|
Plant Physiol, May 2003, Vol. 132, pp. 174-184
Chimeric RNA/DNA Oligonucleotide-Based Site-Specific Modification
of the Tobacco Acetolactate Syntase Gene
Andrej
Kochevenko* and
Lothar
Willmitzer
Max-Planck-Institute of Molecular Plant Physiology, Am
Mühlenberg 1, 14476 Golm, Germany
 |
ABSTRACT |
Single amino acid substitutions at either of two crucial
positions in acetolactate synthase (ALS) result in a
chlorsulfuron-insensitive form of this enzyme and, as a consequence, a
herbicide-resistant phenotype. Here, we describe the successful in vivo
targeting of endogenous tobacco (Nicotiana tabacum) ALS
genes using chimeric RNA/DNA and all-DNA oligonucleotides at two
different locations. Similar number of conversion events with two
different chimeras indicates the absence of restricting influence of
genomic target sequence on the gene repair in tobacco.
Chlorsulfuron-resistant plants were regenerated from calli after
mesophyll protoplast electroporation or leaf tissue particle
bombardment with these specifically constructed chimeras. Sequence
analysis and enzyme assays proved the resulting alterations to ALS at
both DNA and protein levels. Furthermore, foliar application of
chlorsulfuron confirmed the development of resistant phenotypes. Lines
with proline-196-alanine, threonine, glutamine, or serine substitutions or with tryptophan-573-leucine substitutions were highly resistant at
both cellular and whole plant levels, whereas lines with
proline-196-leucine substitutions were less resistant. The stability of
these modifications was demonstrated by the continuous growth of calli
on chlorsulfuron-containing medium and by the transmission of herbicide
resistance to progeny in a Mendelian manner. Ability of haploid state
to promote chimera-mediated conversions is discussed.
 |
INTRODUCTION |
The glut of sequence information now
available for many organisms demands the application of reliable
reverse genetics techniques to associate genes with their functions.
Several reverse genetics strategies have been developed and are
currently used in plants with different degrees of success. Some of
them, like T-DNA or transposon insertional mutagenesis, fast neutron
deletion mutagenesis, and the targeting of induced local lesions in
genomes, are based on random processes (integration or mutation) and
the subsequent application of various methods to identify desirable
mutants. In many non-plant model species, homologous recombination is
used to target genes for mutagenesis. Although gene targeting has been achieved in plants (for ectopic and endogenous genes), it is still far
from routine. Low frequency of homologous recombination and inaccurate
integration are basic barriers that must be overcome to make gene
targeting work in higher plants (Morton and Hooykaas, 1995 ; Mengiste and Paszkowski, 1999 ).
A new strategy, chimera-directed gene alteration, was developed
to correct or induce site-specific point mutations in mammalian cells
and has been applied recently to animals and yeast (Yoon et al.,
1996 ; Alexeev et al., 2000 ;
Bartlett et al., 2000 ). This gene targeting strategy is
based on the action of chimeric RNA/DNA oligonucleotides (chimeras;
Yoon et al., 1996 ). Chimeric oligonucleotides are
self-complementary and produce double-hairpin structures. In this
duplex conformation, two complementary strands can be distinguished: a
chimeric strand consisting of an interposed DNA fragment (5 bp) and two
stretches of RNA (10 bp) flanking this region, and another strand that
is composed only of DNA. The specific structure of this vector (two
thymidine hairpins, a "GC" clamp at the 3' end, and
2'-O-methylated RNA residues) makes it stable within cells.
To target a gene, a chimera must be identical to the gene with the
exception of a single nucleotide. This produces a mismatched base that
is presumably recognized by endogenous repair machinery. The precise
mechanism of this conversion is unknown, but it is believed that it is
based on a two-step process: homologous pairing that results in the
formation of a double D-loop structure and
subsequent endogenous repair activity. From recent studies, it appears
that the chimeric strand provides stability to the intermediate joint
molecule, whereas the DNA strand is used by endogenous repair machinery
as a template for correction (Gamper et al., 2000a ). The
possibility of using a chimeric oligonucleotide to promote
site-specific alterations was shown for the first time in episomal DNA
(Yoon et al., 1996 ). Later, it was successfully targeted
to chromosomal sequence in mammalian cells and animal models
(Kren et al., 1997 , 1999 ; Alexeev
and Yoon, 1998 ; Alexeev et al., 2000 ;
Bartlett et al., 2000 ). These investigations in mammalian cells revealed several findings about the chimera strategy: (a) the efficiency is high and exceeds that found in experiments with
homologous recombination, (b) it provides a high specificity of
nucleotide conversion or nucleotide incorporation, and (c) corresponding DNA/DNA duplexes remain inactive under the same conditions.
In the plant kingdom, the production of chimera-mediated point and
frame shift mutations in genomic (acetolactate synthase [ALS] gene)
and in artificial (nonfunctional green fluorescent protein gene)
targets, respectively, was described in somatic cells of tobacco
(Nicotiana tabacum) and maize (Zea mays;
Beetham et al., 1999 ; Zhu et al., 1999 ).
However, in these studies, whole plants were regenerated only from
maize callus. Segregation of herbicide-resistant and nonresistant
phenotypes exhibited the expected Mendelian ratios (Zhu et al.,
2000 ), which indicated that chimera-dependent changes could be
stably transmitted through meiosis as well as mitosis. Unexpectedly,
the application of chimera-mediated gene repair techniques in plants
results in low efficiencies in comparison with animal cells. The
appearance of semitargeted mutations as a shift of conversion from the
expected nucleotide in the 5' position or mutations other than those
intended in the expected nucleotide also occur in plants. Studies in
cell-free extract system by Rice et al. (2000) confirmed
these peculiarities of chimera-dependent conversion in plants.
ALS catalyzes the initial step common to the biosynthesis of the
branched chain amino acids Leu, Ile, and Val. Sulfonylureas are one
class of herbicides that specifically inhibit this enzyme. In resistant
lines, the herbicide insensitive form of ALS is present (Chaleff
and Mauvais, 1984 ). The allotetraploid species tobacco has two
genetically unlinked loci, SuRA and SuRB, for
ALS. Mutations in either SuRA (Pro-196-Glu and Pro-196-Thr)
or SuRB (Pro-196-Ser) locus result in single amino acid
replacements at position 196 and a herbicide-resistant phenotype
(Lee et al., 1988 ; Harms et al., 1992 ;
Beetham et al., 1999 ). It was also shown that the S4-Hra mutant of tobacco bearing two linked mutations within locus
SuRB had amino acid substitutions at positions 196 (Pro-196-Ala) and 573 (Trp-573-Leu), and it was more resistant to
chlorsulfuron. Genetic linkage between these mutations did not allow
the recovery of the independent contribution of each mutation for these
highly resistant phenotypes (Creason and Chaleff, 1988 ).
