First published online March 20, 2003; 10.1104/pp.102.016725
Plant Physiol, April 2003, Vol. 131, pp. 1566-1575
Cloning, Expression, and Characterization of Sorbitol
Transporters from Developing Sour Cherry Fruit and Leaf Sink
Tissues1
Zhifang
Gao,
Laurence
Maurousset,
Remi
Lemoine,
Sang-Dong
Yoo,
Steven
van Nocker, and
Wayne
Loescher*
Department of Horticulture, Michigan State University, East
Lansing, Michigan 48824 (Z.G., S.-D.Y., S.v.N., W.L.); and Laboratoire
de Physiologie et Biochimie Végétales, Unité Mixte de
Recherches 6161, Centre National de la Recherche Scientifique,
Bâtiment Botanique, Université de Poitiers, 40 Avenue du
Recteur Pineau, 86022 Poitiers cedex, France (L.M., R.L.)
 |
ABSTRACT |
The acyclic polyol sorbitol is a primary photosynthetic
product and the principal photosynthetic transport substance in many economically important members of the family Rosaceace (e.g. almond [Prunus dulcis (P. Mill.) D.A. Webber], apple
[Malus pumila P. Mill.], cherry
[Prunus spp.], peach [Prunus persica
L. Batsch], and pear [Pyrus communis]). To understand
key steps in long-distance transport and particularly partitioning and
accumulation of sorbitol in sink tissues, we have cloned two sorbitol
transporter genes (PcSOT1 and
PcSOT2) from sour cherry (Prunus cerasus)
fruit tissues that accumulate large quantities of sorbitol. Sorbitol
uptake activities and other characteristics were measured by
heterologous expression of PcSOT1 and
PcSOT2 in yeast (Saccharomyces
cerevisiae). Both genes encode proton-dependent,
sorbitol-specific transporters with similar affinities
(Km sorbitol of 0.81 mM for
PcSOT1 and 0.64 mM for PcSOT2). Analyses of gene expression
of these transporters, however, suggest different roles during leaf and
fruit development. PcSOT1 is expressed throughout fruit
development, but especially when growth and sorbitol accumulation rates
are highest. In leaves, PcSOT1 expression is highest in
young, expanding tissues, but substantially less in mature leaves. In
contrast, PcSOT2 is mainly expressed only early in fruit
development and not in leaves. Compositional analyses suggest that
transport mediated by PcSOT1 and PcSOT2 plays a major role in sorbitol
and dry matter accumulation in sour cherry fruits. Presence of these
transporters and the high fruit sorbitol concentrations suggest that
there is an apoplastic step during phloem unloading and accumulation in
these sink tissues. Expression of PcSOT1 in young leaves
before completion of the transition from sink to source is further
evidence for a role in determining sink activity.
 |
INTRODUCTION |
Sorbitol (an acyclic polyol) and Suc
are the primary photosynthetic products and the major
phloem-translocated components in a number of economically important
taxa in the family Rosaceae, in particular in the subfamilies Pomoideae
(e.g. apple [Malus pumila P. Mill.] and pear [Pyrus
communis]) and Prunoideae (e.g. almond [Prunus dulcis
(P. Mill.) D.A. Webber], cherry [Prunus spp.], peach [Prunus persica L. Batsch], and plum
[Prunus spp.]) that collectively are the world's most
important tree fruit crops (Loescher and Everard, 1996 ).
Sorbitol is often the dominant translocated photosynthetic product. In
mature apricot (Prunus armeniaca) leaves, for example, 65%
to 75% of the translocated carbon is sorbitol (Bieleski and
Redgwell, 1985 ). In these species, understanding the factors
involved in facilitating and regulating sorbitol transport, including
export from the leaf, long-distance distribution via the phloem
network, and import into various sink tissues, is at least as important
as those of Suc and other sugars.
In the past 10 years, sugar transporters have been extensively studied
in various sink and source tissues with the isolation of two distinct
families of sugar carriers: the disaccharide transporters that
primarily catalyze Suc transport and the monosaccharide transporters that mediate transport of the hexose sugars (for review, see
Weise et al., 2000 ; Williams et al.,
2000 ). Active uptake of Suc across the plasma membrane in all
known cases involves an H+-Suc symporter
(Lemoine, 2000 ). The biochemical properties of the Suc
transporters have mostly been elucidated through functional expression
in yeast (Saccharomyces cerevisiae) cells where these transporters are pH dependent, electrogenic, and have a 1:1
stoichiometry (Buckhout and Tubbe, 1996 ; Lemoine,
2000 ). Expression of the Suc transporters in various plant
tissues suggests essential roles in phloem loading for Suc
translocation (Bürkle et al., 1998 ; Shakya
and Sturm, 1998 ; Noiraud et al., 2000 ) and in
growth, development, and reproduction (Gottwald et al.,
2000 ). Although much of the Suc transport work has been focused
on phloem loading, there has also been some limited work on both
monosaccharide and disaccharide transporters in sink tissues where
expression is often correlated with a high requirement for substrates
for storage, synthesis, and metabolism (Williams et al.,
2000 ).
In contrast to what we now know about the diversity of roles and
regulation of the Suc and hexose transporters, very little is yet known
about acyclic polyol transporters in either source or sink tissues of
higher plants (Noiraud et al., 2001a ). Recently, however, the cDNA of a mannitol transporter was isolated and
characterized from celery (Apium graveolens) phloem
tissues (Noiraud et al., 2001b ). Transport of mannitol
in transformed yeast cells indicated a proton symport mechanism, and
mRNA expression data were consistent with a role in phloem loading of
mannitol. Evidence of sorbitol transport is, however, much more
limited, i.e. to studies of sorbitol uptake in apple fruit tissues
(Yamaki and Asakura, 1988 ; Berüter, 1993 ; Berüter and Feusi, 1995 ) and peach
leaf plasma membrane vesicles (Marquat et al., 1997 ).
Although these results suggested a carrier-mediated process for
sorbitol transport, there is no direct evidence for any potential
transporters. None has yet been cloned, and nothing is otherwise known
of the molecular mechanisms involved in sorbitol transport in either
sink or source tissues.
