First published online March 13, 2003; 10.1104/pp.102.016188
Plant Physiol, April 2003, Vol. 131, pp. 1855-1867
The Evolution of CONSTANS-Like Gene Families in
Barley, Rice, and Arabidopsis1
Simon
Griffiths,
Roy P.
Dunford,
George
Coupland,2 and
David A.
Laurie*
John Innes Centre, Norwich Research Park, Colney, Norwich NR4 7UH,
United Kingdom
 |
ABSTRACT |
The CO (CONSTANS) gene of
Arabidopsis has an important role in the regulation of flowering by
photoperiod. CO is part of a gene family with 17 members that are subdivided into three classes, termed Group I to III
here. All members of the family have a CCT (CO,
CO-like, TOC1) domain near the carboxy
terminus. Group I genes, which include CO, have two zinc
finger B-boxes near the amino terminus. Group II genes have one B-box,
and Group III genes have one B-box and a second diverged zinc finger.
Analysis of rice (Oryza sativa) genomic sequence
identified 16 genes (OsA-OsP) that were
also divided into these three groups, showing that their evolution
predates monocot/dicot divergence. Eight Group I genes (HvCO1-HvCO8) were isolated from barley
(Hordeum vulgare), of which two (HvCO1
and HvCO2) were highly CO like.
HvCO3 and its rice counterpart (OsB) had
one B-box that was distantly related to Group II genes and was probably
derived by internal deletion of a two B-box Group I gene. Sequence
homology and comparative mapping showed that HvCO1 was
the counterpart of OsA (Hd1), a major
determinant of photoperiod sensitivity in rice. Major genes determining
photoperiod response have been mapped in barley and wheat
(Triticum aestivum), but none corresponded to
CO-like genes. Thus, selection for variation in
photoperiod response has affected different genes in rice and temperate
cereals. The peptides of HvCO1, HvCO2
(barley), and Hd1 (rice) show significant structural differences from CO, particularly amino acid changes that are predicted
to abolish B-box2 function, suggesting an evolutionary trend toward a
one-B-box structure in the most CO-like cereal genes.
 |
INTRODUCTION |
The control of flowering by
photoperiod is an important adaptive characteristic in plants. Studies
of the model dicot Arabidopsis have shown that the CO
(CONSTANS) gene, isolated by Putterill et al.
(1995) , has an important role in the photoperiod pathway, which
is one of four regulatory pathways controlling the timing of flowering
(for review, see Mouradov et al., 2002 ; Simpson
and Dean, 2002 ). CO acts between the circadian clock
and genes controlling meristem identity (Samach et al.,
2000 ; Suárez-López et al., 2001 ). In
Arabidopsis, CO belongs to a family of 17 putative
transcription factors defined by two conserved domains
(Putterill et al., 1995 ; Robson et al.,
2001 ). The first is a zinc finger region near the amino
terminus that resembles B-boxes, which regulate protein-protein interactions in several animal transcription factors (Borden, 1998 ; Torok and Elkin, 2000 ). The second is a
region of 43 amino acids near the carboxy terminus termed the CCT
(CO, CO-like, TOC1) domain
(Strayer et al., 2000 ; Robson et al.,
2001 ). Studies using green fluorescent protein fusions
show that the CCT domain is involved in nuclear localization of the CO
protein but must have an additional role because the late-flowering
co-7 mutant, which has an altered CCT domain, correctly
localizes the protein (Robson et al., 2001 ).
Previous analysis of CO-like genes in Arabidopsis showed
that the family is subdivided into three broad groupings (Robson et al., 2001 ). The first comprised CO and
COL1 to COL5 (two B-box genes), the second
comprised COL6 to COL8 and COL16 (one
B-box genes), and the third comprised COL9 to
COL15 (one CO-like B-box and one more diverged
zinc finger domain). In this paper, these are referred to as Group I to
III genes, respectively. The Group I genes had additional conserved
regions, including a distinctive motif of six amino acids (consensus
G-I/V-V-P-S/T-F) at the carboxy terminus of the predicted peptide.
CO-like genes have been identified in several dicots and in
two cases (Brassica napus BnCOa1, Robert et al.,
1998 ; and Pharbitis nil PnCO, Liu et al.,
2001 ) have been shown to complement a co mutant in
Arabidopsis, demonstrating functional equivalence. The Hd1
(Heading date 1) gene of rice (Oryza sativa) is
also homologous to CO (Yano et al., 2000 ).
Conservation between short-day (SD) plants (rice and P. nil)
and long-day (LD) plants (Arabidopsis and B. napus) suggests
that CO is involved in a conserved pathway regulating
flowering in response to inductive day length. Grafting experiments in
dicots have shown that leaves from SD or LD plants grown under
inductive conditions can promote flowering when grafted to LD or SD
plants, respectively, growing under noninductive conditions (Zeevaart, 1976 ). Not all such grafts are effective, but
nevertheless these experiments also suggest common components in the
response to inductive day length.
Conservation between rice and Arabidopsis suggests that
CO-like genes are likely to be involved in flowering time
control in other cereals such as barley (Hordeum vulgare),
which, like Arabidopsis, is a quantitative LD plant. In this paper, we
investigated the structure of the CO-like gene family in
rice using previously published data (Song et al., 1998 ;
Yano et al., 2000 ) and genomic sequence. This
information was used to isolate Group I CO-like genes from
barley. This allowed us to compare the evolution of CO-like
genes in rice and Arabidopsis and the evolution of Group I genes in
these species and barley. Genetic mapping of genes in barley determined
their relationship to genes in rice and to previously mapped
photoperiod response loci.
 |
RESULTS |
Identification of CONSTANS-Like Genes in Rice Genomic
Sequence
Searches of rice genomic sequence using CO and COL1 to COL16
peptides identified a minimum of 16 genes, designated OsA to OsP, including four CO-like genes previously
described (Hd1 [OsA], Yano et al.,
2000 ; and S12569 [OsB],
S3574 [OsN], and C60190 [OsP]; Song et al., 1998 ; Table
I). Preliminary analysis of the rice
genes showed that they could be divided into the Group I to III
subfamilies seen in Arabidopsis and that OsA
(Hd1) and OsB (S12569) were Group I
genes that were the most CO like overall. These two rice genes also had
the conserved carboxy-terminal motif seen in other Group I
genes.
Isolation of CONSTANS-Like Genes from Barley
Barley CO-like sequences were first isolated using a
120-bp subclone of OsA (Hd1) (Yano et al.,
2000 ), including the CCT domain and a 142-bp subclone of
OsB (S12569) (Song et al., 1998 ), also containing the CCT domain. The CCT domain probes were used to
screen a barley cv Igri lambda phage genomic library (Stratagene, Cambridge, UK) and a barley cv Morex bacterial artificial
chromosome (BAC) library (Yu et al., 2000 ).
Genomic library screens were used because the CO transcript
is rare in Arabidopsis (Suárez-López et al.,
2001 ), and orthologs might behave similarly in barley, making
them difficult to isolate from cDNA libraries. In cases where Morex BAC
clones were used, the corresponding gene from Igri was amplified by PCR
from genomic DNA and sequenced. Sequences were obtained from Igri
because it has an LD response (Laurie et al., 1995 ;
Decousset et al., 2000 ) and, therefore, should contain functional alleles of any CO-like genes involved in the
control of flowering by photoperiod.
The CCT domain probes from OsA (Hd1) and
OsB (S12569) each identified two barley genes
(four genes in total) in the preliminary screen. CCT domains from the
barley genes were then used to test cross hybridization between the
clones and, where appropriate, to rescreen the libraries. The CCT
domains of the two barley genes detected by OsA
(Hd1) gave no additional genes in further library screens,
whereas the CCT domain of HvCO4 detected four additional genes. Thus, genomic library screens detected eight genes.