Lee et al. (1990) were able to target the wild-type ALS
gene of tobacco via homologous recombination. To produce an amino acid
substitution from Trp to Leu that would render a
chlorsulfuron-resistant phenotype, a targeting vector carrying a 3' end
fragment of a mutant gene from S4-Hra was used. Although targeting was
achieved, it was accompanied by random integration of the targeting
vector into the genome, and the phenotype conferred by Hra mutation
remained unknown. Interestingly, the same type of amino acid change
(Trp to Leu) in the conserved region near the C terminus of ALS (as a
result of 1-bp substitution, G to T) resulted in sulfonylurea resistance in a Xanthium sp. and Brassica napus
(Bernasconi et al., 1995 ; Hattori et al.,
1995 ). Moreover, in cocklebur (Xanthium), all
possible mutations affecting the Trp at this position were investigated
using site-directed mutagenesis, and only Trp-Leu substitution yielded
an active, herbicide-insensitive form of ALS (Bernasconi et al.,
1995 ).
In our study, we used an oligonucleotide-mediated strategy
to create single point mutations at different positions within ALS
genomic sequences of tobacco. Sequence analysis confirmed that
application of oligonucleotides with various targeting sequences resulted in the production of predicted alterations. The same frequency
of chimera-mediated conversions at different target sites suggests the
absence of influence of genomic target sequence on the gene repair in
tobacco. The assay of ALS activity in the leaves of resistant lines in
the presence of chlorsulfuron demonstrated the appearance of an
herbicide-insensitive form of the enzyme. Our data also suggest a
correlation between the appearance of nonspecific chimera-dependent
alterations and the ability of selection systems applied to detect them.
 |
RESULTS |
Production of Site-Specific Modifications to the ALS Gene by
Chimera-Mediated Mutagenesis
In the allotetraploid species tobacco, there are two
highly conserved ALS genes (SuRA and SuRB) that
are expressed in all tissues (Keeler et al.,
1993 ). Two chimeric RNA/DNA oligonucleotides were designed to
obtain separate targeted single-nucleotide conversion at two different
positions within either of these genes (Fig. 1, A and B). The chimeras used in our
study had the same structure as those that directed repair mutations in
animals (Kren et al., 1999 ; Alexeev et al.,
2000 ; Bartlett et al., 2000 ). The targeting region of these chimeras consisted of a 25-bp region homologous to the
target DNA with the exception of 1 centralized bp. ChALS-588 was
designed to produce single nucleotide substitution from C to A at
nucleotide position 588, and ChALS-1719 was designed to convert G to T
at nucleotide position 1,719. These nucleotide conversions led to amino
acid changes Pro-Gln at position 196 and Trp-Leu at 573, respectively.
Both predicted amino acid substitutions, Pro-196-Glu and Trp-573-Leu,
must result in a herbicide-insensitive form of ALS. Therefore, the
desired conversion of the targeted base could be recovered by growing
transformed cell colonies on chlorsulfuron-containing medium (Fig.
2A). Chimeric RNA/DNA oligonucleotides (ChALS-588 and ChALS-1719) were introduced into tobacco cells independently. In each experiment, several types of controls were used:
untreated cells or protoplasts, treated without oligonucleotides, treated with nonspecific chimeric oligonucleotide, and treated with
oligonucleotide composed of DNA only (ChALS-587). Electroporation of
protoplasts and bombardment of cell colonies were used to
deliver the chimeric oligonucleotide ChALS-1719. Four colonies
were recovered on selection medium with 140 nM
chlorsulfuron after particle bombardment of 3 × 106 cells and five colonies after electroporation
of 6 × 106 protoplasts. Then, we examined
the capacity of the haploid state to promote chimera-mediated
conversions. For this purpose, haploid lines of tobacco were generated
by anther culture on double-layer medium H (Nitsch and Nitsch,
1969 ) with activated charcoal. The reduction in chromosome
number was verified by caryological analysis (data not shown). The
chimeric oligonucleotide ChALS-588 was delivered into protoplasts by
electroporation. After treatment of 7 × 106
protoplasts of wild type and 6 × 106
protoplasts of haploid lines six and four, respectively,
green-resistant colonies were found on medium containing 56 nM chlorsulfuron. In all control experiments
(except cells treated with DNA oligonucleotide), 39 × 106 cells were used and two resistant colonies
(Mu-1 and Mu-2) were obtained (but one colony was unable to grow when
the selective agent in the medium was increased up to 140 nM chlorsulfuron). In experiments with a DNA-only
oligonucleotide (ChALS-587), a total of 15 × 106 cells were treated, and two resistant
colonies were recovered (rchl-17 and rchl-42).

View larger version (26K):
[in this window]
[in a new window]
|
Figure 1.
Sequences of targeting oligonucleotides and
strategy of gene correction by chimeric oligonucleotides. A,
Oligonucleotide sequences. B, Schematic presentation of
chimera-mediated gene conversion. The endogenous DNA repair system
mediates conversion of G to T at position 1,719, gives rise to
substitution of Trp to Leu, and leads to appearance of
chlorsulfuron-resistant phenotype. Lowercase letters indicate
2'-O-methyl RNA residues, and uppercase letters indicate DNA
bases. The mismatched base is underlined. The chimeric ChALS-588 and
the DNA-composed oligonucleotide ChALS-587 are designed to make
conversions at the codon for Pro-196, whereas chimera ChALS-1719 is
designed to alter the codon for Trp-573. ChALS( ) is a nonspecific
chimera.
|
|

View larger version (81K):
[in this window]
[in a new window]
|
Figure 2.
Resistance to chlorsulfuron at cellular and whole
plant levels. A, Green-resistant colony on selective medium. B, Plants
of wild-type (WT) and resistant (R) line rchl-6.6 growing on medium
containing 560 nM herbicide. C and D, Response of resistant
and wild-type plants to foliar application of
chlorsulfuron.
|
|
Analysis of Targeted Sequences from the Resistant Lines
To confirm that resistant lines appeared due to chimera-dependent
specific conversion, total DNA was isolated, and fragments including
the target site near the 5' or 3' ends of the ALS gene were amplified
by PCR. Direct sequencing of these fragments revealed a small new peak
at the targeted codon on sequence chromatograms. The PCR products from
wild type had unchanged sequence patterns (Fig.