Information on potential sorbitol transporters may be especially useful
because of the limited data linking sorbitol metabolism and sink
activity (especially in fruit development). Sorbitol normally does not
accumulate in apple fruit tissues (Marlow and Loescher,
1984 ), and in peach fruit it is a minor component
(Brooks et al., 1993 ), suggesting substantial metabolism
to sugars and perhaps starch. Sorbitol is metabolized via an
NAD-dependent sorbitol dehydrogenase (NAD-SorDH; Loescher et
al., 1982 ) and an oxidase (SorOX; Lo Bianco and
Rieger, 2002 ) that convert sorbitol into Fru or Glc,
respectively. NAD-SorDH has been purified and characterized (Yamaguchi et al., 1994 ), and its cDNA has been cloned
(Yamada et al., 1998 ), but in some fruits there are
multiple isoforms (Park et al., 2002 ). NAD-SorDH
activities are sometimes correlated with fruit development and with
sugar accumulation (Yamaguchi et al., 1994 ,
1996 ; Lo Bianco et al., 1999 ); however, such
studies may be confounded if there are multiple isoforms. Immunoblot
analysis has shown that enzyme protein levels were low in young apple
fruit but then increased as fruit matured (Yamaguchi et al.,
1996 ), and mRNA similarly increased during several stages of
fruit development (Yamada et al., 1998 ). However, a
close relationship between NAD-SorDH activity and relative fruit growth
rate could not be established in young apple tissues (Yamaguchi
et al., 1996 ). Similarly, relationships between SorOX and fruit
growth depend on stage of development (Lo Bianco et al.,
1999 ). Thus, other enzymes, e.g. Suc synthase (SuSy) and
various invertases, may be important to determining overall sink
activity. However, data linking SuSy and invertases to sink activities
are also difficult to interpret given the multiple forms of SuSy
(Komatsu et al., 2002 ) and its control by
phosphorylation status (Tanase et al., 2002 ) and the
potential effects of invertase inhibitors (Greiner et al.,
2000 ; Winter and Huber, 2000 ). All of this
argues for further investigations of sink activities in these tissues
with a focus on transporter identification and characterization.
In cherries, fruit development is often described as consisting of
three stages that are depicted as a double-sigmoid growth curve
(Tukey and Young, 1939 ), i.e. with enlargement occurring during Stages I and III (for example, see Fig.
1A). Cell division and some growth occur
early in Stage I, endocarp development (pit hardening), but little
growth, occurs in Stage II, and maturation and ripening (as measured by
softening and color development) begin early in stage III at the same
time as most of total fruit growth and dry matter accumulation. Our
preliminary data indicated that, unlike peach and apple, there is
substantial sorbitol accumulation in sour cherry (Prunus
cerasus) stage III fruit tissues with limited or little direct
involvement of either SorDH or SorOX. Sweet cherry (Prunus
avium) accumulates even larger amounts of sorbitol and other
soluble carbohydrates in mature fruit (Roper and Loescher, 1987 ). Also, unlike apple or peach (Flore and Layne,
1996 ), there is no evidence that these species first accumulate
starch. Such data suggest a major role for sorbitol transport in
defining and controlling sink activity in cherry fruit development.
Given that both Suc and mannitol transport are active,
H+-driven, symport processes, we hypothesized
that sorbitol transport and accumulation in cherry fruit tissues
involve similar mechanisms. Here, we report the isolation and cloning
and the heterologous expression and characterization in yeast of two
sorbitol transporter genes from sour cherry fruit and developing leaf
tissues.

View larger version (25K):
[in this window]
[in a new window]
|
Figure 1.
A, Sour cherry fruit growth and the three stages
of fruit development. Each point is the mean of 20 to 60 fruit
(SEs are obscured by the symbols). B, Changes in Glc, Fru,
and sorbitol content per fruit during development. Cherries were
sampled at eight growth stages, from young to mature fruit (5, 16, 25, 36, 42, 50, 59, and 64 DPA). Each point is the mean of measurements
with fruit from three different trees, with at least 6 g of fruit
pericarp collected from each tree. Error bars = SEs.
|
|
 |
RESULTS |
Sorbitol and Hexose Accumulation
Cherry fruit growth was typical, with a biphasic increase in fruit
diameter and weight (Fig. 1A; Tukey and Young, 1939 ).
Our fruit samples represented several stages in development, from young
green fruit with soft endocarp tissues (pits; Stage I, 5-20 DPA) to
straw-colored fruit with hardening pits (Stage II, 20-35 DPA), and
then to pink and finally dark-red mature fruits (Stage III, 35-65 DPA;
Fig. 1A). Glc, Fru, and sorbitol were the major carbohydrate components
in both young and mature fruits. Fruit growth and accumulation of
sorbitol and hexoses increased very rapidly after pit hardening when
fruit changed in color from straw to pink (after 35 DPA) and then
continued until the last harvest date (Fig. 1B). At 64 DPA, fruit
(exclusive of pit and seed) typically contained approximately 120 mg of
both Glc and Fru, and about 100 mg of sorbitol, for a total of 340 mg.
Although trace amounts of inositol were invariably present, starch and
Suc were not detected at any stage of fruit development.
Cloning of Sorbitol Transporters Genes
To identify potential sorbitol transporters, we used reverse
transcriptase-PCR and degenerate primers corresponding to
conserved regions of "sugar transporters." From ripening
fruit-derived cDNAs, this approach resulted in the isolation of an
820-bp cDNA with extensive sequence homology with a celery phloem
mannitol transporter (AgMaT1; Noiraud et al., 2001b ). A
cDNA library screen isolated nine positive clones, and these were
sequenced. Eight clones represented a single sequence and differed only
in the length of the 5'- and 3'-untranslated regions. The longest cDNA
was sequenced in its entirety. This cDNA was 1,927 bp long, potentially
encoding a protein of 509 amino acid residues with a predicted
molecular mass of 55 kD and pI of 8.38 (called
PcSOT1 here, AF482011; Fig.
2A). The ninth isolated cDNA was distinct
(called PcSOT2 here, AY100638) and was 2,032 bp long with a
1,617-bp coding region, potentially encoding a protein of 538 amino
acid residues, a predicted molecular mass of 59 kD, and a pI of
9.26 (Fig. 2A). This PcSOT2 clone shared an 85% nucleotide
sequence identity with PcSOT1 in the coding region and an
amino acid similarity of 76%.

View larger version (89K):
[in this window]
[in a new window]
|
Figure 2.
A, Comparison of the deduced amino acid sequences
of the sour cherry PcSOT1 and PcSOT2 cDNAs with a
mannitol transporter AgMaT1 from celery. Shaded
sequences are identical, the doubly underlined sequences correspond to
those conserved in the sugar transporter subfamily of the major
facilitator superfamily, and those in bold are putative
membrane-spanning sequences. B, Putative transmembrane helical domains
for PcSOT1 and PcSOT2. PM, Plasma membrane; N, N termini; C, C
termini.
|
|
In contrast with many sugar transport proteins with a 6 + 6 arrangement
of transmembrane domains (Buckhout and Tubbe, 1996 ), the
deduced amino acid sequence of both PcSOT1 and
PcSOT2 genes here appeared to have 11 putative
membrane-spanning domains with a 6 + 5 arrangement. However, the
sequences responsible for these differences were nearly identical to
that of AgMaT1, which has a 6 + 6 arrangement; thus, the 6 + 5 model
may be an artifact of the hydropathy analysis. The N termini and
central loops are located on the cytoplasmic side, but in the 6 + 5 model the C termini loops are located on the outside (Fig. 2B). The
consensus sequences for sugar transporters, PESPRWL, GRRPLLL, and
PETQGRTLE, are all present. BLAST results showed that the sequences of
PcSOT1 and PcSOT2 are also similar to an
uncharacterized putative sugar transporter from Arabidopsis (accession
no. NP-188513), the celery phloem mannitol transporter (accession no.
