. Regions encoding Leu-rich repeat (LRR), transmembrane
domain (TM), and protein kinase region (PKR) are indicated by brackets.
The CODDLE program was used to identify regions of the SYMRK
gene in which G/C to A/T transitions are most likely to result in
deleterious effects. Each point on the plot is the sum of scores
calculated for a 500-bp window centered at that residue. A residue
susceptible to a nonsense change scored +6, to a missense change scored
0, to a silent change scored 1, and to a splice junction scored +4
(McCallum et al., 2000b ;
http://www.proweb.org/glossary.html). B, Three amplicons (primer
combination [forward and reverse[: 1, 25019 and 25027; 2, 25012 and
25013; and 3, 25020 and 25028) chosen to cover the protein kinase
region. C, Sequence of the region covered by the amplicons 1, 2, and 3, delimited by dashed lines in A. The positions and family identifier of
mutations are indicated by vertical arrows. In all identified mutants,
a G residue was mutated to an A, which is consistent with the
predominant G/C to A/T transitions induced by EMS (Anderson,
1995 ). Primer positions and orientations are indicated by
horizontal arrows. Forward primers 25019 GCACACATGCTATGATCCAGA, 25012 TCAGAGCATCAAAATTCCCAAGAAACC, and 25020 GACTACAGGGGAACCTGCAA were labeled with 6-carboxyfluorescein (6-FAM).
Reverse primers 25027 GCACACATGCTATGATCCAGA, 25013 TGCATGTTTGTTTGGAAATCCTTCTACA, and 25028 GCCTGCATGCGAAGTTATTT were labeled with
4,7,2',7'-tetrachloro-6-carboxy-fluorescein (TET).
|
|

View larger version (67K):
[in this window]
[in a new window]
|
Figure 4.
CEL1 mismatch detection. A, Fluorescence emission
scans of a 96-well gel showing CEL1-treated PCR products (primer
combination 25020 and 25028) that result in an uncut band (991 bp) and
cleavage products from mismatched heteroduplexes. Emission scans for
forward primer labeled with 6-FAM (left image) and reverse primer
labeled with TET (right image) shows cleavage products of 300, 363, 628, and 691 bp, respectively. For clarity, the insets show schematic
diagrams of the cleavage products observed in the original gels. The
numbered lanes 1 to 6 correspond to six different 3x pools containing
the following mutants (Table II): pool 1, SL1951-4; pool 2, SL1951-5;
pool 3, SL1951-6 and SL160-4; pool 4, SL1951-7 and SL160-5; pool 5, SL160-6; and pool 6, SL1951-2 and SL160-3. B, Fluorescent traces of six
individual lanes representing the pools above from the gel shown in A. The traces on the left show the scan for 6-FAM, which labels the top
strand. Cleaved (300 and 363 bp) and non-cleaved (991 bp) products were
detected, and fragment length could be estimated due to the inclusion
of size standards (not shown). The right traces represent the scan for
TET, which labels the bottom strand. Cleaved (628 and 691 bp) and
non-cleaved products (991 bp) were detected. The CEL I assay was
essentially performed as described by Colbert et al.
(2001) , but PCR was carried out in the absence of unlabeled
primer. Instead of Sephadex filtration, reaction products were
precipitated with ethanol and separated by PAGE using an ABI 377 sequencer.
|
|
A population of 117 non-nodulating plants from 75 families, 135 plants
from 112 families carrying few or small or white nodules, and 23 plants
from 21 families with abnormalities in root development were inspected
for the occurrence of point mutations in the SYMRK kinase domain.
Thirteen symbiosis-defective mutants that were isolated in an
independent mutagenesis program in other laboratories were included as
reference. Two of these (EMS34 and EMS61) had been assigned previously
to the SYMRK (Ljsym2) complementation group
(Szczyglowski et al., 1998 ; Stracke et al.,
2002 ). These 288 mutants were screened at a pool size of three
individuals per pool. In this preselected population, 15 homozygous
mutants representing six different alleles were identified that carried missense mutations. Furthermore, a mutation in plant SL391-2 in the splice acceptor site of the 11th intron was found that is likely to
affect splicing (Table II). The nonsense
mutation in EMS61 published previously (Stracke et al.,
2002 ) served as an internal reference control. All of these
mutations were detected in individuals that did not produce root
nodules upon inoculation with Mesorhizobium loti.
View this table:
[in this window]
[in a new window]
|
Table II.
