|
|
||||||||
|
First published online March 27, 2003; 10.1104/pp.012054 Plant Physiol, April 2003, Vol. 131, pp. 1518-1528 Symplastic Continuity between Companion Cells and the Translocation Stream: Long-Distance Transport Is Controlled by Retention and Retrieval Mechanisms in the Phloem1Department of Plant Biology, Cornell University, Ithaca, New York 14853 (B.G.A., R.T.); and Institute of Plant Biology, University of Zurich, CH-8008 Zurich, Switzerland (F.K.).
Substantial symplastic continuity appears to exist between companion cells (CCs) and sieve elements of the phloem, which suggests that small solutes within the CC are subject to indiscriminate long-distance transport via the translocation stream. To test this hypothesis, the distributions of exotic and endogenous solutes synthesized in the CCs of minor veins were studied. Octopine, a charged molecule derived from arginine and pyruvate, was efficiently transported through the phloem but was also transferred in substantial amounts to the apoplast, and presumably other non-phloem compartments. The disaccharide galactinol also accumulated in non-phloem compartments, but long-distance transport was limited. Conversely, sucrose, raffinose, and especially stachyose demonstrated reduced accumulation and efficient transport out of the leaf. We conclude that small metabolites in the cytosol of CCs do enter the translocation stream indiscriminately but are also subject to distributive forces, such as nonselective and carrier-mediated membrane transport and symplastic dispersal, that may effectively clear a compound from the phloem or retain it for long-distance transport. A model is proposed in which the transport of oligosaccharides is an adaptive strategy to improve photoassimilate retention, and consequently translocation efficiency, in the phloem.
Companion cells (CCs) and sieve
elements (SEs) have a distinctly close relationship, and together form
the SE/CC complex (SECCC). Mature SEs are enucleate, devoid of all but
a few diminutive organelles, and possess an unobstructed central lumen
to accommodate the translocation stream. CCs, on the other hand, are
densely cytoplasmic, sparsely vacuolated, and have a particularly high
concentration of mitochondria (Oparka and Turgeon,
1999 The two cells are symplastically connected by distinct plasmodesmata
characterized by multiple branches on the CC side and a single branch
on the SE side that have been referred to as plasmodesmata pore units (PPUs). The presence of proteins (Fisher et al.,
1992 Plasmodesmata that are open to the passive transfer of larger molecules
would also be open to passage of smaller compounds, such that a great
deal of solute flux between CCs and SEs is expected (Turgeon,
1995 However, the disaccharide galactinol [O- To investigate the mechanisms controlling solute transfer between CCs and SEs and transport via the translocation stream, the distribution of traceable solutes originating in the CCs of Coleus blumei Benth. and transgenic tobacco (Nicotiana tabacum) were analyzed. The traceable solutes in C. blumei were Suc, galactinol, raffinose, and stachyose, photosynthetically labeled with 14CO2. In transgenic tobacco, the traceable solutes were galactinol and octopine, an ionized solute with no net charge derived from Arg and pyruvate. These exotic compounds were synthesized in the CCs of mature leaves by expressing the corresponding biosynthetic genes, galactinol synthase and octopine synthase, respectively, from a minor vein-specific promoter. By this approach, intracellular delivery of the tracers was achieved in an entirely noninvasive manner. The distribution patterns of the assayed solutes indicate unregulated
movement between CCs and SEs, and consequently, unregulated entry into
the translocation stream. However, substantial quantities of galactinol
and octopine accumulated in non-phloem compartments, indicating poor
retention within the phloem symplast. Conversely, Suc, raffinose, and
especially stachyose synthesized in the minor veins of C. blumei moved through the phloem network with limited dilution,
indicative of improved retention and efficient transport out of the
leaf. We present a model in which small solutes in the CCs enter SEs
and the translocation stream by an unregulated mechanism
Galactinol and RFO Transport in C. blumei C. blumei Benth. and members of the Cucurbitaceae
utilize RFOs as transport sugars and are model plants for symplastic
phloem loading by the polymer trap mechanism (Turgeon,
1996 The distribution of 14C-labeled saccharides in C. blumei was assessed to determine the transport characteristics of each compound. Sugars were resolved by thin-layer chromatography (TLC) in two dimensions, and the amount of each sugar present was estimated by staining and autoradiography. A representative experiment was also quantified for absolute sugar concentrations and 14C incorporation by HPLC (Table I): The specific activity of each sugar reflects the amount synthesized from photosynthetically fixed 14CO2 relative to that present at the time of labeling and that synthesized from unlabeled carbohydrate reserves.