AF-215837; Noiraud et al., 2001b ), and two putative
sugar transporters from sugar beet (Beta vulgaris;
accession nos. T-14617 and T-14606; Chiou and Bush,
1996 ). A phylogenetic tree was constructed from a Clustal alignment of 23 different sugar transporters (Fig.
3). The 23-amino acid sequences are
divided into four major subgroups. The PcSOT1 and
PcSOT2 are closest to a group of putative sugar transporters in which only the mannitol transporter (accession no. AF-215837) has a defined function. PcSOT1 and PcSOT2 do not
appear to be closely related to known Suc transporters (accession nos.
T-14340, BAA-89458, and AF-167415) or hexose transporters (accession
nos. CAA-04511, CAB-52689, S-25015, P-23586, NP-267659, NP-289515, and
NP-461933), and these sorbitol transporters are also quite distinct
from myo-inositol transporters (accession nos. NP-593320 and
Q-10286; Fig. 3). Nonetheless, like the mannitol transporter from
celery plants (Noiraud et al., 2001b ), PcSOT1 and PcSOT2 are both clearly members of the major facilitator superfamily (Marger and Saier, 1993 ), and the hydrophobicity
analyses indicate that, like the disaccharide and monosaccharide
transporters, they are highly hydrophobic integral membrane
proteins.

View larger version (32K):
[in this window]
[in a new window]
|
Figure 3.
Phylogenetic tree of related sequences. Alignment
was performed with DNASTAR-MegAlign (GCG Inc., Madison, WI). GenBank
accession numbers for the amino acid sequences are: P-45598 and
NP-461933, putative Ara transporters; NP-289515, a putative Gal
transporter; O-52733 and NP-267659, putative Xyl transporters;
NP-593320 and Q-10286, myo-inositol transporters; P-23586,
CAA-04511, S-25015, and CAB-52689, hexose transporters; AF-416867, a
putative rice (Oryza sativa) sugar transporter;
T-14617, a putative sugar beet sugar transporter; AF-215837 and
AF-480069, the celery mannitol transporters; NP-179209, NP-188513, and
NP-195385, putative Arabidopsis sugar transporters; and T-14340,
BAA-89458, and AF-167415, Suc transporters. Dotted lines indicate a
negative branch length.
|
|
Characterization of PcSOT1 and PcSOT2 in Yeast
To determine the transport functions of PcSOT1 and
PcSOT2, the yeast strain RS453 was transformed with the
recombinant plasmid pDR196 containing either PcSOT1 or
PcSOT2. RS 453 is unable to grow on synthetic
complete (SC) medium with sorbitol as a sole carbon source, and
endogenous sorbitol dehydrogenase activity is undetectable (Z. Gao, R. Lemoine, and W. Loescher, unpublished data). To reduce Glc
suppression of the expression of PcSOT1 and PcSOT2 in yeast, the transformed yeast cells were first
inoculated overnight on SC-Glc medium and then inoculated on
SC-glycerol medium supplemented with 0.05% (w/v) Glc. Using
14C-labeled sorbitol to perform uptake
experiments, yeast cells expressing PcSOT1 or
PcSOT2 showed 5- to 6-fold higher rates of uptake of
14C-labeled sorbitol than yeast transformed with
the empty pDR196 plasmid (Fig. 4). All
the uptake experiments were run on three independent yeast clones with
similar results. The average slopes were 5.0 and 2.8 nmol sorbitol
taken up min 1 mg
protein 1 for PcSOT1 and PcSOT2, respectively,
compared with 0.22 for cells transformed with the control pDR 196 plasmid (Fig. 4). Sorbitol uptake by both cherry fruit transporters
decreased rapidly from pH 4.5 to 5.5 with little activity remaining
above pH 5.5 (Fig. 5). Using
radiolabeled Suc and mannitol, we also compared, in yeast expressing
these two transporters, uptake of mannitol, an isomer of sorbitol, and
uptake of Suc, which is also transported in cherry fruit. These results
showed that the cherry fruit transporters were relatively specific,
with uptake rates for mannitol and Suc of 3.6% and 12.5%,
respectively, of that for sorbitol. The proton uncoupler carbonyl
cyanide m-chlorophenylhydrazone (CCCP) markedly inhibited
sorbitol uptake (Table I), indicating
that sorbitol transport is linked to the proton electrochemical
potential across the plasma membrane. However, sorbitol uptake was not
inhibited by the presence of the thiol reagent
p-chloro-mercuribenzene-sulphoic acid (PCMBS; Table I). Other
sugars and polyols at a 10-fold external concentration showed different
effects on sorbitol transport (Table I). The presence of Suc or xylitol
indicated only a little effect on transport by PcSOT1 and did not
inhibit transport by PcSOT2. Man, Glc, Fru, and mannitol all strongly
inhibited uptake of sorbitol by PcSOT1, but PcSOT2 was less affected
(Table I).

View larger version (17K):
[in this window]
[in a new window]
|
Figure 4.
Uptake of sorbitol by transgenic yeast cells.
RS453 cells were grown to the early logarithmic phase. Uptake of 0.5 mM [14C]sorbitol was measured at an
external pH of 4.5. Three independent yeast clones transformed with
PcSOT1 or PcSOT2 were tested (all with similar
results) and compared with one clone expressing empty pDR196. The
results are the means ± SE of four
replicates.
|
|

View larger version (15K):
[in this window]
[in a new window]
|
Figure 5.
pH dependence of sorbitol transport in transgenic
yeast cells expressing PcSOT1 or PcSOT2.
Measurements were performed at 0.5 mM sorbitol in
SC medium containing 25 mM MES buffered at the
indicated pH. Incubation time was 2 min. The results are the means ± SE of four replicates.
|
|
View this table:
[in this window]
[in a new window]
|
Table I.
Sensitivity of the sorbitol transporter (PcSOT1 and
PcSOT2) activity to inhibitor (at the indicated concentration) and
other sugar or sugar alcohol substances (5 mM)
The substances were added 30 s prior to 14C- or
3H-labeled sorbitol. All uptake tests were performed at 0.5 mM sorbitol (pH 4.5), and incubation time was 3 min.