3). The observed weak peak could be
explained as artifacts or real conversion events that occurred only in
one of several copies of ALS genes. To clarify this, we produced
haploid plants from our resistant lines and selected them by growing on
chlorsulfuron-containing medium. The idea was to decrease the number of
unchanged copies of the ALS gene. Sequence analysis of the targeted
region of resistant haploid lines revealed the presence of increased
signal corresponding to the same nucleotide that was observed on
chromatograms in the original T0 plants.
Furthermore, PCR products of targeted regions of
T0 resistant plants were ligated into the
pPCR-Script Amp SK(+) vector and individually sequenced. In all cases,
sequence analysis demonstrated the alteration of one nucleotide at the
codon corresponding to Pro-196 or Trp-573. Because a change in
nucleotides at different positions within the ALS gene could provide
chlorsulfuron resistance, we performed sequence analysis of PCR
fragments generated from the 5' and 3' ends of ALSs from all analyzed
resistant lines to ensure that resistance was a result of
chimera-mediated conversion. In the case of the chimeric
oligonucleotide ChALS-1719, the observed change was limited to a single
nucleotide substitution (G to T) at position 1,719; the codon for
Pro-196 was unchanged. Application of the chimeric oligonucleotide
ChALS-588 resulted in changes to the codon Pro-196 as predicted; no
changes were found at the second possible region. Interestingly, in
experiments targeting the Trp-573 codon, only predicted base
replacements (G T) were found. However, the second chimeric
oligonucleotide (ChALS-588) targeting the Pro-196 codon also resulted
in semitargeted conversions. Sequence analysis of two lines (rchl-17
and rchl-42) obtained using DNA-only construct (ChALS-587) resulted in
single nucleotide conversions (C G and C A, respectively) at
predicted positions only (Fig. 3; Table
I).

View larger version (54K):
[in this window]
[in a new window]
|
Figure 3.
Confirmation of oligonucleotide-mediated
acetolactate syntase gene conversion by sequence analysis. Nucleotide
sequences from control wild type (WT) and independent resistant lines
rchl-6.6, rchl-17, rchl-20, and rchl-3.11 are shown. G2 rchl-6.6 is
sequence of haploid from line rchl-6.6. Plate A, Nucleotide
substitutions at the codon for Trp-573. Plate B, Nucleotide
substitutions at the codon for Pro-196. The targeted codon is
underlined and conversion events are indicated with
arrows.
|
|
Resistance on Cellular and Whole-Plant Levels
Callus cells remained chlorsulfuron resistant during several
passages, demonstrating stable transmission of the modified gene in
somatic cells. To induce organogenesis, resistant colonies were
transferred to regeneration medium (Murashige and Skoog, 1962 ; 1 mg L 1 6-benzyl-aminopurine, and 0.1 mg
L 1 -naphthaleneacetic acid) with 140 nM herbicide. Regenerated plantlets were cultured on
Murashige and Skoog medium containing 420 nM chlorsulfuron.
Wild type could not grow at such herbicide concentrations, but all
resistant lines were able to produce roots and elongate shoots (Fig.
2B). The inhibition of root production was detected only for line
rchl-3.11. T0 plants were transferred into the greenhouse, and 3-week-old plants were sprayed with
chlorsulfuron. Different concentrations (84, 140, and 280 µM) of herbicide were applied. Two weeks after treatment,
wild-type plants were discolored, widely necrotic, and sometimes the
whole leaf blade was dry (Fig. 2D). A concentration of 84 µM was sufficient to distinguish resistant and
nonresistant phenotypes (Fig. 2C). Resistant lines were significantly different from the wild type in fresh weight. Plants of
resistant lines had green leaves, and no necroses were detected
except for plants of line rchl-3.11. Some leaves of these plants had
small necrotic spots (Table
II).
View this table:
[in this window]
[in a new window]
|
Table II.
Assessment of wild-type and independent resistant
lines after herbicide application and segregation of chlorsulfuron
resistance in T1 progeny
|
|
It is worth noting that during regeneration of resistant colonies that
were selected in the experiments with haploid plants, chromosome
doubling took place (data not shown). Hence, regenerated dihaploid
plants were homozygous for the altered ALS gene that led to higher
viability after herbicide treatment (Table II).
Biochemical Analysis
To prove that chimera-mediated conversions resulted in the
appearance of a chlorsulfuron-insensitive form of ALS, enzyme activity was assayed in the presence and absence of chlorsulfuron. ALS activity
in the leaf extracts from wild type was greatly inhibited under all
tested concentrations. All resistant lines demonstrated lower
sensitivity of ALS in extracts to the inhibition by chlorsulfuron. Line
rchl-3.11 was intermediate in its response to increasing herbicide
concentrations in comparison with other lines that demonstrated similarly high degrees of resistance to chlorsulfuron (Fig.
4).

View larger version (12K):
[in this window]
[in a new window]
|
Figure 4.
Inhibition of ALS activity by chlorsulfuron in
leaf extracts. ALS activities are presented as percentages of the
respective activity in the absence of herbicide. , Line rchl-6.6; *,
rchl-5.5; , rchl-3.11; , rchl-17; , wild type. Each data point
is the mean ± SE from measurements of activity of
five independent plants.
|
|
Transmission of the Altered Gene through Meiosis
Seeds from self-fertilized resistant lines
(T0 plants) were collected and after germination
were transferred to the medium containing 560 nM
chlorsulfuron. T1 seedlings segregated for
resistant and nonresistant phenotypes (Table II). On average, about
one-third of the seedlings were sensitive to the herbicide. These
results indicated that chlorsulfuron resistance was inherited as a
single dominant Mendelian trait.
 |
DISCUSSION |
Homologous recombination-dependent gene
targeting in plants is characterized by low frequency of integration
and random integration of targeting vector elsewhere in the genome
(Morton and Hooykaas, 1995 ; Mengiste and
Paszkowski, 1999 ). In addition, some examples of mitotic and
meiotic instability of targeted genes have been described
(Paszkowski et al., 1988 ; Lee et al.,
1990 ; Schaefer and Zryd, 1997 ). In contrast,
oligonucleotide-directed gene targeting is not accompanied by random
construct integration, and converted genes are regulated by their own
promoters in their natural genetic background (Kren et al.,
1997 ; Zhu et al., 2000 ). Altered genes are also
stably maintained during mitosis (Alexeev and Yoon,
1998 ; Beetham et al., 1999 ; Igoucheva and
Yoon, 2000 ) and transmitted in a Mendelian fashion to
subsequent generations (Zhu et al., 2000 ).