In the C. blumei lamina, Suc was the most prevalent nonreducing saccharide (Table I). Although hexoses were identified in greater quantities, they are not generally considered transport sugars, and their low specific activities imply they are part of, or derived from, long-term carbohydrate storage pools. The predominance of Suc was expected, because Suc is the primary product of photosynthesis in both RFO- and Suc-translocating plants. The next most abundant sugar was galactinol (Table I). Although
galactinol is synthesized in the minor veins, it is present in
mesophyll cells of C. melo at concentrations as high as
one-quarter that of Suc (Haritatos et al., 1996 Stachyose and raffinose were the next most abundant sugars in the leaf,
respectively, and stachyose incorporated the highest percentage of
14C, showing that it is the major end product of
photosynthesis in C. blumei (Table I). Similar to
galactinol, raffinose and stachyose are synthesized in the minor veins,
but unlike galactinol, are not found in flanking tissues
(Haritatos et al., 1996 Labeled sugars in the petiole represent those that originated in the lamina and exited the leaf via the translocation stream during the course of the labeling experiment. Comparing the specific activity of each sugar between the petiole and the lamina provides information on the relative contribution of translocated (labeled) and local (unlabeled) pools to the total amount present. With the exception of stachyose, all analyzed sugars demonstrated a prominent reduction in specific activity, indicating the petiole had an unlabeled pool of each. Galactinol in particular demonstrated a substantial drop in specific activity, and accounted for a negligible percentage of translocated 14C. The specific activity of stachyose, however, was only modestly decreased, indicating that the stachyose in the petiole was derived directly from the translocation stream, with little dilution from a local, unlabeled pool. That stachyose is the predominant transport sugar in this species is emphasized by the high percentage of 14C incorporated into stachyose recovered from the petiole (Table I). Galactinol Transport in Transgenic Tobacco To further assess the transport properties of galactinol
synthesized in minor veins, a genomic clone of galactinol synthase from
C. melo was introduced as a transgene to tobacco. Tobacco was considered a good heterologous host for studying galactinol transport because it does not synthesize detectable quantities of
galactinol or RFOs in the leaf (Haritatos et al., 2000 Soluble sugars in mature leaves were assayed from 24 hygromycin-resistant plants by one-dimensional TLC and detection with vanillin staining (not shown). Galactinol was prevalent and accumulated to roughly equivalent amounts in the majority of these independently transformed plants. This result demonstrates that the substrates for
galactinol synthesis, myo-inositol and UDP-Gal, are readily available despite being maintained at relatively low steady-state concentrations in plant cells (Keller and Pharr, 1996 A T2 progeny plant of a transformant displaying
typical galactinol accumulation patterns was labeled with
14CO2, and soluble sugars
were analyzed as described above for C. blumei (Table
II). In the lamina of the mature leaf,
the Suc concentration was 1.53 × 103 µg g
fresh weight
The predominant transport (labeled) sugar identified by assaying the
midrib was Suc (Table II). The specific activity of Suc in the midrib
was less than that in the lamina and points to a local pool in addition
to that derived from the translocation stream. The concentration of
galactinol in the midrib was 3.39 × 103
µg g fresh weight The distribution of galactinol was further assessed by measuring the saccharide content of the apoplastic fluid in mature leaves (Table II). The concentration of galactinol in the apoplast exceeded that of Suc nearly 6-fold, demonstrating that there is substantial movement from the sites of synthesis to alternative compartments and tissues. Similarly, galactinol was identified by two-dimensional TLC in wild-type scions grafted to galactinol-synthesizing stock plants (not shown). Octopine Transport in Transgenic Tobacco Galactinol metabolism is ubiquitous among plant species because
RFO synthesis occurs in maturing seeds, frequently under drought or
cold stress, and as a prominent transport compound in some plants
(Keller and Pharr, 1996 Although several chromatographic assays exist for identifying