Control activities (100%) were 5.19 and 4.03 nmol mg 1
protein min 1 for PcSOT1 and PcSOT2, respectively. The
results are the means of four replicates expressed as relative uptake
rate to sorbitol.
|
|
When uptake of sorbitol by PcSOT1 and PcSOT2 in yeast was assayed at
concentrations ranging from 0.1 to 4 mM, we obtained Michaelis-Menten saturation plots (Fig. 6). The two transporters showed
similar apparent affinities for sorbitol
(Km of 0.81 mM for
PcSOT1 and 0.64 mM for PcSOT2 at pH 4.5). These
yeast expression results collectively confirmed that both
PcSOT1 and PcSOT2 function as sorbitol
transporters.

View larger version (21K):
[in this window]
[in a new window]
|
Figure 6.
Concentration dependence of sorbitol transport in
transgenic yeast cells expressing PcSOT1 (A) or
PcSOT2 (B). The results are means ± SE of four replicates. The inset shows a
Lineweaver-Burk plot of the uptake data.
|
|
Expression of PcSOT1 and PcSOT2
Because the PcSOT1 shares 85% nucleotide sequence
identity with the PcSOT2 cDNA, a risk of cross-hybridization
had to be avoided. Therefore, we PCR amplified a 400-bp unique
nucleotide sequence found in the 3'-untranslated region of
PcSOT1 and a 485-bp sequence in the 3'-untranslated region
of PcSOT2. The two 3' sequences share only a 31% level
of identity and, thus, should be gene-specific probes for
PcSOT1 and PcSOT2, respectively. RNAs hybridizing
with these probes were investigated at various stages of fruit
and leaf development (Fig.
7).
Although detectable throughout fruit development, RNAs hybridizing with
the PcSOT1 probe increased, first late in pit hardening
(Stage II), and then quite substantially with onset of high sorbitol
accumulation rates at 40 DPA (early in Stage III). During the later
stages of ripening in Stage III, the abundance of these RNAs slightly
decreased (Fig. 7A). RNAs hybridizing with the PcSOT1 probe
were also high in young and expanding leaves but were substantially
decreased in fully mature leaf tissues (Fig. 7B). In contrast, RNAs
hybridizing with the PcSOT2 probe were mainly evident in
young fruit (Stages I and II) before the onset of sorbitol accumulation
(Fig. 7A), with the highest expression during pit hardening and then
decreasing as fruit developed. PcSOT2 expression, as measured with the
PcSOT2 probe, was not detected in any leaf tissues (data not
shown).

View larger version (47K):
[in this window]
[in a new window]
|
Figure 7.
A, RNA gel-blot analysis of sorbitol transporters
(PcSOT1 and PcSOT2) genes in developing cherry
fruit at different stages (I-III, as shown at the top of the blots)
and also at different days after flowering (as shown on the bottom of
blots). B, RNA gel-blot analysis of a sorbitol transporter
(PcSOT1) in developing cherry leaves, from quite immature
leaves, just beginning to expand (on the left) to fully expanded (on
the right). In A and B, the probes used for hybridization are indicated
to the left of each blot. PcSOT1 and PcSOT2 were
gene-specific probes from 3'-untranslated regions, prepared by PCR.
Loading of each lane, 20 µg of total RNA, was verified by reprobing
the blot with an 18S rRNA probe from Arabidopsis.
|
|
 |
DISCUSSION |
Both monosaccharide and disaccharide transporters have now been
characterized in many plants. The technique used for characterization of these and other transporters is almost invariably heterologous expression in yeast and similar systems (Dreyer et al.,
1999 ). Some of these transporters have been reported in various
sink tissues including those of roots, floral organs, and developing and germinating seeds, and several are also associated with
plant-microbial interactions (Williams et al., 2000 ).
However, with one exception (Fillion et al., 1999 ),
there has been practically no work on identification and
characterization of sugar transporters in perennial fruit crops where
carbohydrate accumulation in sink (fruit) tissues is often a critically
important component of crop productivity and quality. As a further
consideration, many of these plants produce, transport, and metabolize
not only Suc, but also other photosynthetic products, e.g. an acyclic
polyol such as mannitol or sorbitol or one or more members of the
raffinose family of oligosaccharides. Of the acyclic polyols, only one
transporter has thus far been characterized, the AgMaT1 mannitol
transporter from celery phloem (Noiraud et al., 2001b ).
Many members of the Rosaceae (the pome and stone fruits, in the
subfamilies Pomoideae and Prunoideae, respectively) and several other
families transport and accumulate sorbitol, but the mechanisms involved
in sorbitol membrane transport have not been defined. We have now
isolated and characterized by heterologous expression two putative
sorbitol transporters (PcSOT1 and PcSOT2) from sour cherry fruit
tissues that accumulate high levels of sorbitol, especially
at the later stages of fruit maturation. Yeast cells expressing
PcSOT1 and PcSOT2 take up sorbitol quite
efficiently and specifically when compared with cells containing only
the vector (Fig. 4). The two transporters in the yeast system were
H+ dependent, with optimal activities at acidic
pH levels, similar to Suc/H+ symporters. In
addition, the proton uncoupler, CCCP, completely inhibited sorbitol
uptake. These results suggest that the two transporters both act as
proton/sorbitol cotransporters, with the proton pump ATPase creating
the pH and potential differences across the plasma membrane to drive
sorbitol transport. The two transporters, however, were not sensitive
to the addition of the thiol group reagent PCMBS, which is in contrast
to the high sensitivity of Suc transporters (Noiraud et al.,
2000 ), but similar to the mannitol transporter AgMaT1 isolated
from celery phloem (Noiraud et al., 2001b ). The
Km of 0.6 to 0.8 mM
sorbitol for PcSOT1 and PcSOT2 in yeast indicates a 60- to 70-fold
higher affinity compared with the Km of 35 to 55 mM sorbitol obtained from uptake studies of
apple tissues (Berüter, 1993 ) but it is consistent
with the Km of 0.67 mM sorbitol reported for peach leaf plasma
membrane vesicles (Marquat et al., 1997 ). The
Km values here are also in the same range
as those reported for mannitol and most Suc carriers (Noiraud et
al., 2001a , 2001b ).
PcSOT1 and PcSOT2 were both quite specific for sorbitol: The mannitol
transport rates were quite low, only 3% that of sorbitol. In contrast,
the celery mannitol transporter, AgMaT1, transports a variety of
acyclic polyols, among them sorbitol, although rates are lower than
those for mannitol (L. Maurousset and R. Lemoine, unpublished data).