Nucleotide and predicted peptide searches of approximately 420,000 wheat (Triticum aestivum), 314,000 barley, and 8,900 rye (Secale cereale) ESTs available in November 2002 from
GenBank (http://www.ncbi.nlm.nih.gov) gave no highly homologous matches outside the B-box or CCT domains to OsA (Hd1) or
the two barley genes detected by the OsA (Hd1)
CCT domain probe. However, several other CO-like genes were
detected. These were highly homologous (>95% nucleotide identity) to
sequences from the genomic clones except for one gene represented by
six barley ESTs that, in combination, included part of the middle
region, the CCT domain, and the COOH region. The combination of
approaches therefore identified nine barley genes in all.
The Exon/Intron Structure of CONSTANS-Like
Genes
The Arabidopsis CO, COL1 to COL8,
and COL16 genes (Group I and II) have a single intron
located between the B-box and CCT domains. COL9 to
COL15 (Group III) have a different structure with three
introns, two of which are between the B-box and CCT domains and the
third within the CCT domain. For the barley genes, alignment to
CO and related genes from Arabidopsis (Robson et al.,
2001 ) and rice (Song et al., 1998 ; Yano
et al., 2000 ) showed that the barley genes had one or two
B-boxes, a CCT domain, and, for HvCO1 to HvCO6,
one intron in a similar position to the single intron of CO
(Fig. 1). HvCO7 was identified
only from cDNA sequences, HvCO8 appeared to lack an intron,
and HvCO9 had no significant homology other than the CCT
domain, and no intron was recognized. The barley genes were numbered
based on the overall homology of their predicted peptides to
CO (Arabidopsis) and Hd1 (rice). This relied
primarily on the B-box and the CCT and COOH regions because the middle
regions (between B-box2 and the CCT domain) were the least well
conserved.

View larger version (21K):
[in this window]
[in a new window]
|
Figure 1.
Exon/intron structure of barley
CONSTANS-like genes. The respective sizes of the genes in
base pairs are shown together with the positions of domains discussed
in the text. Positions of CCT domain subclones used for library
screening (#) and single-copy subclones used for genetic mapping (*)
are also shown. Structures and gene sizes for CO,
Hd1, and S12756 are from sequence accessions
listed in Table I. The inset shows the residues forming the exon
boundaries. HvCO3a and b are alternatively spliced forms (see text).
The intron position of S12569 was determined by alignment with rice
genomic sequence.
|
|
For HvCO1, the intron position was confirmed by sequencing
reverse transcription-PCR products. The intron position of
HvCO2 was then predicted by alignment. The intron of
HvCO1 contained a 147-bp sequence with the characteristics
of a Stowaway element (Bureau and Wessler,
1994 ). For HvCO3 to HvCO6, the intron
position was identified by alignment with barley, wheat, and rye ESTs. Intron positions were confirmed by sequencing candidate full-length barley cDNA clones identified by EST searches. One wheat EST (BQ171773) matched HvCO9, but the clone was truncated and did not
extend to candidate intron sites.
Spliced and unspliced ESTs were found for HvCO3 to
HvCO6, but HvCO3 was the only gene for which
alternatively spliced transcripts were found. The Igri gene was
predicted to give a peptide similar to rice S12569 (HvCO3a in Fig. 1),
and a matching transcript was found in four barley ESTs, including one
fully sequence cDNA (Table I) and a rye EST (BE704660). Three barley
ESTs, including a fully sequenced cDNA (Table I), used the same 3'
splice site and an alternative 5' GT splice site, shortening the first
exon (HvCO3b in Fig. 1). This variant was also seen in an Hordeum
spontaneum EST (AV836099). The shorter transcript had a frame
shift that would produce a truncated peptide lacking the CCT and COOH
regions. Although the sequences flanking the intron were not highly
conserved, the positions of conserved N and H residues relative to
other CO family genes suggests that S12569 and
HvCO3 have evolved by insertion of 30 bp at the end of exon1
and that the HvCO3b variant may use the ancestral splice site (Fig.
1).
In rice, OsA to OsL resembled the barley genes in
having a single intron, whereas OsM to OsP
resembled the Arabidopsis COL9 to COL15 group in
having three introns and a second zinc finger domain that was diverged
from the CO-like B-box. Intron positions were confirmed for
OsA (Hd1), OsB (S12569),
OsN (S3574), and OsP (C60910), for which
full-length cDNA sequences were available (Table I).
Sequence Alignment of CONSTANS-Like Genes
Alignments of the predicted peptides of CO,
OsA (Hd1), and the most CO-like barley
genes (HvCO1 and HvCO2) are shown in Figure 2 together with B-box (Fig. 2a) and CCT
domain and COOH regions (Fig. 2c) for all the barley genes that were
identified and their candidate rice orthologs. The alignment shows that
the barley HvCO1 to HvCO8 peptides had consensus CO-like amino acid
residues at the carboxy terminus. Variation within the B-box and CCT
domains suggested that the CO-like genes could be further subdivided. For example, distinctive amino acid residues in the B-boxes (boxed in
Fig. 2a) grouped Arabidopsis COL3 to COL5 peptides with HvCO4 to HvCO7
and OsC to OsF.

View larger version (74K):
[in this window]
[in a new window]
|
Figure 2.
Alignment of predicted peptides of
CONSTANS and related genes from Arabidopsis, barley, and
rice. a, Amino termini and B-box domains. Conserved C and H residues
and consensus spacing (Xn) defining B-box domains
(Borden, 1998 ; Robson et al., 2001 ) are
shown below. Residues altered in co-2 to co-7
mutant alleles or deleted in co-1 (Robson et al.,
2001 ) are shown above. Boxed residues distinguish COL3- to
COL5-like peptides from the most CO-like group. b, Middle region.
Alignments of whole sequences are shown for CO, Hd1, HvCO1, and HvCO2.
Small conserved motifs found in other CO-like genes are shown in boxes
(see text for details). The underlined region is predicted to form
coiled structures in Hd1 and HvCO1 but not in CO. c, CCT and COOH
domains. Residues affected in co mutant alleles
(Robson et al., 2001 ) are shown above. GenBank accession
numbers for the sequences used in this figure are listed in Table I.
Barley sequences are the Igri allele in all cases except for HvCO7,
where sequence was from CI16151.
|
|
Conserved Motifs in the Middle Region
The middle region of the CO gene family was the most
diverged, but comparison of cereal and dicot genes identified four
small regions of conservation (boxed in Fig. 2b) that helped define the
most CO-like genes. The E-X-S-W-L-L (box 1; Fig. 2b), L-V-D/G-Y (box 2;
Fig. 2b), and G-X-D/E-X-I/V-V-P (box 3; Fig. 2b) motifs were in exon 1. Other genes in addition to those shown in box3 of Figure 2b also had
V-P residues in similar positions, but due to a lack of conserved
flanking residues, it was not clear whether these were the same motif.
A group of the most CO-like genes also had a consensus
S-X-E-X3-V-P motif close to the start of exon 2 (box 4 in Fig. 2b).
Phylogenetic Relationship of the Arabidopsis, Rice, and Barley
Genes
To examine the relationship between genes in more detail,
their nucleotide and predicted peptide sequences were used to determine genetic distances and to construct phylogenetic trees. Because the
middle regions of the genes were the most diverged, they could not be
aligned with confidence. Therefore, neighbor-joining (NJ) and maximum
parsimony (MP) trees were constructed using B-box and CCT domain
sequences following the alignments shown in Figure 2.
First, all genes were compared using the predicted peptide or
nucleotide sequence of the CCT domain alone. This consistently grouped
the genes into four principal clusters (Fig.