In this study, we report the use of synthetic RNA/DNA oligonucleotides
to produce distinct, precise modifications within the ALS gene of
tobacco at two different target sites. Two chimeras were designed and
delivered in independent experiments into wild-type cells of tobacco.
Such an approach should allow us to distinguish between
chimera-mediated conversions and random mutations. In each set of
experiments in which different chimeric oligonucleotides were used,
detection of conversion event at the targeted region and absence of any
changes at the second possible site served as additional proof that the
herbicide-resistant phenotype appeared as a result of chimera-directed
gene targeting. On the other hand, this should answer the question
about the possibility of a single mutation within the ALS gene at
nucleotide 1,719 by itself to provide chlorsulfuron resistance, and if
this is the case, about the degree of this resistance. A previously
described double mutant of tobacco S4-Hra bearing two linked mutations
in Pro-196-Ala and Trp-573-Leu possessed a highly
chlorsulfuron-resistant phenotype (Creason and Chaleff,
1988 ; Lee et al., 1988 ). Because one mutation was produced in the genetic background of another, it was not possible
to examine the contribution of each of them in the resulting phenotype.
Our experiments with chimera ChALS-1719 clearly demonstrated that
single amino acid substitution Trp-573-Leu alone can provide a
chlorsulfuron-resistant phenotype. The fact that this mutation was
generated on the wild-type background allowed its phenotypic expression
to be revealed. As follows from results of enzyme activity assays, two
resistant lines, rchl-17 (Ala-196 corresponding to S4 mutation) and
rchl-6.6 (Leu-573 corresponding to Hra mutation), possessed similar
level of ALS activity (Fig. 4) and responded in similar manners to
herbicide treatment (Table II). These data suggest that the high level
of chlorsulfuron resistance seen for the double mutant S4-Hra probably
arose from an additive effect of two mutations.
Application of only DNA-composed oligonucleotide ALS-587 resulted in
the generation of alterations at the intended nucleotide (Table I; Fig.
3). However the frequency of changes was low. There are two lines of
evidence that a DNA duplex was able to provide repair activity in vivo.
First, changes were found in the codon for Pro-196, which was chosen as
a target, but a second possible place (codon Trp-573)
alteration, which also could result in generation of herbicide
resistance, remained unchanged. Second, even alterations in the codon
Pro-196 at any nucleotide could lead to production of
herbicide-resistant phenotype. However, only the targeted nucleotide
was modified, which also indicated oligonucleotide-directed character
of conversions. This is consistent with findings in the in vitro system
(plant cell-free extracts), where it was shown that all-DNA
oligonucleotides mediated targeted repair (Rice et al.,
2000 ). In contrast, such activity has never been observed in
experiments with mammalian cells (Yoon et al., 1996 ;
Kren et al., 1997 ).
Using both chimeric oilgonucleotides resulted in the intended
conversions of the ALS gene of tobacco; however, some semitargeted alterations also were detected (Table I). These results are
contradictory to those obtained in a study by Beetham et al.
(1999) , where a chimera-mediated change of the codon for
Pro-196 in the ALS gene of tobacco was achieved, but in all cases the
only nucleotide located near the 5' end of the targeted base was
changed. In our opinion, detection of only semitargeted modifications
in the same model system could reflect peculiarities of the selection
system used (see below). The big pool of spontaneous mutations, which was observed in this work, and the inability to regenerate plants could
be referred to using tobacco cell suspension culture. Reduction of
morphogenic potential and appearance of mutations during maintenance of
cell suspension cultures is well documented (Halperin,
1986 ; Sree Ramulu, 1986 ). Our results showed
that mesophyll protoplast cells are competent in the chimera-mediated
conversions. Using mesophyll protoplasts also allowed the reduction of
the appearance of spontaneous mutations and the regeneration of plants
to be achieved. This made possible further study of the inheritance of
the modified gene.
In experiments with maize, a precise targeted correction mediated by a
chimera was reported, although additional semitargeted conversions were
also found (Zhu et al., 1999 ). Using a plant cell-free
extract system, the diminished fidelity of chimera-directed gene repair
(incorrect conversion at the predicted nucleotide position as well as a
shift in the 5' side from the targeted nucleotide) was confirmed
(Rice et al., 2000 ). In vitro and in vivo experiments with plant semitargeted conversions were always detected at one position in 5' direction to the targeted nucleotide. The shift of
conversion in 3' side was never observed. Because formation of a
complement-stabilized D-loop is a key step in chimera-mediated gene
repair, the appearance of these non-correct mutations could be
explained by the existence of alternative pathways (high-fidelity repair and different mutagenic pathways) for processing this joint molecule (Gamper et al., 2000a ). The correlation between
appearance of unspecific base alterations and nonoptimal modifications
of the backbone of the chimera (Gamper et al., 2000a ) or
single-stranded oligonucleotides (Gamper et al., 2000c )
also supports this assumption. Interestingly, the frequency of
conversion events for chimera-mediated repair in plants was 3 orders of
magnitude less than was observed for mammalian cells (Zhu et
al., 1999 ). In combination with observations that a DNA duplex
can provide targeted gene conversions and that chimera-dependent
nonspecific mutations can be generated, this finding indicates the
possible existence of different repair pathways in animals and plants.