Mannitol, despite its low uptake rates, did, however, inhibit transport
of sorbitol by both PcSOT1 and PcSOT2, presumably by competing for the
active site. Despite its conformational similarities to sorbitol,
xylitol had little effect on sorbitol transport. The inhibitory effects
of Glc and Fru are similar to those observed with AgMaT1
(Noiraud et al., 2001b ), but these may be an artifact of
heterologous expression in yeast where transporter expression is often
repressed with addition of Glc or Fru (Horak and Wolf,
1997 ; Noiraud et al., 2001b ). Thus, comparisons
of Glc and Fru uptake in relation to PcSOT1 and PcSOT2 may not be
applicable to this yeast system. Nonetheless, as in the case with
the mannitol transporter (Noiraud et al., 2001b ),
the presence of either sorbitol transporter, PcSOT1 or PcSOT2, did
not significantly enhance radiolabeled Glc uptake in RS 453 cells (Z. Gao, R. Lemoine, and W. Loescher, unpublished data). Further, Glc or
Fru effects on sorbitol transporter activity in cherry fruit seem
unlikely given the quantities of Glc, Fru, and sorbitol in Stage III
cherry fruit storage parenchyma (Fig. 1A); however, the transporter may
not be influenced by these sugars due to compartmentation.
Because sorbitol and mannitol are isomers, a high degree of
homology between the cDNAs of the sorbitol and mannitol carriers might
be expected. PcSOT1 and PcSOT2 cDNA sequences are
quite similar to AgMaT1; however, the two cherry transporters do
not otherwise have close sequence relationships to the known
hexose and Suc transporters (Fig. 3). Although the functions of those genes (sequences) closely grouped with the acyclic polyol transporters in Figure 3 (e.g. from sugar beet, rice, and Arabidopsis) remain to be
determined, the similarities to the two sorbitol transporters may
provide further arguments for considering that these may encode acyclic
polyol transporters. As such, the results here may also indicate that
these transporters represent a distinct group of transporters.
Consistent with its function in yeast and with its proposed role as a
sorbitol transporter, PcSOT1 was expressed mainly later in
fruit development (Fig. 7A), coincident with the high rates of sorbitol
accumulation and fruit growth during Stage III. Thus, the data here are
not only consistent with PcSOT1 as a sorbitol transporter,
but also with the hypothesis that it may play an important role in
sorbitol accumulation, particularly later in sour cherry fruit
development. Similar results, i.e. correlations of expression with
sugar accumulation, have been observed for a hexose transporter in
ripening grape (Vitis vinifera; Fillion et
al., 1999 ). The expression pattern of PcSOT2 (Fig.
7A) indicates that although this transporter may not be directly
involved in the later stages of sorbitol accumulation, it may have a
specific function earlier in fruit growth at or before pit hardening
(at Stage II) or about the time when the fruit experiences the first increases in growth and dry matter accumulation (during Stage I).
Given that we measured only relatively low levels of SorDH
gene expression and enzyme activities throughout development (data not
shown), a major role for SorDH in cherry fruit growth and dry matter
accumulation seems unlikely. The dramatic increases in sorbitol
accumulation during Stage III of fruit development would instead appear
to result primarily from sorbitol transport and not SorDH activity.
However, variability in the sorbitol to Suc ratio in mature leaves of
different Prunus spp. has been observed (Moing et
al., 1997 ), and it is possible that the cherry fruit import
relatively more sorbitol, compared with Suc, at the later stages of
development. Or, as is more likely, Suc is hydrolyzed to Glc and Fru by
invertase, leaving sorbitol to accumulate in the absence of substantial
SorDH activity or detectable SorOX.
Thus, all these data, and especially those indicating relatively high
expression of PcSOT1 at the later stages of fruit
development when sorbitol accumulation rates are highest, are
consistent with a significant role for a sorbitol transporter in
sorbitol accumulation in maturing sour cherry fruit. Similarly, the
presence of PcSOT2 at earlier stages of fruit development is also
consistent with a role in fruit growth and dry matter accumulation.
Presence of these transporters and the high fruit sorbitol
concentrations suggest that there is an apoplastic step during phloem
unloading and accumulation in these sink tissues. In addition,
expression of PcSOT1 in developing leaf tissues indicates
one or more additional roles in sink tissues, e.g. in utilization,
storage, or compartmentation in leaf tissues as these undergo the
transition from sink to source. Expression of PcSOT1 and
PcSOT2 is obviously tightly regulated, which has several
implications for regulation of sink activities and partitioning
mechanisms in sour cherry tissues. Although these proteins are
presumably targeted to the plasma membrane in yeast, further
confirmation of roles for these transporters in defining sink activity
will require information on their upstream regulatory sequences and on
their precise localization at the cell and membrane level in planta.
 |
MATERIALS AND METHODS |
Sour cherry (Prunus cerasus L. cv Montmorency)
fruits were collected from 5 to 64 DPA from trees located at the
Horticulture Research Center (Michigan State University, East Lansing).
The fruit samples represented all the important stages in fruit
phenology, with the last sample consisting of fully mature, dark-red
fruit. All fruits were immediately pitted and frozen in liquid nitrogen before storage at 80°C. Leaves were sampled mid-season from
developing shoots that provided a range of leaf ages from buds and
young sink leaves to fully expanded, fully photosynthetically competent source leaves. All leaf samples were frozen in liquid nitrogen and then
stored at 80°C.
Analysis of Soluble Sugars and Starch
Fruit samples (about 2 g fresh weight) were extracted three
times with 10 mL of 80% (v/v) ethanol for 1 h at 70°C, and the extracts were pooled. Triplicate samples were prepared for each stage
of fruit development. They were then vacuum evaporated to dryness at
60°C, redissolved in 1 mL of distilled water, and 0.5 mL of the
solution was passed through a Sep-Pak C18 column (Waters, Milford,
MA) and a 0.22-µm filter (Gelman Sciences, Ann Arbor, MI).
Aliquots (10 µL) were injected into a Waters HPLC system equipped
with a Shodex SC1011 carbohydrate column (6.5 × 300 mm, Shoko
Co., Ltd., Tokyo) and a refractive index detector. The sugars were eluted (with water at 1.0 mL min 1) and identified
and quantified by comparison of retention times and peak areas with
standards of known sugars. All the data were processed with an HPLC
on-line computer using Waters Millennium32 software
(version 3.05). Starch was analyzed by digesting the residues with
amyloglucosidase followed by quantification of the resulting Glc using
Glc oxidase.
cDNA Library Construction and Gene Cloning
Total RNA was isolated as previously described by Hunter
and Reid (2001) . Poly(A+) RNA was isolated from
total RNA by oligo(dT)-cellulose column chromatography (CLONTECH
Laboratories, Inc., Palo Alto, CA). Four cDNA libraries (two from each
stage of development) were constructed in a Uni-Zap XR vector according
to the manufacturer's instructions (Stratagene, La Jolla, CA) using
the poly(A+) mRNA from quite immature green (about 12 DPA)
and fully mature red (53 DPA) fruit mesocarp tissues. The primary
libraries were amplified according to the manufacturer's protocols and
represented at least 1 × 106 clones. Analysis of the
sequences was carried out at the Genomics Technology Support Facility
at Michigan State University. Sequence analyses were performed using
DNASTAR (GCG Inc.), and data comparisons were through the BLAST server
at the National Center for Biotechnology Information (Bethesda,
MD). Transmembrane regions were predicted using Hidden Markov Model
Topology Prediction (Tusnady and Simon, 1998 ).