octopine in plant extracts, they are laborious, insufficiently sensitive, and can be misleading because they detect many endogenous plant compounds in addition to octopine (Maille, 1983
To synthesize octopine specifically in CCs of transgenic tobacco, a
fusion gene was created between ocs and uidA
(encoding the GUS protein), and placed downstream of the
CmGAS1 promoter. Octopine synthase was fused to GUS for two
reasons. First, the predicted molecular mass for octopine synthase is
38.8 kD, and the size exclusion limit for PPU between CCs and SEs may
be as high as 60 kD for globular proteins (Kempers and van Bel,
1997 Thirty-six tobacco plants, independently transformed with pGAS-OCS/GUS, were analyzed for GUS activity and the presence of octopine in mature leaves. Two plants demonstrating the highest levels of both indicators were used in further studies. These plants were designated NtGOG-12 and NtGOG-20. Long-distance transport of octopine was assayed in grafting experiments
with wild-type tobacco as scions and plants segregating for the
presence of the fusion gene as stock. As expected, the OCS-GUS fusion
protein was restricted to the minor veins of transgenic stock plants as
indicated by histochemical staining for GUS activity (Fig. 1B).
Fluorescent assays on plant extracts with the 4-methylumbelliferyl However, the product of this enzyme, octopine, was detected throughout
the plant (Fig. 1C). Octopine was detected in the sink tissues of the
scion, indicating that octopine synthesized in the CCs can enter the SE
and move long distances via the translocation stream. Furthermore,
octopine was detected in apoplastic fluids when collected with
approaches demonstrated to minimize cellular damage (Husted and
Schjoerring, 1995 Because octopine is able to move from the symplast to the apoplast, it is possible that upon reaching the stem, acropetal transport into the wild-type scion may have occurred in the transpiration stream of the xylem, rather than the translocation stream of the phloem. To establish phloem transport, reciprocal grafts were made such that wild-type plants formed the rootstock, and transgenic plants were used as scions. Two weeks after grafting, octopine was readily detected in roots, demonstrating phloem transport (not shown). The presence of octopine in the apoplast also raised the possibility
that entry into the SEs may have occurred by transmembrane transport
rather than through the PPUs connecting the CCs and SEs. To test this
possibility, 6.15 µg of octopine was delivered to the apoplast of a
mature leaf, along with 3.16 × 106 dpm of
14C-labeled Suc as a second tracer (both at 100 µM). After 24 h, 0.54% of the
14C was extracted from 100 mg fresh weight of
tissue at the vegetative apex. If octopine in the apoplast entered and
moved through the translocation stream with similar efficiency, 33 ng
(330 ng g fresh weight
Translocation through the phloem is the result of a pressure
gradient between sink tissues (low pressure) and source tissues (high
pressure). In mature leaves, high osmotic pressure is generated by the
active accumulation of photoassimilate into the SECCC of minor veins,
and is referred to as phloem loading. Thus, minor veins Octopine Distribution One of these traceable solutes was octopine. Octopine is a small molecule (246.3 D) derived from Arg and pyruvate, which is ionized but has no net charge at physiological pH. The enzyme responsible for octopine synthesis, octopine synthase, was expressed as a fusion with GUS in transgenic tobacco. The resulting enzyme has a predicted molecular mass of 110 kD. Although molecular mass does not directly reflect the hydrodynamic radius, we reasoned that a protein of this size would exceed the size exclusion limits of PPUs and be restricted to the CCs in which it was translated. Importantly, the GUS fusion allowed precise protein localization by histochemical staining, and consequently, precise identification of the sites of octopine synthesis. The fusion protein, and thus octopine synthesis, localized to the minor veins and was excluded from heterotrophic tissues (Fig. 1B). Despite this localized synthesis, octopine was detected in all tissues examined: source leaves, apoplastic fluids, and heterotrophic tissues, including the aerial sinks of wild-type scions (Fig. 1C) and wild-type roots in reciprocal grafts (not shown). These results demonstrate that octopine is transported from the site of synthesis in CCs of minor veins to SEs, and subsequently long distance to sink tissues via the translocation stream. However, octopine in the apoplast suggests that in addition to translocation, dispersal throughout the leaf may occur in the transpiration stream. Two paths for entry into the SEs are theoretically possible. The most