3a). Group III genes comprised
Arabidopsis and rice genes with two zinc finger domains, the second of
which was diverged from the CO-type B-box. Group II genes
comprised Arabidopsis and rice genes with a single B-box. Group I
comprised the most CO-like genes and included the barley
HvCO1 to HvCO8 genes. There were subdivisions
within Group I, but these had low bootstrap values.

View larger version (46K):
[in this window]
[in a new window]
|
Figure 3.
Phylogenetic analysis of CO-like genes.
NJ trees of CCT domain nucleotides (a) or concatenated B-box and CCT
domain nucleotides (b) are shown. Genetic distances were calculated
using the Kimura two-parameter model and excluded nucleotides at the
third position in each codon. Bootstrap values from 1,000 replicates
were used to assess the robustness of the trees. The domain structures
of each gene in b is also shown. B1 and B2 are CO-like
B-boxes (white rectangles) or other zinc finger domains (solid
rectangles). M1 to M4, Conserved middle region domains shown in Figure
2b; T, Carboxy-terminal domain shown in Figure 2c. Intron positions
confirmed by alignment with cDNAs or reverse transcription-PCR
products are shown as solid arrowheads. Introns predicted from genomic
sequence are show as white arrowheads.
|
|
HvCO9 had the most diverged CCT domain of the barley genes,
and the phylogenetic tree (Fig. 3a) placed HvCO9 and two
related rice genes (OsH and OsI) between the
Groups II and III genes. OsH was part of a sequenced and
annotated BAC clone (Table I) and the predicted peptide (AAL79780) had
no B-box. Searches of Arabidopsis genomic sequence using the predicted
peptide showed no significant homology outside the CCT domain. Thus,
HvCO9 and the related rice genes were identified as a
distinct forth group that had no counterpart in Arabidopsis (Fig. 3, a
and c).
When genes were analyzed using concatenated B-box and CCT domain
sequences, a similar overall pattern was observed, but the Group I
genes could be divided into subgroups with higher bootstrap values.
This was consistent in NJ and MP methods using nucleotide or predicted
peptide sequences. There were minor variations at some nodes with low
bootstrap values, but this did not affect the gene groups defined in
Figure 3.
Group Ia comprised the most CO-like genes, including the
B. napus and P. nil genes previously shown to
complement co mutations in Arabidopsis, rice OsA
(Hd1), and barley HvCO1 and HvCO2.
Within the COOH terminus, Hd1, HvCO1, HvCO2, and two maize
(Zea mays) Hd1-like peptides translated from ESTs
(GenBank accession nos. BE051702 and BE640554) had T and W residues
(Fig. 2c), suggesting that this may be a useful distinguishing feature
for the most CO-like cereal genes.
Group I also contained the Arabidopsis COL3 to
COL5 genes, rice OsC to OsF, and
HvCO4 to HvCO7. This grouping reflected the distinctive amino acid residues in the B-boxes (the W, V, and VT
residues marked in Fig. 2a). The phylogenetic tree (Fig. 3b) separated
HvCO4/HvCO5 from
HvCO6/HvCO7, and the latter also lacked the first
domain of the middle region (box 1 in Fig. 2b). Therefore, these genes
were designated as Groups Ic and Id, respectively.
Group I contained four genes (HvCO3, OsB
[S12569], HvCO8, and OsG) that had a
single B-box. This placement was consistent in all phylogenetic
analyses of nucleotide or peptide sequences, and these genes were never
placed with the one B-box genes of Group II. Nucleotide and peptide
alignment of HvCO3/OsB gave the best fit to other
Group I genes when the first part of the B-box was aligned to B-box1
and the remainder to B-box2 (Fig. 2a). The alignment of
HvCO8/OsG was more ambiguous, but the alignment
shown in Figure 2a was marginally the best. In addition to the
carboxy-terminal motif, HvCO3/OsB and
HvCO8/OsG had motifs in the middle region that placed them with the Group I genes (Figs. 2b and 3c). These results suggest that these genes originated by internal deletion of
ancestral two-B-box genes. The COOH region of
HvCO3/OsB was similar to HvCO1 and
OsA (Hd1) (Fig. 2c), but the absence of conserved motifs 2 and 3 with the middle region suggested it was more closely related to Group Ic genes (Figs. 2b and 3c). Thus, the exact
relationship of HvCO3/OsB to the Ia and Ic Groups
was ambiguous. Apart from their B-box structure, HvCO3 and
HvCO8 were not closely related, and HvCO8 also lacked middle
region motif 1. Therefore, HvCO3/OsB was placed
in the subgroup Ib, and HvCO8/OsG was placed in
subgroup Ie.
B-Box Structure of the Group Ia Genes
Although HvCO1 and HvCO2 were the most CO like overall (Fig. 2),
and HvCO1 was the most similar to rice Hd1 in the middle region
(generally the most diverged part of the genes; Fig. 2b) and the COOH
region. However, B-box2 was not well conserved. The HvCO1 peptides of
Igri and Morex were identical and lacked three highly conserved C
residues (Fig. 2a) that would be predicted to abolish B-box2 function.
There was also an A-to-V change affecting the residue that is altered
in the Arabidopsis co-4 allele and is conserved in other
genes, suggesting essential function (Fig. 2a). Interestingly, the
functional alleles of Hd1 sequenced by Yano et al.
(2000) also showed changes that would be expected to abolish
B-box2 function. The Ginbouzou allele showed an H-to-Y change involving
an H residue thought to be essential for B-box function. This change is
found in Arabidopsis co-3, the most severely late-flowering
mutant allele (Robson et al., 2001 ; Fig. 2a). The Nipponbare allele retained the H residue but had a deletion of 12 amino
acids (nine from B-box2 and three from the adjacent middle region) that
included part of the deletion in the Arabidopsis co-1 mutant
allele. Nonfunctional alleles had either an H (Kasalath) or Y (HS66 and
HS110) residue and additional insertion or deletion changes likely to
result in nonfunctional proteins (Yano et al., 2000 ).
The 93-11 sequence (not shown) had an H residue, predicting two
functional B-boxes, but also had a 4-bp deletion in the CCT domain,
giving a predicted peptide lacking the P and R residues affected in the
Arabidopsis co-5 and co-7 mutant alleles and
lacking the conserved residues at the carboxy terminus.
B-box2 from HvCO2 was more conserved but had two non-consensus amino
acids in the position of the co-1 deletion (I-A-Q in place
of L-A-R, Fig. 2a). Together, these observations suggest that B-box2 is
less important to the function of the most CO-like genes in
cereals. B-box1, in contrast, was well conserved, suggesting that a
B-box is required for gene function in barley and rice.
A further difference between cereal CO-like peptides and CO itself was
suggested by secondary structure analysis using facilities at the
ExPASy Molecular Biology Server (http://www.expasy.ch/). This showed
that HvCO1 was strongly predicted to form a coiled region in the
central part of the peptide (underlined region in Fig. 2b;
probabilities of 0.943, 0.994, and 0.995 for windows of 14, 21, or 28 amino acids, respectively). This was also strongly predicted for Hd1
(probabilities 0.925, 0.994, and 0.424, respectively), weakly predicted
for HvCO2 (14-amino acid windows only, probability 0.38), and not
predicted for CO. Torok and Elkin (2000) suggested that
B-boxes may function to orientate coiled-coil domains that are the site
of interaction with other proteins. However, in animal proteins, the
coiled-coil region is separated from the B-box by five to eight amino
acids. Therefore, it is unclear if the predicted secondary structure of
the middle region would affect protein interaction of the plant proteins.
Southern Hybridization Analysis of CONSTANS-Like Genes
of Barley
To assess whether the nine HvCO genes comprised the
whole CO-like family in barley, Southern blots of barley
genomic DNA were hybridized with the CCT domain probes used for library
screening, stripped, and reprobed with single-copy subclones for each
gene in turn. The CCT domain of Hd1 detected two bands in
barley, as did the CCT domains of HvCO1 and
HvCO2, with reciprocal strength differences, consistent with
the presence of two genes. Hybridization of these three probes to rice
DNA cut with several restriction enzymes detected one band, suggesting
that only one such gene (Hd1) is present in rice, consistent
with the analysis of indica and japonica genomic sequence.