A putative sorbitol transporter PcSOT cDNA was
amplified from ripening fruit by reverse
transcriptase-PCR. Degenerate primers were designed based on a
sugar transporter region conserved among numerous plants
(Noiraud et al., 2001a ). The primers were G62 [forward
5'.GA(A/G)TC(T/C/A/G)CC(T/C/A/G)CG(T/C/A/G) TGGCT.3'] and G60
[reverse 5'.CG(T/C/A/G)CC(T/C)TG(T/C/A/G)GT(T/C)TC(T/C)GG.3']. The forward primer corresponds to an ESPRWL conserved motif, and the
reverse primer corresponds to an RGQTEP conserved motif. This cDNA was
cloned to pGEM easy vector (Promega, Madison, WI) according to
the manufacturer's instructions and sequenced. The cDNA was then used
as a probe to screen approximately 40 × 104
recombinant phages from the ripening fruit-derived cDNA library according to the manufacturer's instructions. Putative
PcSOT clones were isolated and sequenced at the Genomics
Technology Support Facility.
Expression and Characterization of PcSOT1 and PcSOT2 in Yeast
(Saccharomyces cerevisiae)
The PcSOT1 and PcSOT2 cDNAs were
ligated into the EcoRI-XhoI sites of the
yeast shuttle vector pDR196 (Rentsch et al., 1995 ). This
vector allows expression of full-length cDNA under the control of the
yeast PMA1 promoter. Yeast strain RS 453 (Sauer and Stadler, 1993 ), which lacks the uracil gene for selection of recombinant cells, was transformed with the cDNAs according to the method of
Dohmen et al. (1991) . Cells transformed with empty
pDR196 plasmid were used as controls.
Uptake of Radiolabeled Sorbitol
The uptake of sorbitol was followed as described by
Noiraud et al. (2001b) . Yeast cells were initially grown
overnight in SC medium supplemented with 2% (w/v) Glc and then
transferred to SC medium supplemented with 3% (w/v) glycerol
and 0.05% (w/v) Glc. The cell were grown for 16 h to the
early logarithmic phase, washed with distilled water, and resuspended
to 1% (w/v) in SC medium containing 25 mM MES (pH 4.5).
For each sorbitol uptake assay, 100 µL of the cell suspension was
mixed with 100 µL of suspension buffer containing 0.5 mM
sorbitol at 14C-sorbitol-specific activity (11.5 GBq
mmol 1), although 3H-sorbitol was sometimes
used (with a similar specific activity). Cells were incubated at 28°C
for 0, 1, 2, 3, and 5 min on a water bath. Sorbitol uptake was stopped
by the addition of 4 mL of ice-cold water and filtered on glass fiber
filters in a vacuum filtration apparatus. Cells were rapidly washed
three times with 4 mL of ice-cold water and transferred to liquid
scintillation vials and counted. To determine relative uptake rates of
mannitol and Suc by the transformed yeast cells, 0.5 mM
mannitol at 3H-mannitol-specific activity (14.8 MBq
mmol 1) or 0.5 mM Suc at 14C-Suc
at specific activity (14.8 MBq mmol 1) was used for
uptake. For inhibition studies, a protonophore (50 µM
CCCP) or a thiol reagent (100 µM
p-chloro-mercuribenzenesulphonic acid) was added
30 s before the sorbitol uptake assay. Similarly, for the sugar
and acyclic polyol competition studies, 5 mM of each
compound was added 30 s before the assay. To measure the Km values of PcSOT1 and PcSOT2, sorbitol
concentrations of 0.1, 0.2, 0.5, 1, 2, and 4 mM
and an uptake time of 2 or 4 min were used. The pH dependence of
sorbitol uptake was also determined. The yeast cells were grown and
treated as described above but were resuspended in SC medium containing
25 mM MES at pH 4.5, 5.5, 6.5, or 7.5. All the
uptake experiments were repeated at least four times with the pDR 196 empty vector-transformed cells as controls.
RNA Gel-Blot Hybridization
Twenty micrograms of total RNA was separated on 1.3%
(w/v) agarose gel under denaturing (formaldehyde) conditions.
RNA was capillary transferred (Sambrook et al., 1989 ) to
Hybond N+ nylon membranes (Amersham, Buckinghamshire,
UK) overnight in 20× SSC and fixed to the membrane at 80°C
for 1.5 h. Gene-specific DNA probes were prepared for
PcSOT1 and PcSOT2 by PCR. The primers were 5' CAGAAACAAAGGGCCGTCG 3' and T7 for PcSOT1 and 5'
GCAAGTTGATCATGGTGATG 3' and T7 for PcSOT2. Random
priming was used to -32P-label cDNA of PcSOT1 and PcSOT2
using a NEBlot kit (New England Biolabs, Inc., Beverly, MA) according
to the manufacturer's instructions. Membranes were hybridized and
washed with low-salt buffer as described previously (Gao and
Loescher, 2000 ). The mRNA abundances were captured on a
PhosphorImaging screen (Molecular Dynamics, Sunnyvale, CA). The same
blots were washed at 90°C for 30 min in a solution containing 2%
(w/v) SDS, 0.5 M Tris (pH 7), and 0.1 mM
EDTA to strip off the probes, and rehybridized with a
32P-labeled probe of 18S rRNA from
Arabidopsis to standardize for RNA loading.
Naming of PcSOT1 and PcSOT2 followed a
search of the Mendel CPGN database, and no SOT synonyms exist.
Distribution of Materials
Upon request, all novel materials described in this publication
will be made available in a timely manner for noncommercial research
purposes, subject to the requisite permission from any third party
owners of all or parts of the material. Obtaining any permissions will
be the responsibility of the requestor.
 |
FOOTNOTES |
Received October 25, 2002; returned for revision November 24, 2002; accepted January 29, 2003.
1
This work was supported by Michigan State
University (Project GREEEN) and by the Centre National de la Recherche
Scientifique (France; special fellowship to Z.G.).
*
Corresponding author; e-mail loescher{at}msu.edu; fax
517-432-3490.
Article, publication date, and citation information can be found at
www.plantphysiol.org/cgi/doi/10.1104/pp.102.016725.
 |
LITERATURE CITED |
-
Berüter J
(1993)
Characterization of the permeability of excised apple tissue for sorbitol.