probable route from CC to SE is symplastically through the
PPUs that connect the two cell types. The alternative route is from CC
to the apoplast, followed by uptake into the SE. However, exogenous delivery of octopine to the apoplast did not result in
detectable transport, suggesting that octopine that leaks into the
apoplast is removed from the transport pool. This finding is expected
for a foreign molecule that is not recognized by a transporter, because
the proximity and relative purity of water in the xylem draws solutes
leaching from the phloem into the transpiration stream and effectively
concentrates them in the leaf (Hsu and Kleier, 1996
Galactinol Distribution The second traceable compound synthesized in the CCs of minor
veins in transgenic tobacco was galactinol. In C. blumei and the Cucurbitaceae, galactinol is synthesized in the intermediary cells
(specialized CCs) of minor veins as a precursor for the synthesis of
RFO (Beebe and Turgeon, 1992 The distribution of galactinol in transgenic tobacco plants paralleled that of octopine in that it was identified in high concentrations in apoplastic fluids and heterotrophic tissues. However, in labeling experiments, the majority of labeled galactinol did not reach the petiole of either C. blumei or the midrib of transgenic tobacco (Tables I and II). Our interpretation of these results is that galactinol behaves similarly to octopine, but as an unionized compound, it is retained less well within the phloem symplast. Specifically, galactinol produced in the minor veins is distributed to surrounding tissues and compartments by passive efflux, including symplastic entry into the SEs through the PPUs and entry into the apoplast. The proportion of galactinol that enters the translocation stream is then subject to further passive efflux as it moves along the path phloem (Fig. 2). This model for inefficient translocation of galactinol being the result
of poor retention within the phloem symplast is well supported by
extensive studies on the translocation of Suc. Transmembrane Suc
efflux, or leakage, occurs both in the minor veins at the sites of
loading and along the path phloem on the way to regions of demand
(Turgeon, 1984 Although galactinol is present in the apoplast, transmembrane leakage
is not the only possible mode of distribution to tissues surrounding
the SECCC. In the minor veins of all species studied to date,
plasmodesmata are present between the SECCC and surrounding tissues
(Turgeon et al., 2001 Notwithstanding the inefficient translocation of galactinol, small quantities of labeled galactinol do reach the midrib and petiole, indicating that retention within the symplast of the phloem is sufficient for long-distance transport of small amounts. The gradual loss of galactinol along the path phloem and accumulation in surrounding tissues explains the significant presence of galactinol in tissues far removed from the sites of synthesis in minor veins. RFO Distribution In the leaves of wild-type tobacco, RFOs and their essential
precursor galactinol are not detected (Haritatos et al.,
2000 In C. blumei, RFOs are the predominant transport sugars and
are synthesized in the minor veins of mature leaves (Turgeon and Gowan, 1992 The petiole was not directly labeled by photoassimilation of 14CO2; thus, radiolabeled sugars in the petiole were those transported out of the labeled lamina. Because stachyose, raffinose, and galactinol are synthesized in the minor veins, the unlabeled pools of each in the petiole likely entered the translocation stream before labeling and leached into surrounding tissues as they moved along the phloem network. With the notable exception of stachyose, the specific activities of all sugars in the petiole were markedly reduced relative to those observed in the lamina, indicating a local pool of each. Stachyose, however, demonstrated a very modest reduction in specific activity from the lamina to the petiole, suggesting that only a very small, local pool was present in the petiole, and the majority detected was in the translocation stream. An effective mechanism for keeping the local pool of RFOs small in the
lamina and petiole would be efficient transport out of the leaf.