In our experiments, a second nucleotide at the codon corresponding to
Pro-196 or Trp-573 was chosen as a target for chimera-mediated conversion. Such an approach should allow us to detect both types of
previously revealed nonspecific alterations as a shift of
conversion and incorrect conversion if those would take place and
distinguish oligonucleotide-dependent alterations and random
mutations. Surprisingly, chimera ChALS-1719 led to only targeted
conversion, whereas application of ChALS-588 resulted in both targeted
and semitargeted alterations (Table I; Fig. 3). In our opinion, this
can be explained by the selection system applied. Recovery of
conversion events in a big pool of treated cells was based on
expression of the altered form of an ALS gene, the product of which
renders tobacco cells resistant to the herbicide. Several single amino
acids substitutions at position 196 of ALS, Pro-196-Glu, Pro-196-Ser,
Pro-196-Ala, and Pro-196-Thr (Lee et al., 1988 ;
Harms et al., 1992 ; Beetham et al., 1999 )
and Pro-196-Leu (this study, Table I) led to the appearance of
chlorsulfuron-resistant phenotypes. Thus, any chimera-dependent nucleotide changes at this codon (no matter if the first or second nucleotide was changed) could be recovered. In contrast, within other
conserved sites of the ALS protein involved in the herbicide binding,
only one specific amino acid substitution, Trp-573-Leu, led to
sulfonylurea resistance (Creason and Chaleff, 1988 ;
Bernasconi et al., 1995 ; Hattori at al.,
1995 ). Therefore, even though other types of alteration took
place in the experiments with ChALS-1719, these would not have been
recovered because they were not accompanied by chlorsulfuron
resistance. The results obtained with all-DNA construct (ChALS-587)
also support such conclusions. A shift of repair conversion in the 5'
side from the predicted nucleotide was described (Beetham et
al., 1999 ; Zhu et al., 1999 ; Rice et al.,
2000 ). Thus, theoretically we could expect such an effect, but
only conversions at the targeted nucleotide 587 were obtained (Table
I). The substitution of C for G or A can be understood because any
nucleotide substitutions for the first nucleotide of the Pro-196 codon
could be identified using our selection system (which is based on
recovery of chlorsulfuron-resistant cells). In contrast, even if the
third nucleotide (which is at a 5' side of the targeted nucleotide) of
the adjacent codon of Val-195 is changed to another nucleotide, it
would result in a silent mutation, and such an event would remain
undetectable because it would not render resistance to the herbicide.
In previous studies, the appearance of chimera-directed conversions
were proved on the DNA level by RFLP and sequence analyses. Together
with the latter, we also used enzyme activity assay to verify
conversions at the protein level. Variable levels of ALS resistance to
chlorsulfuron among different mutant lines were revealed (Table II;
Fig. 4). Thus, the line rchl-3.11 containing substitution Pro-196-Leu
had approximately 2-fold less resistance to chlorsulfuron than other
lines. This was accompanied by stronger inhibition of callus, seedling
growth, and delay of root production on selective medium. The observed
differences suggest that different types of amino acid substitution
confer unequal levels of chlorsulfuron resistance, and, under strong
selective conditions, cells with defined type of alterations could not
survive. This finding explains why in the study of Beetham et
al. (1999) , after application of a chimeraplast designed to
modify codon for Pro-196 (CCA to CTA), only
semitargeted alterations were detected. In that report, regeneration of
herbicide-resistant plants was not achieved and conversion events were
identified as calli that were able to grow under strong chlorsulfuron
selection. Our data clearly show that under such conditions, cells
bearing Leu (CTA) at the position 196 in the amino acid sequence of ALS
are susceptible (Table II; Fig. 4). Thus, the selection system applied
in those experiments could be one of the reasons why only conversions
adjacent to the targeted nucleotide were observed. Zhu et al.
(1999) demonstrated that chemical selection influenced the
frequency of chimera-mediated alterations. In maize, the frequency of
green fluorescent protein-expressing cells that appeared because
of conversion events was higher in comparison with experiments where
chemical selection was employed. These data and our results demonstrate
that the selection system applied may influence the frequency of
chimera-mediated targeting events and the ability to detect
semitargeted chimera-dependent conversions.
Studies with yeast, bacteria, mammalian, and plant cells did not reveal
obvious restriction to DNA sequences that can be targeted by chimeric
oligonucleotides (Graham and Dickson, 2002 ; Kren
and Steer, 2002 , and refs. therein). However, when the APOAI
gene in human (Homo sapiens) HepG2 cells was targeted at two
locations, the conversions were obtained only at one target site
(apoAIParis). A limited correction at second site
(apoAIMilano) was achieved in CHO cells. This
finding pointed out the possible limitation of chimera-mediated
correction by differences between the two target sequences
(Graham et al., 2001 ). In our experiments, application of ALS-588 and ALS-1769 chimeraplasts, mediating conversion at two
different sites inside the ALS gene, resulted in comparable frequency
of conversion events. Together with the fact that our chimeras had the
equal purity and the same level of GC content, this suggests that the
influence of genomic target sequence on the gene repair in tobacco was
not detected.
Gene targeting of plants using homologous recombination is currently
limited by low efficiency and inaccurate integration. Only moss
(Physcomitrella patens) demonstrates a high rate of homologous recombination. It has been speculated that the efficiency of
homologous integration might correlate with the haploid state (Schaefer and Zryd, 1997 ). The mechanisms of
chimera-directed gene repair and homologous recombination are different
(Gamper et al., 2000a ; Chen et al.,
2001 ). However, experiments with chicken (Gallus
gallus) B cells and embryonic mouse (Mus musculus)
fibroblasts lacking an active p53 protein in which high frequency of
homologous recombination was correlated with high frequency of
chimera-mediated conversion demonstrated that cell recombination
activity is important for chimera-dependent repair (Igoucheva et
al., 1999 ; Alexeev and Yoon, 2000 ). The
observation that the RecA protein can catalyze strand exchange between
chimera and DNA duplex also suggests that recombination is a necessary
step in chimera-dependent correction (Gamper et al.,
2000a , 2000b ). In view of these results, we
assessed the role of the haploid state in increasing frequency of
chimera-mediated conversion. For this purpose, haploid plants of
tobacco were produced, and chimera ChALS-588 was
electroporated into protoplasts. However, the number of
recovered chlorsulfuron-resistant colonies did not differ significantly
from those derived from wild-type protoplasts (see results). This
observation is consistent with studies on the haploid green alga
Volvox carteri and haploids of tobacco in
which it has been shown that a haploid nature per se was not enough for
successful targeting of arylsulfatase gene (Hallmann et al.,
1997 ) or disruption of the nitrate reductase gene
(Lebel, 1994 ). Although our results suggest that the
haploid state by itself could not elevate the frequency of targeted
conversion, using haploids in chimera-targeting experiments provides
some new insights. First, it gives opportunity to operate with
recessive traits, and second, it makes possible one-step production of
homozygous plants with respect to the modified gene.
 |
CONCLUSION |
In summary, we produced chlorsulfuron-resistant lines of tobacco
by modifying an endogenous ALS gene at different positions using in
vivo site-specific oligonucleotide-mediated conversion. The limitation
of chimera-mediated gene conversion by differences in genomic target
sequences was not observed. Using this technique allowed the generation
of plants with separate new point mutations causing amino acid
substitutions Pro-196-Leu and Trp-573-Leu, which are characterized by
different phenotypic and biochemical responses to the application of
chlorsulfuron. The selection system applied may influence the
capacity to detect different types of chimera-mediated alterations.