The CCT domains of S13576 and HvCO4 gave
equivalent results, detecting up to six bands on Southern blots of
barley genomic DNA, none of which corresponded to bands detected by
HvCO1 or HvCO2 probes. When Southern blots were
reprobed with single-copy subclones, all bands detected by the CCT
domains could be accounted for. Thus, there was no evidence for
additional CO-like genes in barley. However, this does not
exclude the possibility that additional genes exist that have
CO-like CCT domains with diverged nucleotide sequences
(although no such genes were detected by TBLASTN searches) or CCT
domains that comigrated with other bands on the Southern blots.
Sequence comparisons showed that although the predicted amino acid
sequences of the CCT domains used as probes were similar, the
nucleotide sequences were more diverged. This accounted for the
different behavior of CCT domains on genomic Southern blots and the
failure of the S13576 or HvCO4 CCT domain probes
to detect HvCO1 and HvCO2. Thus, no single CCT
domain probe could identify all members of the barley
CO-like family at the stringencies used.
Genetic Mapping of Barley CONSTANS-Like Genes
Hybridizations of single-copy subclones to wheat/barley telosomic
addition lines were used to assign barley genes to chromosome arms.
Genes were then mapped in barley or, where polymorphism was lacking,
Hordeum bulbosum or rye (Fig. 3), utilizing the known colinearity of their maps (Salvo-Garrido et al., 2001
and Devos et al., 1993 , respectively). This showed that
barley CO-like genes were present on several chromosomes,
with three on chromosome 6H (HvCO2, 5, and
7) and three on chromosome 7H (HvCO1,
6, and 8). HvCO1 was in a region of 7H
previously shown to be colinear with the region of rice 6 containing
Hd1 (Van Deynze et al., 1995 ). HvCO3 was located close to the centromere on barley
chromosome 5HL, whereas OsB (S12569) was mapped
to the end of rice chromosome 9 (Song et al., 1998 ; Fig.
3). We confirmed that single-copy subclones from HvCO3 and
OsB (S12569) cross-hybridized and detected the same loci in reciprocal hybridizations. The respective chromosome regions were shown previously to be colinear (Van Deynze
et al., 1995 ; Foote et al., 1997 ).
Mapping in rice using CCT domain probes detected several loci and
suggested that HvCO6 (7HL) had a counterpart on rice 6L (Fig. 4). This was confirmed by analysis
of genomic sequence, which showed that OsE was in the
predicted region (Table I). Rice 6 also contained OsL close
to OsA (Hd1) but, as expected from differences in
the nucleotide sequences, this was not detected on the Southern
blots.

View larger version (36K):
[in this window]
[in a new window]
|
Figure 4.
Genetic map locations of CONSTANS-like
genes in barley and rice. 1, Genetic map lengths of barley chromosomes
1H, 2H, 5H, 6H, and 7H from Qi et al. (1996) indicating
the approximate positions of partial maps that are drawn to larger
scale. Solid ovals show positions of centromeres derived from other
published maps. 2, Genetic map lengths of rice
chromosomes 2, 3, 4, 6, and 9 from Harushima et
al. (1998) indicating the approximate positions of the partial
maps. Solid ovals show positions of centromeres. 3 to 13, Partial maps
showing CO-like gene locations. Triticeae maps have markers
to the right, and rice maps have markers to the left. 3, Barley:
Igri × Triumph (Laurie et al., 1995 plus
additional markers; Ppd, Sgh, and eps
are loci for photoperiod response, vernalization response, or
quantitative trait locus [QTL] for earliness, respectively,
from the same paper). 4, H. bulbosum: PB1 × PB11
(Salvo-Garrido et al., 2001 ); 5, Wheat: Chinese
Spring × Synthetic group 2 map (Gale et al.,
1995 ). 6, Barley: Captain × H. spontaneum (2H
from Laurie et al., 1993 ; 7HS from Dunford et
al., 1995 ). 7, Barley: Bonus × H. spontaneum
(Laurie et al., 1996 ). 8, Triticum monococcum
(Dubcovsky et al., 1996 ). 9, Wheat: Group 7 map
(Van Deynze et al., 1995 ). 10, Rye Ds2 × RxL10
(Devos et al., 1993 ). 11, Rice: IR20 × 63-83 (Quarrie et al., 1997 , plus additional markers). 12, Rice: Nipponbare × Kasalath (Harushima et al.,
1998 ). Map locations of Xrgs3574,
Xrgs12569, and Xrgc60910 are from Song et
al. (1998) ; Hd1 from Yano et al.
(2000) . 13, Rice (Causse et al., 1994 ).
Positions of OsE and OsL are by alignment with
genomic sequence (Table I).
|
|
Single-copy subclones of barley genes, which for the most part were
derived from the middle regions of the genes (Fig. 1), hybridized to
rice with varying efficiency, and no systematic attempt was made to map
CO-like genes in the latter. However, the HvCO4
subclone detected two loci. Strongly hybridizing bands detected a locus
at the expected colinear position on rice chromosome 4L; this is
probably OsC, which was found on a chromosome 4 sequence (Table I). Weakly hybridizing bands detected a second locus on rice
chromosome 3S, which is possibly OsD.
Relationship of Barley CONSTANS-Like Genes to Known
Photoperiod Loci
In wheat and barley, major genes regulating photoperiod response
have been mapped on the short arms of the group 2 chromosomes, where
their location relative to common RFLP markers suggests that they form
a homoeoallelic series (Börner et al., 1998 and Sourdille et al., 2000 for wheat and Laurie et
al., 1995 and Decousset et al., 2000 for
barley). None of the barley CO-like genes mapped to the
Ppd-H1 region on chromosome 2HS; therefore, there were no
candidates for this major photoperiod response gene. HvCO9, although located in the same chromosome region as Ppd-H2
(Laurie et al., 1995 ), was not in the same map interval
and because HvCO9 was the least CO-like barley
gene it was not considered a likely candidate. Similarly,
HvCO1 is clearly related to Hd1 but does not
correspond to a known major flowering time gene in barley. HvCO1 (7H), HvCO4 (2H), HvCO3 (5H),
HvCO2 and HvCO5 (6HL), and HvCO7 (7HS)
are all in regions previously shown to contain QTLs for flowering time
(Laurie et al., 1995 ; GrainGenes,
http://wheat.pw.usda.gov/). However, in no case did the locus coincide
with the maximum likelihood peak for QTL location. Further work would
be needed to determine if any of the mapped sequences are candidates
for these QTL. HvCO7 was located on the same chromosome arm
as the recessive eam7 (early maturity7) mutant,
which is early flowering under LD and SD conditions (Stracke and
Börner, 1998 ). However, HvCO7 occupied a more
proximal position.
 |
DISCUSSION |
The Evolution and Divergence of CONSTANS-Like
Genes
Previous analysis of CO-like genes sequences by
Lagercrantz and Axelsson (2000) concluded that they
evolve rapidly, particularly in the middle regions. Their analysis
focused on B-box sequences and included the Arabidopsis STO
(SALT TOLERANCE) gene and related sequences from rice.
STO-like genes have B-boxes but no CCT domain.