Stachyose, as a tetrasaccharide, is predicted to be too large to pass
through plasmodesmata between intermediary cells and bundle sheath
cells (Turgeon, 1996 Solute Retention/Reclamation and Münch Pressure Flow The distribution of octopine and galactinol synthesized in the
minor veins is most consistent with unregulated movement between CCs
and SEs and subsequent long-distance transport in the translocation stream. However, leaching of both compounds from the phloem was significant, with galactinol leaching to a greater extent than octopine. Ernst Münch proposed that the translocation stream of
the phloem is driven by a pressure differential between source and sink
tissues and recognized that to maintain a pressure gradient, the
conducting elements must be leak-free, or nearly so (for discussion, see van Bel, 1993 Galactinol, like Suc, is a nonreducing disaccharide that demonstrates
significant efflux from the phloem symplast, but unlike Suc does not
appear to be retrieved. Rather, galactinol functions as a precursor in
the synthesis of raffinose, stachyose, and higher order
oligosaccharides (Keller and Pharr, 1996
Plasmid Construction All plasmid constructions were by standard procedures
(Ausubel et al., 1995 Plasmid pCamGAS1 was created to express the CmGAS1
galactinol synthase gene in the minor veins of transgenic tobacco
(Nicotiana tabacum) plants. The CmGAS1
expression cassette corresponds to a 6-kb EcoRI fragment
of Cucumis melo genomic DNA contained on pSG8E
(Haritatos et al., 2000 The plasmid pGAS-OCS/GUS was created to express an octopine
synthase gene fused in-frame to the GUS reporter gene
(uidA) in the minor veins of transgenic plants.
Initially, the CmGAS1 promoter without an ATG
translation initiation codon was subcloned into pUC19 to create
pUC-GUT. This was done in two steps. First, sequences An octopine synthase (ocs) gene fragment lacking a
stop codon was synthesized by PCR. The source of this gene was a pBR325 plasmid containing the ocs gene from pTiA6
(Escherichia coli strain E22; a gift from Stanton
Gelvin, Purdue University, West Lafayette, IN). The forward
oligonucleotide sequence was
TATCGAGGTACCGATGGCTAAAGTGGCAATTTTGG, and the reverse
oligonucleotide sequence was
CTTAAGAGCTCCCCGGGGAACTCCATTGAGAGCCCTGA. The cycling
parameters were as above, except that the annealing step was for
30 s and initiated at 65°C, dropped 0.7°C each cycle for 11 cycle, and continued at 55°C for an additional 25 cycles, and that
the extension step was for 90 s. This gene fragment was subcloned
into a pGEM3zf+ (Promega, Madison, WI) derivative as a
KpnI/SacI (recognition sites underlined
in the oligonucleotides) fragment, and sequenced. The
uidA gene was isolated from pBi101.2 (Jefferson
et al., 1987 Plant Material Variegated Coleus blumei Benth. was grown as
previously described (Turgeon and Gowan, 1992 For grafting experiments, transgenic stock plants were grown to a height of approximately 20 cm and had at least four fully mature leaves 15 cm or greater in length. Approximately 2.5 cm of the shoot apex was removed by a horizontal cut with a razor blade. For the scion, a similarly sized shoot apex was cut from a wild-type plant and secured to the stock plant with a sewing pin. Grafted plants were kept at 100% relative humidity for several days until the graft healed, acclimatized, and returned to the controlled environment chamber. Grafted plants were grown for another 2 weeks before taking samples for analysis. Apoplastic fluid was collected by the infiltration centrifugation
technique. Excised leaf samples that excluded the midrib were submersed
in deionized water and brought to 15 kPa in a vacuum chamber. Water
entered the samples upon release of the vacuum. The samples were
blotted dry and placed on parafilm. The leaf and parafilm were wrapped
together around a 1-mL syringe barrel and placed inside a 5-mL syringe
barrel that was in turn placed in a 15-mL Falcon tube. Apoplastic fluid
was collected by centrifugation in a swinging bucket rotor for 10 min
at 250g. To minimize resistance to elution, the
secondary veins of the leaf samples were oriented parallel to the long
axis of the Falcon tube. Dilution of the apoplastic fluid was
conservatively estimated to be 4-fold (Husted and Schjoerring,
1995 Octopine Assays A quantitative bioassay based on the octopine-inducible,
octopine-utilization pathway of A. tumefaciens was
established for measuring octopine concentration in plant extracts.