Stable transmission of chlorsulfuron resistance in several generations
of somatic cells of tobacco and Mendelian inheritance in
T1 progeny verified the permanent character
of chimeroplast and all-DNA oligonucleotide-dependent conversions.
The low frequency of observed alterations will still discourage wide
application of this strategy. However, we hope that further elucidation
of mechanism of oligonucleotide-mediated targeted gene conversion would
help to improve the design of structure of RNA/DNA or single-stranded
oligonucleotides that would result in increase of frequency. This would
allow the expansion of the applicability of this technique as a
powerful tool for the modification or disruption of the genes to create
desirable phenotypes or knockout mutants.
 |
MATERIALS AND METHODS |
Design of Targeting Oligonucleotides
The oligonucleotide sequences (Interactiva, Ulm, Germany) are
shown in Figure 1. They were designed to target the ALS gene of tobacco
(Nicotiana tabacum) at the desired position and, with the exception of ChALS( ), shared homology to this gene. Chimera ChALS-1719 was designed to create a single G T substitution at nucleotide position 1,719, and ChALS-588 was designed to create an
A C conversion at position 588. Oligonucleotide ChALS-587 was constructed to produce a single C G conversion at position 587 and
was composed of DNA residues only. The ChALS( ) chimeric
oligonucleotide had no homology to the ALS sequence and served as a
nonspecific control.
Plant Material and Transformation Procedure
Axenic shoots of tobacco cv Samsun were cultivated on Murashige
and Skoog medium (Murashige and Skoog, 1962 )
supplemented with 20 g L 1 Suc at 25°C, with
illumination of 250 µmol m 2s 1 and a 16-h
photoperiod. Mesophyll protoplasts were isolated using enzyme medium
containing 1% (w/v) Cellulase R10 (Sigma, St. Louis) and 0.5%
(w/v) Driselase (Fluka) in a solution of 0.5 M Suc and 5 mM CaCl2. After overnight incubation of the
aseptic leaves in this mixture at 25°C, the suspension was diluted by
0.5 M Suc, passed through nylon mesh (100 µm), and
centrifuged at 50g for 5 min. Floating protoplasts were
collected and washed twice with W5 solution (Menzel and
Wolfe, 1984 ). Isolated protoplasts (5 × 105)
were electroporated with the appropriate oligonucleotide (0.5 µg)
using a Bio-Rad Gene Pulser II (Bio-Rad Laboratories, Hercules, CA) in medium M (0.3 mL) containing 8 mM HEPES, 4 mM CaCl2, 70 mM KCl, and 0.4 M mannitol (pH 7.2). Electroporation conditions were as
follows: voltage, 250 V; capacitor, 240 µF; and distance between
electrodes, 4 mm. Protoplasts were cultivated in dark conditions at
25°C in 10 mL of K3NM medium (Nagy and Maliga,
1976 ) containing 0.4 M mannitol as an osmotic
stabilizer. After 7 d, they were transferred to light conditions.
Selection was started in liquid culture 2 weeks after protoplast
isolation. Then, cell colonies were transferred to solidified selective
medium with 56 and 140 nM chlorsulfuron for ChALS-588 and
ChALS-1719, respectively. In particle bombardment experiments,
protoplasts were cultured as described above and colonies about 1 to 2 mm in diameter were used for bombardment. Oligonucleotides
(0.5 µg) were precipitated onto gold particles (1 µm)
and delivered to microcalli using a Bio-Rad PDS-1000 He device as
described previously (Klein et al., 1988 ). A helium
pressure of 1,100 psi was used to accelerate the particles, and the
vacuum in the chamber was 28 inches of Hg. After bombardment, colonies
were plated on Murashige and Skoog medium with 0.2 M
mannitol and were transferred in 2 or 3 d onto selective medium
with 140 nM chlorsulfuron and without mannitol. After 3 to
4 weeks of culture, resistant colonies were transferred to Murashige
and Skoog regeneration medium containing 1 mg L 1
6-benzyl-aminopurine and 0.1 mg L 1
-naphthaleneacetic acid.
Haploid Plant Production and Caryotype Analysis
Anthers of tobacco were cultured on H-medium (Nitsch and
Nitsch, 1969 ) using a double-layer method (Johansson et
al., 1982 ). Root tip cells from the aseptically grown, haploid
plants produced using this method were caryotyped as described
previously (Kochevenko et al., 1996 ).
PCR Amplification and Sequencing Analysis
PCR was performed with Pfu Turbo DNA polymerase (Stratagene, La
Jolla, CA) to ensure high fidelity. Reactions were carried out
in 50-µL volumes containing 10 mM KCl, 20 mM
Tris-HCl (pH 8.8), 2 mM MgSO4, 0.1%
(v/v) Triton X-100, 200 µM of each dNTP, 250 ng of
each primer, and 100 ng of genomic DNA. After an initial denaturation
step at 95°C for 5 min, the reaction mixtures were subjected to 35 amplification cycles of 95°C for 1 min, 65°C for 1.3 min, and
72°C for 2 min with subsequent incubations for 10 min at 72°C. The
sequences of the primers used were (5' to 3'): 1fwd,
GGGTTACGCACGCGCCACCGG; 1rev, GGCTGATCCCAGTCAGGTATC; 2fwd, CACCAGATGTGGGCTGCTCAA; and 2rev, GCAGCAGGTACGCCACAAGCC. Amplification products were separated by electrophoresis on 1% (w/v) agarose gels,
stained with ethidium bromide, and visualized under UV light. The
amplified fragments with expected size were recovered and sequenced
directly or subcloned into the pPCR-Script Amp SK(+) vector
(Stratagene) for subsequent DNA sequence analysis. DNA sequencing was
done by AGOWA GmbH (Berlin).