In this paper, we restricted our analysis to genes with B-box and CCT
domains. Analysis of this group shows that the major subgroups of
Arabidopsis genes (Ia, Ic, II, and III in Fig. 3) are all present in
cereals. Thus, they predate monocot/dicot divergence and have conserved
distinctive B-box and CCT domain sequence characteristics since. The
subgroups also retain distinctive conserved motifs in the middle region
and at the carboxy terminus of their peptides (Fig. 3b). Furthermore,
the numbers of genes in each grouping was similar between species,
particularly between barley and rice. This clearly suggests that pairs
of barley and rice genes are orthologous, and this was supported by
genetic mapping that showed that HvCO1/OsA
(Hd1), HvCO3/OsB (S12569),
and HvCO6/OsE were in regions previously shown to
be colinear. Comparison of these genes showed the middle region to be
the most diverged and, hence, the most rapidly evolving.
Cereals, however, possess two classes of CO-like genes that
were not found in Arabidopsis. One class is Group I genes with a single
B-box. Alignment with other genes and the presence of conserved domains
in the middle and carboxy-terminal regions suggests that they evolved
by internal deletion of a two B-box Group I gene. The
HvCO3/OsB and HvCO8/OsG
pairs are not closely related and probably evolved independently. The
HvCO8/OsG pair were the only genes for which
there was no evidence of an intron, but they have intact reading frames
and were found in ESTs of barley and sorghum (Sorghum
bicolor). These characters, together with differences in sequence,
make it unlikely that they are pseudogenes derived from
HvCO3/OsB. Also novel are the Group IV genes that
lack B-box domains but have a CO-like CCT domain.
The most CO-like genes (Group Ia) differ in number between
species. Southern-blot analysis and analysis of genomic sequence detected one rice gene (Hd1) whereas barley clearly has two
(HvCO1 and HvCO2) and Arabidopsis has three
(CO, COL1, and COL2). In Arabidopsis,
CO and the closely related COL1 gene are arranged in tandem, separated by about 3.9 kb (accession no. AL391144). The rice
PAC clone containing the Hd1 gene (accession no. AP003044) and corresponding 93-11 genomic contigs had no such duplication. To
test the situation in barley, three restriction enzymes were used to
digest barley BAC clones containing HvCO1 or
HvCO2. Southern blots were tested with CCT domain probes
that consistently revealed a single band. Therefore, there was no
evidence in rice or barley for a tandem duplication.
A surprising feature of the most CO-like barley and rice
genes was changes in B-box2 involving amino acid residues believed to
be essential for B-box function (Fig. 2a). This suggests that these
cereal genes do not require a second B-box for function, and in this
respect, they differ from CO in Arabidopsis. Changes to
B-box2 were not a general feature of cereals because the
HvCO4 to HvCO7 genes of barley, and their rice
counterparts, retained characteristic B-box residues. Further work is
needed to understand why B-box2 has been altered in the most
CO-like genes and whether the derived regions have novel
roles in gene function. The presence of one B-box in HvCO3
and OsB, which were the most closely related to
HvCO1 and Hd1 in the COOH region, might also
reflect an evolutionary trend toward a one B-box structure.
The existence of common classes of CO-like genes in monocots
and dicots clearly suggests that CO-like genes have an
ancient origin. Database searches confirmed this, showing that CO-like CCT domains (defined as being more similar to CO than to
other Arabidopsis genes such as TOC1) are present in
Chlamydomonas reinhardii and, therefore, evolved before the
divergence of unicellular green algae from other green plants.
CO-like genes (defined by one or more B-boxes, a CO-like CCT
domain, and conserved residues at the COOH terminus) are present in
mosses (Physcomitrella patens), gymnosperms, and angiosperms
(Fig. 5), showing that they predate the
evolution of these groups.

View larger version (25K):
[in this window]
[in a new window]
|
Figure 5.
CCT domain and COOH region peptides in distantly
related green plants. Angiosperms: Arabidopsis CO (X94937) and rice Hd1
Ginbouzou allele (AB041840). Gynmosperm: Pinus radiata
(AF001136); this gene has similarities to COL3 to
COL5 group gene because it has the conserved W, V, and VT
B-box residues boxed in Figure 2a. Moss: P. patens (3' ESTs
BJ167752 [1] and BJ166101 [2]; 5' sequences from the same clones
reveal B-box residues). Unicellular green alga: C. reinhardii (ESTs BI529290, BI716177, and BI727274 all give this
translation). The CCT domain and COOH region of the Arabidopsis
TOC1 gene (AF272039) are included for comparison.
|
|
The Role of CONSTANS-Like Genes in Barley
Studies in wheat and barley have consistently shown that
Ppd genes on the short arms of the group 2 chromosomes are
the major factors controlling photoperiod response, and comparative
mapping suggests that they are a series of orthologous genes
(Börner et al., 1998 ; Sourdille et al.,
2000 ; and Laurie et al., 1995 , respectively). We
found no evidence for a CO-like gene in the Ppd
region. However, cereals clearly possess CO homologs, and at
least one gene (OsA [Hd1]) plays a major role
in photoperiod response in rice. OsA (Hd1) has a
clear counterpart in barley (HvCO1), but to date we have
found no correspondence between barley CO-like genes and
flowering time loci. Thus, variation for photoperiod response in rice
and temperate cereals has been achieved by different routes. To
investigate this further, we are analyzing the role of barley
CO-like genes using transgenic plants. In addition to overexpression studies within the relevant species, it would be interesting to determine whether Arabidopsis co mutants can
be complemented by HvCO1 or HvCO2, either with
their normal structure or with a second, more conserved, B-box2. It
would also be interesting to determine if the barley HvCO1
gene can complement the hd1 mutation of rice and, if so,
whether the resulting plant has SD or LD characteristics.
 |
MATERIALS AND METHODS |
Nomenclature
Italicized names refer to genes and gene segments (e.g.
HvCO1 and Hd1), whereas nonitalic names
(e.g. HvCO1, Hd1) refer to predicted peptides. Loci (Fig. 4) are
italicized and prefixed with X (e.g.
XHvCO1 and XHd1).
Analysis of Rice (Oryza sativa) Genomic
Sequence
The nucleotide and predicted peptide sequences of Arabidopsis
CO and COL1 to COL16
(Table I) were used for BLASTN and TBLASTN searches of databases using
facilities provided by the National Center for Biological Information
Web site (http://www.ncbi.nlm.nih.gov). In addition to genomic sequence
of indica rice 93-11 (Yu et al., 2002 )
and japonica rice Nipponbare
(http://www.dna.affrc.go.jp), we also analyzed Nipponbare genomic
sequence from the Torrey Mesa Research Institute
(http://www. tmri.org; Goff et al., 2002 ).
Cloning and Sequencing of Barley (Hordeum vulgare)
CONSTANS-Like Genes
To clone barley CO-like genes, genomic libraries
were first screened with CCT domain probes from two rice
CO-like genes, Hd1 (Yano et al.,
2000 ) and S13576. The rice Hd1
gene and sequence were kindly provided by Dr. Masahiro Yano (National
Institute of Agrobiological Resources, Tsukuba, Japan).
S13576 was one of four rice EST clones that were fully
sequenced after having been identified by database searches as
containing a CO-like B-box. Of the three other rice
ESTs, two (R1479 and R2967) had no CCT domain, whereas the third (S3574) had a 43-amino acid
CCT domain that was less homologous to CO than that of
S13576 (60% and 88% amino acid identity,
respectively). Therefore, the CCT domains of Hd1 and
S13576 were selected for screening barley libraries. S13576 was subsequently found to be identical in
sequence with S12569, a cDNA previously described by
Song et al. (1998) that is referred to as
S12569 elsewhere in this paper. The
Hd1-CCT fragment was amplified using primers
HD1-CCTf (CAGGGAGGCCAGGGTGCTCAG) and HD1-CCTr (CTCTTGGCGAAACGGCCCTTGA).
The S13576-CCT fragment was amplified using primers S12569-CCTf
(TACAGGGA-GAAGAGGAAGACGAG) and S12569-CCTr (AGAAGTACTGGTCGACCTCAAG).