Mutations in the region encoding the kinase domain
of SYMRK
The base and amino acid change are listed in addition to the position
of the mutation in genomic DNA sequence relative to the A of the start
codon. Non-nodulating M2 plants homozygous for alleles SL605, SL391, SL
1951, and SL160 set seed, and the non-nodulating phenotype was stably
inherited to the M3 generation, but the two non-nodulating individuals,
SL140-2 and SL3472-2, did not set seed. We therefore tested M3 seed
from the bulk harvested families SL140 and SL3472, but we could not
identify non-nodulating plants in the sibling progeny.
|
|
An M1 plant EMS treated at the embryo stage
represents a mosaic of differentially mutagenized cells. Because more
than one cell of the embryo gives rise to the germ line, less than 75% of the M2 progeny are expected to segregate a
particular mutant allele. Only one (SL1951) of the six novel mutant
alleles was represented in a heterozygous state in the nodulating
sibling of the general TILLING population.
The high number of functionally affected mutant alleles in the
preselected mutants shows that, depending on the purpose of the
resource, it might be advisable to include a phenotypic screen for the
trait of interest when setting up TILLING in a particular organism.
 |
ACKNOWLEDGMENTS |
We thank Paul Schulze-Lefert (Max-Planck
Institute, Cologne , Germany), Noel Ellis (John Innes Centre, Norwich,
UK, [JIC]), Brande Wulff (The Sainsbury Laboratory, Norwich, UK
[SL]), and Bradley Till (Fred Hutchinson Cancer Research Center,
Seattle, WA) for ideas and discussions; Steven Henikoff (Fred
Hutchinson Cancer Research Center) for providing CEL I; and Jens
Stougaard (University of Aarhus, Denmark) for supplying sufficient
quantities of L. japonicus "Gifu" seed for
mutagenesis We gratefully acknowledge Ruth Pothecary (JIC), Barry
Robertson (JIC), Hugh Frost (JIC), Noel Ellis (JIC), Julie Hofer (JIC),
Catherine Kistner (Deutsche Forschungsgemeinschaft, Bonn, Germany),
Scott Coomber (SL), Max Gosling (JIC), Kevin Crane (JIC), Steve Johnson
(JIC), Miriam Balcam (JIC), Sonia Hill (JIC), Rob Seale (JIC), Scott
Taylor (JIC), Thilo Winzer (SL), and all in the JIC Horticultural
Services department for help with plant handling. We thank Da Luo
(Shanghai Institute of Plant Physiology, Shanghai, China) and Cathie
Martin (JIC) for scoring flower and pigment mutants, and Mike Harvey (JIC) and Paul Bishop (JIC) for setting up the Web-accessible database. We thank David Baker (JIC) for operating the ABI377 sequencing machine.
 |
FOOTNOTES |
Received November 7, 2002; returned for revision November
11, 2002; accepted December 19, 2002.
1
This work was supported by the Biotechnology and
Biological Science Research Council (grant no. D15167 "A Reverse
Genetics Tool for Legume Functional Genomics") and grant-in-aid by
the John Innes Centre (interdepartmental research grant to T.L.W. and
M.P.), and by the Gatsby Charitable Foundation (to the Sainsbury Laboratory).
*
Corresponding author; e-mail
martin.parniske{at}sainsbury-laboratory.ac.uk; fax
44-1603-450011.
www.plantphysiol.org/cgi/doi/10.1104/pp.102.017384.