Assay of ALS Activity
Plants were grown in a greenhouse at 26°C, with illumination
of 250 µmol m 2s 1, and under a 16-h
photoperiod. Leaf samples were harvested from 4-week-old plants and
immediately frozen. One gram of leaf material was homogenized in 8 mL
of extraction buffer containing 100 mM potassium phosphate
buffer (pH 7.5), 0.5 mM MgCl2, 1 mM
sodium pyruvate, 0.5 mM thiamine pyrophosphate, 10 µM FAD, 10% (v/v) glycerol, and 1% (w/v)
polyvinylpolypyrrolidone (PVPP). Extracts were prepared and ALS
activity was assayed as described by Chaleff and Mauvais
(1984) . Inhibition of ALS activity was measured in the presence
of 84, 280, and 560 nM chlorsulfuron. The protein content
in the same extracts was measured by the method of Bradford (1976) .
Growth Test for Herbicide Resistance
Herbicide-resistant phenotypes were studied under greenhouse
conditions after foliar application of chlorsulfuron. Three-week-old plants were sprayed with a solution (10 mL per plant) containing 0.2%
(v/v) Tween 20, 10% (v/v) acetone, and the herbicide (84, 140, or 280 µM of chlorsulfuron). Plant fresh weight was determined 2 weeks later.
Segregation Analysis
Regenerants were self-fertilized in the greenhouse. Obtained
seeds were surface sterilized and after germination, seedlings were
transferred to Murashige and Skoog medium containing 560 nM
chlorsulfuron. Plants showing root and shoot growth were scored as resistant.
 |
ACKNOWLEDGMENTS |
We thank Anna Lytovchenko and Megan McKenzie for proofreading
and suggestions regarding the manuscript.
 |
FOOTNOTES |
Received October 29, 2002; returned for revision December 3, 2002; accepted February 12, 2003.
*
Corresponding author; e-mail
kochevenko{at}mpimp-golm.mpg.de; fax 49-331-567-8408.
Article, publication date, and citation information can be found at
www.plantphysiol.org/cgi/doi/10.1104/pp.102.016857.
 |
LITERATURE CITED |
-
Alexeev V, Igoucheva O, Domashenko A, Cotsarelis G, Yoon K
(2000)
Localized in vivo genotypic and phenotypic correction of the albino mutation in skin by RNA-DNA oligonucleotide.
Nat Biotechnol
18: 43-47[CrossRef][Web of Science][Medline]
-
Alexeev V, Yoon K
(1998)
Stable and inheritable changes in genotype and phenotype of albino melanocytes induced by an RNA-DNA oligonucleotide.
Nat Biotechnol
16: 1343-1346[CrossRef][Web of Science][Medline]
-
Alexeev V, Yoon K
(2000)
Gene correction by RNA-DNA oligonucleotides.
Pigment Cell Res
13: 72-79[CrossRef][Web of Science][Medline]
-
Bartlett RJ, Stockinger S, Denis MM, Bartlett WT, Inverardi L, Le TT, Man NT, Morris GE, Bogan DJ, Metcalf-Bogan J, et al
(2000)
In vivo targeted repair of a point mutation in the canine dystrophin gene by a chimeric RNA/DNA oligonucleotide.
Nat Biotechnol
18: 615-622[CrossRef][Web of Science][Medline]
-
Beetham PR, Kipp PB, Sawycky XL, Arntzen CJ, May GD
(1999)
A tool for functional plant genomics: chimeric RNA/DNA oligonucleotides cause in vivo gene-specific mutations.
Proc Natl Acad Sci USA
96: 8774-8778[Abstract/Free Full Text]
-
Bernasconi P, Woodworth AR, Rosen BA, Subramanian MV, Siehl DL
(1995)
A naturally-occurring point mutation confers broad range tolerance to herbicides that target acetolactate synthase.
J Biol Chem
270: 17381-17385[Abstract/Free Full Text]
-
Bradford MM
(1976)
Rapid and sensitive method for quantitation of microgram quantities of protein utilizing principle of protein dye binding.
Anal Biochem
72: 248-254[CrossRef][Web of Science][Medline]
-
Chaleff RS, Mauvais CJ
(1984)
Acetolactate synthase is the site of action of two sulfonylurea herbicides in higher plants.
Science
224: 1443-1445[Abstract/Free Full Text]
-
Chen ZY, Felsheim R, Wong P, Augustin LB, Metz R, Kren BT, Steer CJ
(2001)
Mitochondria isolated from liver contain the essential factors required for RNA/DNA oligonucleotide-targeted gene repair.
Biochem Biophys Res Commun
285: 188-194[CrossRef][Web of Science][Medline]
-
Creason GL, Chaleff RS
(1988)
A second mutation enhanced resistance of a tobacco mutant to sulfonylurea herbicides.
Theor Appl Genet
76: 177-182
-
Gamper HB, Cole-Strauss A, Metz R, Parekh H, Kumar R, Kmiec EB
(2000a)
A plausible mechanism for gene correction by chimeric oligonucleotides.
Biochemistry
39: 5808-5816[CrossRef][Medline]
-
Gamper HB, Hou YM, Kmiec EB
(2000b)
Evidence for a four-strand exchange catalyzed by the RecA protein.
Biochemistry
39: 15272-15281[CrossRef][Medline]
-
Gamper HB, Parekh H, Rice MC, Bruner M, Youkey H, Kmiec EB
(2000c)
The DNA strand of chimeric RNA/DNA oligonucleotides can direct gene repair/conversion activity in mammalian and plant cell-free extracts.
Nucleic Acids Res
28: 4332-4339[Abstract/Free Full Text]
-
Graham IR, Dickson G
(2002)
Gene repair and mutagenesis mediated by chimeric RNA-DNA oligonucleotides: chimeraplasty for gene therapy and conversion of single nucleotide polymorphisms(SNPs).
Biochim Biophys Acta
1587: 1-6[Medline]
-
Graham IR, Manzano A, Tagalakis AD, Mohri Z, Sperber G, Hill V, Beattie S, Schepelmann S, Dickson G, Owen JS
(2001)
Gene repair validation.
Nat Biotechnol
19: 507-508[CrossRef][Web of Science][Medline]
-
Hallmann A, Rappel A, Sumper M
(1997)
Gene replacement by homologous recombination in the multicellular green alga Volvox carteri.
Proc Natl Acad Sci USA
94: 7469-7474[Abstract/Free Full Text]
-
Halperin W
(1986)
Attainment and retention of morphogenetic capacity in vitro.