32P-labeled Hd1-CCT was hybridized to
3.13 × 105 barley BAC clones from the var. Morex
yielding two CO-like genes. High-density filters
of the Morex BAC library, described by Yu et al. (2000) ,
and Morex, CI16151, and CI16155 cDNA clones were obtained from Clemson
University Genomics Institute (SC; http://www.genome.clemson.edu). S12569-CCT and subsequent screens with barley CCT domain
probes detected six CO-like genes
(HvCO3-HvCO9) when hybridized to 1 × 106 barley genomic phage clones from a commercially
available library (Stratagene Inc.) from the var. Igri.
BAC DNA was extracted using a modified alkaline lysis procedure
from Clemson University (http://www.genome.clemson.edu/protocols/). Phage DNA was extracted from plate lysates according to Sambrook et al. (1989) . Gene-containing fragments were subcloned by
restriction digestion of 5 µg of DNA followed by fractionation in
0.8% (w/v) agarose for 20 h at 1V cm 1, and
then blotted onto charged nylon membrane (Amersham,
Buckinghamshire, UK) according to the manufacturer's
instructions. Hybridization with the same probe sequence used to screen
the genomic library identified gene-containing restriction fragments.
These fragments were excised from preparative agarose gels, purified by
electroelution, and cloned into pBluescript (Stratagene Inc.) using
standard laboratory procedures. Subclone sequencing began using M13
forward and reverse primers and progressed through the insert with
custom primers. Reactions were carried out using BigDye
(Perkin-Elmer Applied Biosystems, Foster City, CA) chemistry and
fractionated on a Perkin-Elmer Applied Biosystems 3700 automated
sequencing machine. Alternatively, genes were sequenced directly from
BAC or phage clones, initially using primers based on the highly
conserved CCT domain of CO-like genes. Sequence reads
were assembled into contigs using the Sequencher program (Gene Codes
Corporation, Ann Arbor, MI). Multiple sequence alignments were
constructed using ClustalX followed by manual optimization. GenBank
sequence accession numbers for the barley genes are listed in Table
I.
Southern Blotting, Hybridization, and Genetic Mapping
To assess the copy number of CO-like genes in barley, Southern
blots were prepared from barley genomic DNA digested with
EcoRI, EcoRV, DraI, or
HindIII. CCT domain probes and gene-specific probes (Fig. 1) were amplified by PCR, radiolabeled, and used as described by
Laurie et al. (1993) . For heterologous probes, the
filters were washed at a final stringency of 2× SSC or 0.2× SSC at
65°C. Otherwise, the final stringency was 0.2× SSC at 65°C. Wheat
(Triticum aestivum)/barley telosomic addition lines
(Islam, 1983 ) were used to assign single-copy subclones
of barley genes to chromosome arms. Mapping populations used to locate
CO-like genes in barley, Hordeum
bulbosum, rye (Secale cereale), and rice are
referenced in the legend to Figure 4. Genetic maps were produced using
JoinMap v2.0 (Stam and Van Ooijen, 1995 ).
Phylogenetic Analysis
To compare Arabidopsis, barley, and rice genes, we used
concatenated nucleotide or predicted peptide sequences of the B-box and
CCT domains or individual domains for comparisons of genes where not
all domains were present. Sequences were aligned using ClustalX or the
pileup facility of the GCG package (Genetics Computer Group,
Madison, WI) followed by manual adjustment. Phylogenetic and molecular
evolutionary analyses were conducted using MEGA version 2.1 software
(http://www.megasoftware.net/; Kumar et al., 2001 ).
Genetic distances between nucleotide sequences and predicted peptide
sequences were calculated various parameters provided by the software,
and phylogenetic trees were constructed using NJ and MP methods.
Nucleotide comparisons excluded the third position in each codon. Data
files used for the analysis are available from the corresponding author
on request.
 |
FOOTNOTES |
Received October 15, 2002; returned for revision December 3, 2002; accepted December 12, 2002.
1
This work was supported by the John Innes
Foundation (PhD studentship to S.G.) and by the Biotechnology and
Biological Sciences Research Council (UK; grant-in-aid to the John
Innes Centre).
2
Present address: Max-Planck-Institut für
Züchtungsforschung, Carl-von-Linné-Weg 10, D-50829
Köln, Germany.
*
Corresponding author; e-mail david.laurie{at}bbsrc.ac.uk; fax
44-1603-450-023.
Article, publication date, and citation information can be found at
www.plantphysiol.org/cgi/doi/10.1104/pp.102.016188.
 |
LITERATURE CITED |
-
Borden KLB
(1998)
RING fingers and B-boxes: zinc-binding protein-protein interaction domains.
Biochem Cell Biol
76: 351-358[CrossRef][Web of Science][Medline]
-
Börner A, Korzun V, Worland AJ
(1998)
Comparative genetic mapping of loci affecting plant height and development in cereals.
Euphytica
100: 245-248[CrossRef][Web of Science]
-
Bureau TE, Wessler SR
(1994)
Stowaway: A new family of inverted repeat elements associated with the genes of both monocotyledonous and dicotyledonous plants.
Plant Cell
6: 907-916[Abstract]
-
Causse MA, Fulton TM, Cho YG, Ahn SN, Chunwongse J, Wu K, Xiao J, Yu Z, Ronald PC, Harrington SE, et al
(1994)
Saturated molecular map of the rice genome based on an interspecific backcross population.
Genetics
138: 1251-1274[Abstract]
-
Decousset L, Griffiths S, Dunford RP, Pratchett N, Laurie DA
(2000)
Development of STS markers closely linked to the Ppd-H1 photoperiod response gene of barley (Hordeum vulgare L.).
Theor Appl Genet
101: 1202-1206[CrossRef][Web of Science]
-
Devos KM, Atkinson MD, Chinoy CN, Francis HA, Harcourt RL, Koebner RMD, Liu CJ, Masojc P, Xie DX, Gale MD
(1993)
Chromosomal rearrangements in the rye genome relative to that of wheat.
Theor Appl Genet
85: 673-680[Web of Science]
-
Dubcovsky J, Luo MC, Zhong GY, Bransteitter R, Desai A, Kilian A, Kleinhofs A, Dvorak J
(1996)
Genetic map of diploid wheat, Triticum monococcum L., and its comparison with maps of Hordeum vulgare L.
Genetics
143: 983-999[Abstract]
-
Dunford RP, Kurata N, Laurie DA, Money TA, Minobe Y, Moore G
(1995)
Conservation of fine-scale DNA marker order in the genomes of rice and the Triticeae.
Nucleic Acids Res
23: 2724-2728[Abstract/Free Full Text]
-
Foote T, Roberts M, Kurata N, Sasaki T, Moore G
(1997)
Detailed comparative mapping of cereal chromosome regions corresponding to the Ph1 locus in wheat.
Genetics
147: 801-807[Abstract]
-
Gale MD, Atkinson MD, Chinoy CN, Harcourt RL, Jia J, Li QY, Devos KM
(1995)
Genetic maps of hexaploid wheat.
In
ZS Li, ZY Xin, eds, Proceedings of the 8th International Wheat Genetics Symposium. China Agricultural Scientech Press, Beijing, pp 29-40
-
Goff SA, Ricke D, Lan TH, Presting G, Wang RL, Dunn M, Glazebrook J, Sessions A, Oeller P, Varma H, et al
(2002)
A draft sequence of the rice genome (Oryza sativa L. ssp. japonica).
Science
296: 92-100[Abstract/Free Full Text]
-
Harushima Y, Yano M, Shomura A, Sato M, Shimano T, Kuboki Y, Yamamoto T, Lin SY, Antonio BA, Parco A, et al
(1998)
A high-density rice genetic map with 2275 markers using a single F2 population.