 |
LITERATURE CITED |
-
Anderson P
(1995)
Methods Cell Biol
48: 31-58[Web of Science][Medline]
-
Colbert T, Till BJ, Tompa R, Reynolds S, Steine MN, Yeung AT, McCallum CM, Comai L, Henikoff S
(2001)
Plant Physiol
126: 480-484[Free Full Text]
-
Handberg K, Stougaard J
(1992)
Plant J
2: 487-496[CrossRef][Web of Science]
-
McCallum CM, Comai L, Greene EA, Henikoff S
(2000a)
Nat Biotechnol
18: 455-457[CrossRef][Web of Science][Medline]
-
McCallum CM, Comai L, Greene EA, Henikoff S
(2000b)
Plant Physiol
123: 439-442[Free Full Text]
-
Rozen S, Skaletsky H
(2000)
Methods Mol Biol
132: 365-386[Medline]
-
Stracke S, Kistner C, Yoshida S, Mulder L, Sato S, Kaneko T, Tabata S, Sandal N, Stougaard J, Szczyglowski K, Parniske M
(2002)
Nature
417: 959-962[CrossRef][Medline]
-
Szczyglowski K, Shaw RS, Wopereis J, Copeland S, Hamburger D, Kasiborski B, Dazzo FB, de Bruijn FJ
(1998)
Mol Plant-Microbe Interact
11: 684-697[CrossRef][Web of Science]
-
Tissier AF, Marillonnet S, Klimyuk V, Patel K, Torres MA, Murphy G, Jones JD
(1999)
Plant Cell
11: 1841-1852[Abstract/Free Full Text]
-
VandenBosch K, Stacey G
(2003)
Plant Physiol
131: 840-865[Free Full Text]
-
Voinnet O
(2002)
Curr Opin Plant Biol
5: 444[CrossRef][Web of Science][Medline]
-
Yang B, Wen X, Kodali NS, Oleykowski CA, Miller CG, Kulinski J, Besack D, Yeung JA, Kowalski D, Yeung AT
(2000)
Biochemistry
39: 3533-3541[CrossRef][Medline]
© 2003 American Society of Plant Biologists
This article has been cited by other articles:

|
 |

|
 |
 
K. Voskarides and C. Deltas
Screening for Mutations in Kidney-Related Genes Using SURVEYOR Nuclease for Cleavage at Heteroduplex Mismatches
J. Mol. Diagn.,
July 1, 2009;
11(4):
311 - 318.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Welham, J. Pike, I. Horst, E. Flemetakis, P. Katinakis, T. Kaneko, S. Sato, S. Tabata, J. Perry, M. Parniske, et al.
A cytosolic invertase is required for normal growth and cell development in the model legume, Lotus japonicus
J. Exp. Bot.,
May 27, 2009;
(2009)
erp169v1.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Maekawa-Yoshikawa, J. Muller, N. Takeda, T. Maekawa, S. Sato, S. Tabata, J. Perry, T. L. Wang, M. Groth, A. Brachmann, et al.
The Temperature-Sensitive brush Mutant of the Legume Lotus japonicus Reveals a Link between Root Development and Nodule Infection by Rhizobia
Plant Physiology,
April 1, 2009;
149(4):
1785 - 1796.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Dong, J. Dalton-Morgan, K. Vincent, and P. Sharp
A Modified TILLING Method for Wheat Breeding
The Plant Genome,
March 1, 2009;
2(1):
39 - 47.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Yano, S. Yoshida, J. Muller, S. Singh, M. Banba, K. Vickers, K. Markmann, C. White, B. Schuller, S. Sato, et al.
From the Cover: CYCLOPS, a mediator of symbiotic intracellular accommodation
PNAS,
December 23, 2008;
105(51):
20540 - 20545.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Charpentier, R. Bredemeier, G. Wanner, N. Takeda, E. Schleiff, and M. Parniske
Lotus japonicus CASTOR and POLLUX Are Ion Channels Essential for Perinuclear Calcium Spiking in Legume Root Endosymbiosis
PLANT CELL,
December 1, 2008;
20(12):
3467 - 3479.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Gherbi, K. Markmann, S. Svistoonoff, J. Estevan, D. Autran, G. Giczey, F. Auguy, B. Peret, L. Laplaze, C. Franche, et al.
From the Cover: SymRK defines a common genetic basis for plant root endosymbioses with arbuscular mycorrhiza fungi, rhizobia, and Frankiabacteria
PNAS,
March 25, 2008;
105(12):
4928 - 4932.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Li, R. Berbeco, R. J. Distel, P. A. Janne, L. Wang, and G. M. Makrigiorgos
s-RT-MELT for rapid mutation scanning using enzymatic selection and real time DNA-melting: new potential for multiplex genetic analysis
Nucleic Acids Res.,
June 9, 2007;
35(12):
e84 - e84.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. K. Udvardi, K. Kakar, M. Wandrey, O. Montanari, J. Murray, A. Andriankaja, J.-Y. Zhang, V. Benedito, J. M.I. Hofer, F. Chueng, et al.