In
IK Vasil, ed, Cell Culture and Somatic Cell Genetics of Plants, Vol. 3. Academic Press, Inc., Orlando, FL, pp 3-37
-
Harms CT, Armour SL, Dimaio JJ, Middlesteadt LA, Murray D, Negrotto DV, Thompson-Taylor H, Weymann K, Montoya AL, Shillito RD, et al
(1992)
Herbicide resistance due to amplification of a mutant acetohydroxy acid synthase.
Mol Gen Genet
233: 427-435[Web of Science][Medline]
-
Hattori J, Brown D, Mourad G, Labbe H, Ouellet T, Sunohara G, Rutledge R, King J, Miki B
(1995)
An acetohydroxy acid synthase mutant reveals a single-site involved in multiple herbicide resistance.
Mol Gen Genet
246: 419-425[CrossRef][Web of Science][Medline]
-
Igoucheva O, Peritz AE, Levy D, Yoon K
(1999)
A sequence-specific gene correction by an RNA-DNA oligonucleotide in mammalian cells characterized by transfection and nuclear extract using a lacZ shuttle system.
Gene Ther
6: 1960-1971[CrossRef][Web of Science][Medline]
-
Igoucheva O, Yoon K
(2000)
Targeted single-base correction by RNA-DNA oligonucleotides.
Hum Gene Ther
11: 2307-2312[CrossRef][Web of Science][Medline]
-
Johansson L, Andersson B, Eriksson T
(1982)
Improvement of anther culture technique activated charcoal bound in agar medium in combination with liquid-medium and elevated CO2 concentration.
Physiol Plant
54: 24-30
-
Keeler SJ, Sanders P, Smith JK, Mazur BJ
(1993)
Regulation of tobacco acetolactate synthase gene-expression.
Plant Physiol
102: 1009-1018[Abstract]
-
Klein TM, Gradziel T, Fromm ME, Sanford JC
(1988)
Factors influencing gene delivery into Zea mays cells by high velocity microprojectiles.
Biotechnology
6: 559-563[CrossRef]
-
Kochevenko AS, Ratushnyak YI, Gleba YY
(1996)
Protoplast culture and somaclonal variability of species of series Juglandifolia.
Plant Cell Tissue Organ Cult
44: 103-110
-
Kren BT, Cole-Strauss A, Kmiec EB, Steer CJ
(1997)
Targeted nucleotide exchange in the alkaline phosphatase gene of HuH-7 cells mediated by a chimeric RNA/DNA oligonucleotide.
Hepatology
25: 1462-1468[CrossRef][Web of Science][Medline]
-
Kren BT, Parashar B, Bandyopadhyay P, Chowdhury NR, Chowdhury JR, Steer CJ
(1999)
Correction of the UDP-glucuronosyltransferase gene defect in the Gunn rat model of Crigler-Najjar syndrome type I with a chimeric oligonucleotide.
Proc Natl Acad Sci USA
96: 10349-10354[Abstract/Free Full Text]
-
Kren BT, Steer CJ
(2002)
The application of DNA repair vectors to gene therapy.
Curr Opin Biotechnol
13: 473-481[Medline]
-
Lebel E
(1994)
Gene targeting in plants. Induction of cellular recombination and transposons as targeting vector. PhD thesis. Basel University, Basel
-
Lee KY, Lund P, Lowe K, Dunsmuir P
(1990)
Homologous recombination in plant cells after Agrobacterium-mediated transformation.
Plant Cell
2: 415-425[Abstract/Free Full Text]
-
Lee KY, Townsend J, Tepperman J, Black M, Chui CF, Mazur B, Dunsmuir P, Bedbrook J
(1988)
The molecular basis of sulfonylurea herbicide resistance in tobacco.
EMBO J
7: 1241-1248[Web of Science][Medline]
-
Mengiste T, Paszkowski J
(1999)
Prospects for the precise engineering of plant genomes by homologous recombination.
Biol Chem
380: 749-758[CrossRef][Web of Science][Medline]
-
Menzel L, Wolfe K
(1984)
High frequency of fusion induced in freely suspended protoplast mixture by polyethylene-glycol and dimethylsulfoxide at high pH.
Plant Cell Rep
3: 196-198
-
Morton R, Hooykaas P-JJ
(1995)
Gene replacement.
Mol Breed
1: 123-132
-
Murashige T, Skoog F
(1962)
A revised medium for rapid growth and bio assays tobacco tissue cultures.
Physiol Plant
15: 473-497[CrossRef]
-
Nagy JI, Maliga P
(1976)
Callus induction and plant regeneration from mesophyll protoplasts of Nicotiana sylvestris.
Z Pflanzenphysiol
78: 453-455
-
Nitsch JP, Nitsch C
(1969)
Haploid plants from pollen grains.
Science
163: 85-87[Abstract/Free Full Text]
-
Paszkowski J, Baur M, Bogucki A, Potrykus I
(1988)
Gene targeting in plants.
EMBO J
7: 4021-4026[Web of Science][Medline]
-
Rice MC, May GD, Kipp PB, Parekh H, Kmiec EB
(2000)
Genetic repair of mutations in plant cell-free extracts directed by specific chimeric oligonucleotides.
Plant Physiol
123: 427-437[Abstract/Free Full Text]
-
Schaefer DG, Zryd JP
(1997)
Efficient gene targeting in the moss Physcomitrella patens.
Plant J
11: 1195-1206[CrossRef][Web of Science][Medline]
-
Sree Ramulu K
(1986)
Case histories of genetic variability in vitro: potato.
In
IK Vasil, ed, Cell Culture and Somatic Cell Genetics of Plants, Vol. 3. Academic Press, Inc., Orlando, FL, pp 449-469
-
Yoon K, Cole-Strauss A, Kmiec EB
(1996)
Targeted gene correction of episomal DNA in mammalian cells mediated by a chimeric RNA center dot DNA oligonucleotide.
Proc Natl Acad Sci USA
93: 2071-2076[Abstract/Free Full Text]
-
Zhu T, Mettenburg K, Peterson DJ, Tagliani L, Baszczynski CL
(2000)
Engineering herbicide-resistant maize using chimeric RNA/DNA oligonucleotides.
Nat Biotechnol
18: 555-558[CrossRef][Web of Science][Medline]
-
Zhu T, Peterson DJ, Tagliani L, St-Clair G, Baszczynski CL, Bowen B
(1999)
Targeted manipulation of maize genes in vivo using chimeric RNA/DNA oligonucleotides.
Proc Natl Acad Sci USA
96: 8768-8773[Abstract/Free Full Text]
© 2003 American Society of Plant Biologists
|
|