Genetics
148: 479-494[Abstract/Free Full Text]
-
Islam AKMR
(1983)
Ditelosomic additions of barley chromosomes to wheat.
In
S Sakamoto, ed, Proceedings of the 6th International Wheat Genetics Symposium. Maruzen Co. Ltd., Kyoto, Japan, pp 233-238
-
Kumar S, Tamura K, Jakobsen IB, Nei M
(2001)
MEGA2: Molecular Evolutionary Genetics Analysis Software. Arizona State University, Tempe
-
Lagercrantz U, Axelsson T
(2000)
Rapid evolution of the family of CONSTANS like genes in plants.
Mol Biol Evol
17: 1499-1507[Abstract/Free Full Text]
-
Laurie DA, Pratchett N, Allen RL, Hantke SS
(1996)
RFLP mapping of the barley homeotic mutant lax-a.
Theor Appl Genet
93: 81-85
-
Laurie DA, Pratchett N, Bezant JH, Snape JW
(1995)
RFLP mapping of five major genes and eight quantitative trait loci controlling flowering time in a winter × spring barley (Hordeum vulgare L.) cross.
Genome
38: 575-585
-
Laurie DA, Pratchett N, Devos KM, Leitch IJ, Gale MD
(1993)
The distribution of RFLP markers on chromosome 2(2H) of barley in relation to the physical and genetic location of 5S rDNA.
Theor Appl Genet
87: 177-183
-
Liu JY, Yu JP, McIntosh L, Kende H, Zeevaart JAD
(2001)
Isolation of a CONSTANS ortholog from Pharbitis nil and its role in flowering.
Plant Physiol
125: 1821-1830[Abstract/Free Full Text]
-
Mouradov A, Cremer F, Coupland G (2002) Control of flowering time:
interacting pathways as a basis for diversity. Plant Cell Suppl
S111-S130
-
Putterill J, Robson F, Lee K, Simon R, Coupland G
(1995)
The CONSTANS gene of Arabidopsis promotes flowering and encodes a protein showing similarities to zinc finger transcription factors.
Cell
80: 847-858[CrossRef][Web of Science][Medline]
-
Quarrie SA, Laurie DA, Zhu J, Lebreton C, Semikhodskii A, Steed A, Witsenboer H, Calestani C
(1997)
QTL analysis to study the association between leaf size and abscisic acid accumulation in droughted rice leaves and comparisons across cereals.
Plant Mol Biol
35: 155-165[CrossRef][Web of Science][Medline]
-
Qi X, Stam P, Lindhout P
(1996)
Comparison and integration of four barley genetic maps.
Genome
39: 379-394
-
Robert LS, Robson F, Sharpe A, Lydiate D, Coupland G
(1998)
Conserved structure and function of the Arabidopsis flowering time gene CONSTANS in Brassica napus.
Plant Mol Biol
37: 763-772[CrossRef][Web of Science][Medline]
-
Robson F, Costa MMR, Hepworth SR, Vizir I, Pineiro M, Reeves PH, Putterill J, Coupland G
(2001)
Functional importance of conserved domains in the flowering-time gene CONSTANS demonstrated by analysis of mutant alleles and transgenic plants.
Plant J
28: 619-631[CrossRef][Web of Science][Medline]
-
Salvo-Garrido H, Laurie DA, Jaffé B, Snape JW
(2001)
An RFLP map of diploid Hordeum bulbosum L. and comparison with maps of barley (H. vulgare L.) and wheat (Triticum aestivum L.).
Theor Appl Genet
103: 869-880[CrossRef]
-
Sambrook J, Fritsch EF, Maniatis T
(1989)
Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
-
Samach A, Onouchi H, Gold SE, Ditta GS, Schwarz-Sommer Z, Yanofsky MF, Coupland G
(2000)
Distinct roles of CONSTANS target genes in reproductive development of Arabidopsis.
Science
288: 1613-1616[Abstract/Free Full Text]
-
Simpson GG, Dean C
(2002)
Arabidopsis, the rosetta stone of flowering time.
Science
296: 285-289[Abstract/Free Full Text]
-
Song J, Yamamoto K, Shomura A, Itadani H, Zhong HS, Yano M, Sasaki T
(1998)
Isolation and mapping of a family of putative zinc-finger protein cDNAs from rice.
DNA Res
30: 95-101
-
Sourdille P, Snape JW, Cadalen T, Charmet G, Nakata N, Bernard S, Bernard M
(2000)
Detection of QTLs for heading time and photoperiod response in wheat using a doubled-haploid population.
Genome
43: 487-494[Medline]
-
Stam P, Van Ooijen JW
(1995)
JoinMap Version 2.0: Software for the Calculation of Genetic Linkage Maps. CPRO-DLO, Wageningen, The Netherlands
-
Stracke S, Börner A
(1998)
Molecular mapping of the photoperiod response gene ea7 in barley.
Theor Appl Genet
97: 797-800[CrossRef]
-
Strayer C, Oyama T, Schultz TF, Raman R, Somers DE, Mas P, Panda S, Kreps JA, Kay SA
(2000)
Cloning of the Arabidopsis clock gene TOC1, an autoregulatory response regulator homolog.
Science
289: 768-771[Abstract/Free Full Text]
-
Suárez-López P, Wheatley K, Robson F, Onouchi H, Valverde F, Coupland G
(2001)
CONSTANS mediates between the circadian clock and the control of flowering in Arabidopsis.
Nature
410: 1116-1119[CrossRef][Medline]
-
Torok M, Elkin LD
(2000)
Two B or not two B? Overview of the rapidly expanding B-box family of proteins.
Differentiation
67: 63-71
-
Van Deynze AE, Nelson JC, Yglesias ES, Harrington SE, Braga DP
(1995)
Comparative mapping in grasses: wheat relationships.
Mol Gen Genet
248: 744-754[CrossRef][Web of Science][Medline]
-
Yano M, Katayose Y, Ashikara M, Yamanouchi U, Monna L, Fuse T, Baba T, Yamamoto K, Umehara Y, Nagamura Y, et al
(2000)
Hd1, a major photoperiod sensitivity quantitative trait locus in rice, is closely related to the Arabidopsis flowering time gene CONSTANS.
Plant Cell
12: 2473-2483[Abstract/Free Full Text]
-
Yu Y, Tomkins JP, Waugh R, Frisch DA, Kudrna D, Kleinhofs A, Brueggeman RS, Muehlbauer GJ, Wise RP, Wing RA
(2000)
A bacterial artificial chromosome library for barley (Hordeum vulgare L.) and the identification of clones containing putative resistance genes.
Theor Appl Genet
101: 1093-1099[CrossRef]
-
Yu J, Hu SN, Wang J, Wong GKS, Li SG, Liu B, Deng YJ, Dai L, Zhou Y, Zhang XQ, et al
(2002)
A draft sequence of the rice genome (Oryza sativa L. ssp. indica).
Science
296: 79-92[Abstract/Free Full Text]
-
Zeevaart JAD
(1976)
Physiology of flowering.
Annu Rev Plant Physiol
27: 321-348
© 2003 American Society of Plant Biologists
This article has been cited by other articles:

|
 |

|
 |
 
U. Lagercrantz
At the end of the day: a common molecular mechanism for photoperiod responses in plants?
J. Exp. Bot.,
July 1, 2009;
60(9):
2501 - 2515.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Baga, D. B. Fowler, and R. N. Chibbar
Identification of genomic regions determining the phenological development leading to floral transition in wheat (Triticum aestivum L.)
J. Exp. Bot.,
June 24, 2009;
(2009)
erp199v1.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Yamamoto, J. Yonemaru, and M. Yano
Towards the Understanding of Complex Traits in Rice: Substantially or Superficially?