Legume Transcription Factors: Global Regulators of Plant Development and Response to the Environment
Plant Physiology,
June 1, 2007;
144(2):
538 - 549.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Sato, Y. Nakamura, E. Asamizu, S. Isobe, and S. Tabata
Genome Sequencing and Genome Resources in Model Legumes
Plant Physiology,
June 1, 2007;
144(2):
588 - 593.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Horst, T. Welham, S. Kelly, T. Kaneko, S. Sato, S. Tabata, M. Parniske, and T. L. Wang
TILLING Mutants of Lotus japonicus Reveal That Nitrogen Assimilation and Fixation Can Occur in the Absence of Nodule-Enhanced Sucrose Synthase
Plant Physiology,
June 1, 2007;
144(2):
806 - 820.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Cuppen, E. Gort, E. Hazendonk, J. Mudde, J. van de Belt, I. J. Nijman, V. Guryev, and R. H.A. Plasterk
Efficient target-selected mutagenesis in Caenorhabditis elegans: Toward a knockout for every gene
Genome Res.,
May 1, 2007;
17(5):
649 - 658.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. B. Heckmann, F. Lombardo, H. Miwa, J. A. Perry, S. Bunnewell, M. Parniske, T. L. Wang, and J. A. Downie
Lotus japonicus Nodulation Requires Two GRAS Domain Regulators, One of Which Is Functionally Conserved in a Non-Legume
Plant Physiology,
December 1, 2006;
142(4):
1739 - 1750.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Benlloch, I. d'Erfurth, C. Ferrandiz, V. Cosson, J. P. Beltran, L. A. Canas, A. Kondorosi, F. Madueno, and P. Ratet
Isolation of mtpim Proves Tnt1 a Useful Reverse Genetics Tool in Medicago truncatula and Uncovers New Aspects of AP1-Like Functions in Legumes
Plant Physiology,
November 1, 2006;
142(3):
972 - 983.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. J. Till, T. Zerr, E. Bowers, E. A. Greene, L. Comai, and S. Henikoff
High-throughput discovery of rare human nucleotide polymorphisms by Ecotilling
Nucleic Acids Res.,
August 7, 2006;
34(13):
e99 - e99.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Maeda, K. Ashida, K. Iguchi, S. A. Chechetka, A. Hijikata, Y. Okusako, Y. Deguchi, K. Izui, and S. Hata
Knockdown of an Arbuscular Mycorrhiza-inducible Phosphate Transporter Gene of Lotus japonicus Suppresses Mutualistic Symbiosis
Plant Cell Physiol.,
July 1, 2006;
47(7):
807 - 817.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Lamour and L. Finley
A strategy for recovering high quality genomic DNA from a large number of Phytophthora isolates.
Mycologia,
May 1, 2006;
98(3):
514 - 517.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Kistner, T. Winzer, A. Pitzschke, L. Mulder, S. Sato, T. Kaneko, S. Tabata, N. Sandal, J. Stougaard, K. J. Webb, et al.
Seven Lotus japonicus Genes Required for Transcriptional Reprogramming of the Root during Fungal and Bacterial Symbiosis
PLANT CELL,
August 1, 2005;
17(8):
2217 - 2229.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. D. Young, S. B. Cannon, S. Sato, D. Kim, D. R. Cook, C. D. Town, B. A. Roe, and S. Tabata
Sequencing the Genespaces of Medicago truncatula and Lotus japonicus
Plant Physiology,
April 1, 2005;
137(4):
1174 - 1181.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. L. Davis and M. G. Mitchum
Nematodes. Sophisticated Parasites of Legumes
Plant Physiology,
April 1, 2005;
137(4):
1182 - 1188.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z.-c. Dong, Z. Zhao, C.-w. Liu, J.-h. Luo, J. Yang, W.-h. Huang, X.-h. Hu, T. L. Wang, and D. Luo
Floral Patterning in Lotus japonicus
Plant Physiology,
April 1, 2005;
137(4):
1272 - 1282.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Yoshida and M. Parniske
Regulation of Plant Symbiosis Receptor Kinase through Serine and Threonine Phosphorylation
J. Biol. Chem.,
March 11, 2005;
280(10):
9203 - 9209.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Forslund, M. Morant, B. Jorgensen, C. E. Olsen, E. Asamizu, S. Sato, S. Tabata, and S. Bak
Biosynthesis of the Nitrile Glucosides Rhodiocyanoside A and D and the Cyanogenic Glucosides Lotaustralin and Linamarin in Lotus japonicus
Plant Physiology,
May 1, 2004;
135(1):
71 - 84.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Wienholds, F. van Eeden, M. Kosters, J. Mudde, R. H.A. Plasterk, and E. Cuppen
Efficient Target-Selected Mutagenesis in Zebrafish
Genome Res.,
December 1, 2003;
13(12):
2700 - 2707.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. P. Lohar and D. McK. Bird
Lotus japonicus: A New Model to Study Root-Parasitic Nematodes
Plant Cell Physiol.,
November 15, 2003;
44(11):
1176 - 1184.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. A. VandenBosch and G. Stacey
Summaries of Legume Genomics Projects from around the Globe. Community Resources for Crops and Models
Plant Physiology,
March 1, 2003;
131(3):
840 - 865.
[Full Text]
[PDF]
|
 |
|
|
|