J Exp Bot
44: 519-528[Abstract/Free Full Text]
-
Berüter OJ, Feusi MES
(1995)
Comparison of sorbitol transport in excised tissue discs and cortex tissue of intact apple fruit.
J Plant Physiol
146: 95-102
-
Bieleski RL, Redgwell RJ
(1985)
Sorbitol versus sucrose as photosynthesis and translocation products in developing apricot leaves.
Aust J Plant Physiol
12: 657-668
-
Brooks SJ, Moore JN, Murphy JB
(1993)
Quantitative and qualitative changes in sugar content of peach genotypes [Prunus persica (L.) Batsch.].
J Am Soc Hortic Sci
118: 97-100[Abstract/Free Full Text]
-
Buckhout TJ, Tubbe A
(1996)
Structure, mechanisms of catalysis, and regulation of sugar transporters in plants.
In
E Zamski, AA Schaffer, eds, Photoassimilate Distribution in Plant and Crops: Source-Sink Relationships. Marcel Dekker, New York, pp 229-260
-
Bürkle L, Hibberd JM, Quick WP, Kühn C, Hirner B, Frommer WB
(1998)
The H+-sucrose cotransporter NtSUT1 is essential for sugar export from tobacco leaves.
Plant Physiol
118: 59-68[Abstract/Free Full Text]
-
Chiou TJ, Bush DR
(1996)
Molecular cloning, immunochemical localization to the vacuole, and expression in transgenic yeast and tobacco of a putative sugar transporter from sugar beet.
Plant Physiol
110: 511-520[Abstract]
-
Dohmen RJ, Strasser AWM, Honer CB, Hollenberg CP
(1991)
An efficient transformation procedure enabling long term storage of competent cells of various yeast genera.
Yeast
7: 691-692[CrossRef][ISI][Medline]
-
Dreyer I, Horeau C, Lemaillet G, Zimmermann S, Bush DR, Rodriguez-Navarro A, Schachtman DP, Spalding EP, Sentenac H, Gaber RF
(1999)
Identification and characterization of plant transporters using heterologous expression systems.
J Exp Bot
50: 1073-1087[Abstract]
-
Fillion L, Ageorges A, Picaud S, Coutos-Thévenot P, Lemoine R, Romieu C, Delrot S
(1999)
Cloning and expression of a hexose transporter gene expressed during the ripening of grape berry.
Plant Physiol
120: 1083-1093[Abstract/Free Full Text]
-
Flore JA, Layne DR
(1996)
Prunus.
In
E Zamski, AA Schaffer, eds, Photoassimilate Distribution in Plant and Crops: Source-Sink Relationships. Marcel Dekker, New York, pp 825-849
-
Gao ZF, Loescher WH
(2000)
NADPH supply and mannitol biosynthesis: characterization, cloning, and regulation of the non-reversible glyceraldehyde-3-phosphate dehydrogenase in celery leaves.
Plant Physiol
124: 321-330[Abstract/Free Full Text]
-
Gottwald JR, Krysan PJ, Young JC, Evert RF, Sussman MR
(2000)
Genetic evidence for the in planta role of phloem-specific plasma membrane sucrose transporters.
Proc Natl Acad Sci USA
97: 13979-13984[Abstract/Free Full Text]
-
Greiner S, Koster U, Lauer K, Rosenkranz H, Vogel T, Rausch T
(2000)
Plant invertase inhibitors: expression in cell culture and during plant development.
Aust J Plant Physiol
27: 807-814[ISI]
-
Horak J, Wolf DH
(1997)
Catabolite inactivation of the galactose transporter in the yeast Saccharomyces cerevisiae: ubiquitination, endocytosis, and degradation in the vacuole.
J Bacteriol
179: 1541-1549[Abstract/Free Full Text]
-
Hunter DA, Reid MS
(2001)
A simple and rapid method for isolating high quality RNA from flower petals.
Acta Hortic
543: 147-152
-
Komatsu OA, Moriguchi T, Koyama K, Omura M, Akihama T
(2002)
Analysis of sucrose synthase genes in citrus suggests different roles and phylogenetic relationships.
J Exp Bot
53: 61-71[Abstract/Free Full Text]
-
Lemoine R
(2000)
Sucrose transporters in plants: update on function and structure.
Biochim Biophys Acta
1465: 246-262[Medline]
-
Lo Bianco R, Rieger M
(2002)
Roles of sorbitol and sucrose in growth and respiration of "Encore" peaches at the three developmental stages.
J Am Soc Hortic Sci
127: 297-302
-
Lo Bianco R, Rieger M, Sung SS
(1999)
Carbohydrate metabolism of vegetative and reproductive sinks in the late-maturing peach cultivar "Encore."
Tree Physiol
19: 103-109[ISI][Medline]
-
Loescher WH, Everard JD
(1996)
Sugar alcohol metabolism in sinks and sources.
In
E Zamski, AA Schaffer, eds, Photoassimilate Distribution in Plant and Crops: Source-Sink Relationships. Marcel Dekker, New York, pp 185-207
-
Loescher WH, Marlow GC, Kennedy RA
(1982)
Sorbitol metabolism and sink-source interconversions in developing apple leaves.
Plant Physiol
70: 335-339[Abstract/Free Full Text]
-
Marger MD, Saier JMH
(1993)
A major superfamily of transmembrane facilitators that catalyze uniport, symport and antiport.
Trends Biochem Sci
18: 13-20[CrossRef][ISI][Medline]
-
Marlow G, Loescher WH
(1984)
Watercore.
Hortic Rev
6: 189-251
-
Marquat C, Petel G, Gendraud M
(1997)
Saccharose and sorbitol transporters from plasmalemma membrane vesicles of peach tree leaves.
Biol Plant
39: 369-378[CrossRef]
-
Moing A, Langlois N, Svanella L, Zanetto A, Gaudillere JP
(1997)
Variability in sorbitol: sucrose ratio in mature leaves of different Prunus species.
J Am Soc Hortic Sci
122: 83-90[Abstract/Free Full Text]
-
Noiraud N, Delrot S, Lemoine R
(2000)
The sucrose transporter of celery: identification and expression during salt stress.
Plant Physiol
122: 1447-1455[Abstract/Free Full Text]
-
Noiraud N, Maurousset L, Lemoine R
(2001a)
Transport of polyols in higher plants.
Plant Physiol Biochem
39: 717-728[CrossRef][ISI]
-
Noiraud N, Maurousset L, Lemoine R
(2001b)
Identification of a mannitol transporter, AgMaT1, in celery phloem.