A. tumefaciens KYC16 is an R10-derived strain with a
promoterless Tn5-gusA7 construct inserted into the
octopine oxidase gene (ooxA) of the octopine utilization
operon (occ; Cho et al., 1996 To quantify octopine levels in plant extracts, fluorescence
resulting from octopine in leaf extracts was compared with fluorescence resulting from commercial octopine standards. To extract octopine from transgenic leaf tissue, samples that excluded the midrib were
crushed in an equal volume of water (w/v) and incubated for 15 min at
95°C. The water was then removed to a fresh tube, and the extraction
was repeated three times (Dessaux and Petit,
1994 Induction of gusA7 was negligible in the absence of octopine but was readily detectable at concentrations as low as 1 nM. Octopine concentrations from 4 to 25 nM gave an approximately linear increase in response, whereas cultures containing 50 nM octopine or greater did not demonstrate increased GUS activity, indicating saturation of the induction system (Fig. 1A). The addition of wild-type extracts from 10 mg fresh weight leaf tissue had minimal impact on the standard curves, whereas the addition of wild-type extract from 50 mg fresh weight leaf tissue reduced induction slightly, possibly representing modest catabolite repression (Fig. 1A). However, because extract from 5 mg fresh weight tissue or less was used to assay our transgenics plants, this finding has no appreciable affect on our measurements. Importantly, the addition of wild-type extract alone did not result in gusA7 induction, proving that this bioassay is specific for octopine and not induced by endogenous plant compounds. To assess octopine uptake and transport from the apoplast, 6.15 µg of
octopine and 3.16 × 106 dpm of
14C-labeled Suc were delivered to the apoplast of a mature
leaf in a solution containing 100 µM of each. A pin was
used to make a small hole in the lower epidermis of the leaf, over
which the opening of a 1-mL syringe barrel containing the tracer
solution was placed. Gentle pressure between the leaf and the syringe
barrel was applied to form a seal, and the solution was then pushed
into the intercellular spaces by gentle pressure on the syringe
plunger. This flooded approximately 2 cm2 of the leaf, and
the process was repeated until 20 cm2 of leaf area was
treated. Leaf samples were collected with a 4-mm diameter cork bore,
and the total amount of solution delivered was determined by liquid
scintillation counting (Turgeon and Gowan, 1992 All source leaves except the treated one were removed, as were all immature leaves except those less than 1.5 cm in length at the vegetative apex. After 24 h, the vegetative apex was excised, and octopine and Suc were extracted as described above. The quantity of 14C extracted was determined by liquid scintillation counting. Based on the efficiency of 14C transport, and the possibility that uptake and transport of octopine may be similar, octopine assays were set up with sufficient extract to provide final concentrations as high as 50 nM, which is enough to saturate the assay and exceed the detection limit 50-fold. Sugar Analysis Sugar analysis was essentially as described (Turgeon and
Gowan, 1992 For labeling experiments, leaf tissue was photosynthetically labeled
with 14C essentially as described (Turgeon et al.,
1993 Quantitative measurements of sugar concentration and specific activity
were as described (Bachmann and Keller, 1995 Distribution of Materials Upon request, all novel materials described in this publication will be made available in a timely manner for noncommercial research purposes, subject to the requisite permission from any third party owners of all or parts of the material. Obtaining any permissions will be the responsibility of the requestor.
We thank Roisin C. McGarry and Edwin J. Reidel for reviewing the manuscript, Stephen C. Winans for suggesting that A. tumefaciens strain KYC16 could be used in a quantitative bioassay for octopine, and Randy O. Wayne for use of equipment.
Received July 30, 2002; returned for revision September 25, 2002; accepted November 24, 2002. 1 This work was supported by the U.S. Department of Agriculture/Cooperative State Research, Education, and Extension Service/National Research Initiative Competitive Grants Program (proposal no. 2001-35318-10893 to R.T.).
* Corresponding author; e-mail bga2{at}cornell.edu; fax 607-255-5407.
Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.012054.
This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | SEARCH RESULT |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|