DNA Res,
June 1, 2009;
16(3):
141 - 154.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Greenup, W. J. Peacock, E. S. Dennis, and B. Trevaskis
The molecular biology of seasonal flowering-responses in Arabidopsis and the cereals
Ann. Bot.,
June 1, 2009;
103(8):
1165 - 1172.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Takahashi, K. M. Teshima, S. Yokoi, H. Innan, and K. Shimamoto
Variations in Hd1 proteins, Hd3a promoters, and Ehd1 expression levels contribute to diversity of flowering time in cultivated rice
PNAS,
March 17, 2009;
106(11):
4555 - 4560.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Garris, L. Clark, C. Owens, S. McKay, J. Luby, K. Mathiason, and A. Fennell
Mapping of Photoperiod-induced Growth Cessation in the Wild Grape Vitis riparia
J. Amer. Soc. Hort. Sci.,
March 1, 2009;
134(2):
261 - 272.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Colasanti and V. Coneva
Mechanisms of Floral Induction in Grasses: Something Borrowed, Something New
Plant Physiology,
January 1, 2009;
149(1):
56 - 62.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Distelfeld, G. Tranquilli, C. Li, L. Yan, and J. Dubcovsky
Genetic and Molecular Characterization of the VRN2 Loci in Tetraploid Wheat
Plant Physiology,
January 1, 2009;
149(1):
245 - 257.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Datta, H. Johansson, C. Hettiarachchi, M. L. Irigoyen, M. Desai, V. Rubio, and M. Holm
LZF1/SALT TOLERANCE HOMOLOG3, an Arabidopsis B-Box Protein Involved in Light-Dependent Development and Gene Expression, Undergoes COP1-Mediated Ubiquitination
PLANT CELL,
September 1, 2008;
20(9):
2324 - 2338.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Y. P. Chia, A. Muller, C. Jung, and E. S. Mutasa-Gottgens
Sugar beet contains a large CONSTANS-LIKE gene family including a CO homologue that is independent of the early-bolting (B) gene locus
J. Exp. Bot.,
July 1, 2008;
59(10):
2735 - 2748.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Karsai, P. Szucs, B. Koszegi, P.M. Hayes, A. Casas, Z. Bedo, and O. Veisz
Effects of photo and thermo cycles on flowering time in barley: a genetical phenomics approach
J. Exp. Bot.,
July 1, 2008;
59(10):
2707 - 2715.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Datta, C. Hettiarachchi, H. Johansson, and M. Holm
SALT TOLERANCE HOMOLOG2, a B-Box Protein in Arabidopsis That Activates Transcription and Positively Regulates Light-Mediated Development
PLANT CELL,
October 1, 2007;
19(10):
3242 - 3255.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Izawa
Adaptation of flowering-time by natural and artificial selection in Arabidopsis and rice
J. Exp. Bot.,
September 1, 2007;
58(12):
3091 - 3097.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Hecht, C. L. Knowles, J. K. Vander Schoor, L. C. Liew, S. E. Jones, M. J.M. Lambert, and J. L. Weller
Pea LATE BLOOMER1 Is a GIGANTEA Ortholog with Roles in Photoperiodic Flowering, Deetiolation, and Transcriptional Regulation of Circadian Clock Gene Homologs
Plant Physiology,
June 1, 2007;
144(2):
648 - 661.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Faure, J. Higgins, A. Turner, and D. A. Laurie
The FLOWERING LOCUS T-Like Gene Family in Barley (Hordeum vulgare)
Genetics,
May 1, 2007;
176(1):
599 - 609.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Cockram, H. Jones, F. J. Leigh, D. O'Sullivan, W. Powell, D. A. Laurie, and A. J. Greenland
Control of flowering time in temperate cereals: genes, domestication, and sustainable productivity
J. Exp. Bot.,
April 9, 2007;
(2007)
erm042v1.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. W. Manfield, P. F. Devlin, C.-H. Jen, D. R. Westhead, and P. M. Gilmartin
Conservation, Convergence, and Divergence of Light-Responsive, Circadian-Regulated, and Tissue-Specific Expression Patterns during Evolution of the Arabidopsis GATA Gene Family
Plant Physiology,
February 1, 2007;
143(2):
941 - 958.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Gutierrez, G. Conejero, M. Castelain, S. Guenin, J.-L. Verdeil, B. Thomasset, and O. Van Wuytswinkel
Identification of new gene expression regulators specifically expressed during plant seed maturation
J. Exp. Bot.,
June 1, 2006;
57(9):
1919 - 1932.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Ciannamea, J. Busscher-Lange, S. de Folter, G. C. Angenent, and R. G. H. Immink
Characterization of the Vernalization Response in Lolium perenne by a cDNA Microarray Approach
Plant Cell Physiol.,
April 1, 2006;
47(4):
481 - 492.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Karlova, S. Boeren, E. Russinova, J. Aker, J. Vervoort, and S. de Vries
The Arabidopsis SOMATIC EMBRYOGENESIS RECEPTOR-LIKE KINASE1 Protein Complex Includes BRASSINOSTEROID-INSENSITIVE1
PLANT CELL,
March 1, 2006;
18(3):
626 - 638.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Datta, G.H.C.M. Hettiarachchi, X.-W. Deng, and M. Holm
Arabidopsis CONSTANS-LIKE3 Is a Positive Regulator of Red Light Signaling and Root Growth
PLANT CELL,
January 1, 2006;
18(1):
70 - 84.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Turner, J. Beales, S. Faure, R. P. Dunford, and D. A. Laurie
The Pseudo-Response Regulator Ppd-H1 Provides Adaptation to Photoperiod in Barley
Science,
November 11, 2005;
310(5750):
1031 - 1034.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Zhang, C. Chen, L. Li, L. Meng, J. Singh, N. Jiang, X.-W. Deng, Z.-H. He, and P. G. Lemaux
Evolutionary Expansion, Gene Structure, and Expression of the Rice Wall-Associated Kinase Gene Family
Plant Physiology,
November 1, 2005;
139(3):
1107 - 1124.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Vandepoele and Y. Van de Peer
Exploring the Plant Transcriptome through Phylogenetic Profiling
Plant Physiology,
January 1, 2005;
137(1):
31 - 42.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W.-R. Scheible, R. Morcuende, T. Czechowski, C. Fritz, D. Osuna, N. Palacios-Rojas, D. Schindelasch, O. Thimm, M. K. Udvardi, and M. Stitt
Genome-Wide Reprogramming of Primary and Secondary Metabolism, Protein Synthesis, Cellular Growth Processes, and the Regulatory Infrastructure of Arabidopsis in Response to Nitrogen
Plant Physiology,
September 1, 2004;
136(1):
2483 - 2499.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Bevan and S. Walsh
Positioning Arabidopsis in Plant Biology. A Key Step Toward Unification of Plant Research
Plant Physiology,
June 1, 2004;
135(2):
602 - 606.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W.A. Rensink and C. R. Buell
Arabidopsis to Rice. Applying Knowledge from a Weed to Enhance Our Understanding of a Crop Species
Plant Physiology,
June 1, 2004;
135(2):
622 - 629.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Hayama and G. Coupland
The Molecular Basis of Diversity in the Photoperiodic Flowering Responses of Arabidopsis and Rice
Plant Physiology,
June 1, 2004;
135(2):
677 - 684.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. C. Reyes, M. I. Muro-Pastor, and F. J. Florencio
The GATA Family of Transcription Factors in Arabidopsis and Rice
Plant Physiology,
April 1, 2004;
134(4):
1718 - 1732.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Yan, A. Loukoianov, A. Blechl, G. Tranquilli, W. Ramakrishna, P. SanMiguel, J. L. Bennetzen, V. Echenique, and J. Dubcovsky
The Wheat VRN2 Gene Is a Flowering Repressor Down-Regulated by Vernalization
Science,
March 12, 2004;
303(5664):
1640 - 1644.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|