Plant Cell
13: 695-705[Abstract/Free Full Text]
-
Park SW, Song KJ, Kim MY, Hwang JH, Shin YU, Kim WC, Chung WI
(2002)
Molecular cloning and characterization of four cDNAs encoding the isoforms of NAD-dependent sorbitol dehydrogenase from the Fuji apple.
Plant Sci
162: 513-519[CrossRef]
-
Rentsch D, Laloi M, Rouhara I, Scmelzer E, Delrot S, Frommer WB
(1995)
NTR1 encodes a high affinity oligopeptide transporter in Arabidopsis.
FEBS Lett
370: 264-268[CrossRef][ISI][Medline]
-
Roper TR, Loescher WH
(1987)
Relationships between leaf area per fruit and fruit quality in "Bing" sweet cherry.
HortScience
22: 1273-1276
-
Sambrook J, Fritsch EF, Maniatis T
(1989)
Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
-
Sauer N, Stadler R
(1993)
A sink-specific H+/monosaccharide co-transporter from Nicotiana tabacum: cloning and heterologous expression in baker's yeast.
Plant J
4: 601-610[CrossRef][ISI][Medline]
-
Shakya R, Sturm A
(1998)
Characterization of source- and sink-specific sucrose/H+ symporters from carrot.
Plant Physiol
118: 1473-1480[Abstract/Free Full Text]
-
Tanase K, Shiratake K, Mori H, Yamaki S
(2002)
Changes in the phosphorylation state of sucrose synthase during development of Japanese pear fruit.
Physiol Plant
114: 21-26[Medline]
-
Tukey HB, Young JO
(1939)
Histological study of the developing fruit of the sour cherry.
Bot Gaz
100: 723-749[CrossRef]
-
Tusnady GE, Simon I
(1998)
Principles governing amino acid composition of integral membrane proteins: application to topology prediction.
J Mol Biol
283: 489-506[CrossRef][ISI][Medline]
-
Weise A, Barker L, Kuehn C, Lalonde S, Buschmann H, Frommer WB, Ward JM
(2000)
A new subfamily of sucrose transporters, SUT4, with low affinity/high capacity localized in enucleate sieve elements of plants.
Plant Cell
12: 1345-1355[Abstract/Free Full Text]
-
Williams LE, Lemoine R, Sauer N
(2000)
Sugar transporters in higher plants: a diversity of roles and complex regulation.
Trends Plant Sci
5: 283-290[CrossRef][ISI][Medline]
-
Winter H, Huber SC
(2000)
Regulation of sucrose metabolism in higher plants: localization and regulation of activity of key enzymes.
Crit Rev Biochem Mol Biol
35: 253-289[ISI][Medline]
-
Yamada K, Oura Y, Mori H, Yamaki S
(1998)
Cloning of NAD-dependent sorbitol dehydrogenase from apple fruit and gene expression.
Plant Cell Physiol
39: 1357-1361
-
Yamaguchi H, Kanayama Y, Soejima J, Yamaki S
(1996)
Changes in the amounts of the NAD-dependent sorbitol dehydrogenase and its involvement in the development of apple fruit.
J Am Soc Hortic Sci
121: 848-852[Abstract/Free Full Text]
-
Yamaguchi H, Kanayama Y, Yamaki S
(1994)
Purification and properties of NAD-dependent sorbitol dehydrogenase from apple fruit.
Plant Cell Physiol
35: 887-892[Abstract/Free Full Text]
-
Yamaki S, Asakura T
(1988)
Energy coupled transport of sorbitol and other sugars into the protoplast isolated from apple fruit flesh.
Plant Cell Physiol
29: 961-968[Abstract/Free Full Text]
© 2003 American Society of Plant Biologists
This article has been cited by other articles:

|
 |

|
 |
 
N. Garcia-Marino, F. de la Torre, and A.J. Matilla
Organic Acids and Soluble Sugars in Edible and Nonedible Parts of Damson Plum (Prunus domestica L. subsp. insititia cv. Syriaca) Fruits During Development and Ripening
Food Science and Technology International,
April 1, 2008;
14(2):
187 - 193.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Schneider, D. Beyhl, R. Hedrich, and N. Sauer
Functional and Physiological Characterization of Arabidopsis INOSITOL TRANSPORTER1, a Novel Tonoplast-Localized Transporter for myo-Inositol
PLANT CELL,
April 1, 2008;
20(4):
1073 - 1087.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Juchaux-Cachau, L. Landouar-Arsivaud, J.-P. Pichaut, C. Campion, B. Porcheron, J. Jeauffre, N. Noiraud-Romy, P. Simoneau, L. Maurousset, and R. Lemoine
Characterization of AgMaT2, a Plasma Membrane Mannitol Transporter from Celery, Expressed in Phloem Cells, Including Phloem Parenchyma Cells
Plant Physiology,
September 1, 2007;
145(1):
62 - 74.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Pommerrenig, F. S. Papini-Terzi, and N. Sauer
Differential Regulation of Sorbitol and Sucrose Loading into the Phloem of Plantago major in Response to Salt Stress
Plant Physiology,
June 1, 2007;
144(2):
1029 - 1038.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Conde, P. Silva, A. Agasse, R. Lemoine, S. Delrot, R. Tavares, and H. Geros
Utilization and Transport of Mannitol in Olea europaea and Implications for Salt Stress Tolerance
Plant Cell Physiol.,
January 1, 2007;
48(1):
42 - 53.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Teo, Y. Suzuki, S. L. Uratsu, B. Lampinen, N. Ormonde, W. K. Hu, T. M. DeJong, and A. M. Dandekar
Colloquium Paper: Silencing leaf sorbitol synthesis alters long-distance partitioning and apple fruit quality
PNAS,
December 5, 2006;
103(49):
18842 - 18847.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Hemmerlin, D. Tritsch, M. Hartmann, K. Pacaud, J.-F. Hoeffler, A. van Dorsselaer, M. Rohmer, and T. J. Bach
A Cytosolic Arabidopsis D-Xylulose Kinase Catalyzes the Phosphorylation of 1-Deoxy-D-Xylulose into a Precursor of the Plastidial Isoprenoid Pathway
Plant Physiology,
October 1, 2006;
142(2):
441 - 457.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Conde, A. Agasse, D. Glissant, R. Tavares, H. Geros, and S. Delrot
Pathways of Glucose Regulation of Monosaccharide Transport in Grape Cells
Plant Physiology,
August 1, 2006;
141(4):
1563 - 1577.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Schneider, A. Schneidereit, K. R. Konrad, M.-R. Hajirezaei, M. Gramann, R. Hedrich, and N. Sauer
Arabidopsis INOSITOL TRANSPORTER4 Mediates High-Affinity H+ Symport of Myoinositol across the Plasma Membrane
Plant Physiology,
June 1, 2006;
141(2):
565 - 577.
[Abstract]
[Ful | |