Plant Physiol.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online May 22, 2003; 10.1104/pp.103.021212

Plant Physiology 132:1107-1114 (2003)
© 2003 American Society of Plant Biologists

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
132/2/1107    most recent
pp.103.021212v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (113)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gazzani, S.
Right arrow Articles by Dean, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gazzani, S.
Right arrow Articles by Dean, C.
Agricola
Right arrow Articles by Gazzani, S.
Right arrow Articles by Dean, C.
WHOLE PLANT AND ECOPHYSIOLOGY

Analysis of the Molecular Basis of Flowering Time Variation in Arabidopsis Accessions1,[w]

Silvia Gazzani2, Anthony R. Gendall2,3, Clare Lister and Caroline Dean*

Department of Cell and Developmental Biology, John Innes Centre, Colney Lane, Norwich NR4 7UH, United Kingdom


    ABSTRACT
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Allelic variation at the FRI (FRIGIDA) and FLC (FLOWERING LOCUS C) loci are major determinants of flowering time in Arabidopsis accessions. Dominant alleles of FRI confer a vernalization requirement causing plants to overwinter vegetatively. Many early flowering accessions carry loss-of-function fri alleles containing one of two deletions. However, some accessions categorized as early flowering types do not carry these deletion alleles. We have analyzed the molecular basis of earliness in five of these accessions: Cvi, Shakhdara, Wil-2, Kondara, and Kz-9. The Cvi FRI allele carries a number of nucleotide differences, one of which causes an in-frame stop codon in the first exon. The other four accessions contain nucleotide differences that only result in amino acid substitutions. Preliminary genetic analysis was consistent with Cvi carrying a nonfunctional FRI allele; Wil-2 carrying either a defective FRI or a dominant suppressor of FRI function; and Shakhdara, Kondara, and Kz-9 carrying a functional FRI allele with earliness being caused by allelic variation at other loci including FLC. Allelic variation at FLC was also investigated in a range of accessions. A novel nonautonomous Mutator-like transposon was found in the weak FLC allele in Landsberg erecta, positioned in the first intron, a region required for normal FLC regulation. This transposon was not present in FLC alleles of most other accessions including Shakhdara, Kondara, or Kz-9. Thus, variation in Arabidopsis flowering time has arisen through the generation of nonfunctional or weak FRI and FLC alleles.


The timing of the floral transition has significant consequences for the reproductive success of plants. Plants need to gauge when both environmental and endogenous cues are optimal before undergoing the switch to reproductive development. To achieve this, a complex regulatory network has evolved consisting of multiple pathways that quantitatively regulate a set of genes (the floral pathway integrators) whose activity causes the transition of the meristem to reproductive development (Simpson and Dean, 2002Go). As plant varieties spread, there is strong selective pressure for changes in flowering time that confer an advantage in that new environment. Arabidopsis accessions show a range of flowering strategies: Some complete their life cycle very rapidly, whereas others adopt a winter annual habit, overwintering vegetatively and flowering in the favorable conditions of spring. The genetic basis of this has been analyzed in a number of studies (Clarke et al., 1995Go; Jansen et al., 1995Go; Mitchell-Olds, 1996Go; Alonso-Blanco et al., 1998Go). Allelic variation at FRI (FRIGIDA) was found to be a major determinant of vernalization requirement and flowering time variation (Napp-Zinn, 1985Go; Burn et al., 1993Go; Lee et al., 1993Go; Clarke and Dean, 1994Go). FRI functions to increase RNA levels of the floral repressor FLC (FLOWERING LOCUS C), which represses the expression of genes required for the transition to flowering (Michaels and Amasino, 1999Go; Sheldon et al., 1999Go). FLC RNA levels are reduced during a long period of cold temperature, namely winter, in a process called vernalization. The antagonistic activities of FRI and vernalization on FLC expression thus result in the winter annual habit. Analysis of the allelic variation at FRI showed that the majority of rapid-cycling accessions carry FRI alleles with one of two deletions, both predicted to cause loss-of-function (Johanson et al., 2000Go), indicating that rapid-cycling accessions have evolved independently, at least twice, from winter annual progenitors. Some of these alleles may have evolved more recently than others (Hagenblad and Nordborg, 2002Go). Extensive variation at FRI was also observed in a study of 25 accessions from western Europe, which revealed six novel loss-of function FRI alleles and a high degree of polymorphism within exon 1 (Le Corre et al., 2002Go). These data reinforce the view that FRI is under strong selective pressure and is a major target for natural selection of flowering time in Arabidopsis.

We have continued to analyze the molecular variation at FRI and have focused on the five early flowering accessions: Cvi (from Cape Verde Island), Shakhdara and Kondara (from Tadjikistan), Kz-9 (from Kazakstan), and Wil-2 (from Russia). These have been categorized as early flowering accessions that do not contain either of the FRI deletion alleles present in Landsberg erecta (Ler) or Columbia (Col; Johanson et al., 2000Go). Previously, we had shown that the earliness of Shakhdara was probably due to allelic differences at FLC (Johanson et al., 2000Go). Therefore, we have analyzed allelic variation at FLC in a number of accessions including the previously characterized weak allele present in Ler. We have detected several single-nucleotide polymorphisms plus a 30-bp insertion and a nonautonomous Mutator-like transposable element (TE) both within the first intron of FLC, a region shown to be important for FLC up-regulation (Sheldon et al., 2002Go). The distribution of these insertions and their correlation with FLC activity has been analyzed in a range of accessions.


    RESULTS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Sequence Analysis of FRI in Early Flowering Accessions

We sequenced approximately 3.6 kb of the genomic region covering FRI in five accessions: Cvi, Wil-2, Shakhdara, Kz-9, and Kondara. These had been characterized as early flowering accessions, flowering at <75 d or <10 leaves (Karlsson et al., 1993Go; Nordborg and Bergelson, 1999Go) but did not contain either the Ler- or Col-type deletion alleles (Johanson et al., 2000Go). The sequenced region contained 573 bp upstream of the ATG putative translation start codon and 870 bp downstream of the putative translation stop codon. The sequences were compared with the same region from the active H51 FRI allele (GenBank accession no. AF228499). Within the FRI coding sequence, Cvi (GenBank accession no. AY198404) showed five nucleotide differences in comparison with H51, four in the first and one in the third exon (Fig. 1). Four resulted in amino acid differences, Pro-12 to Thr, Arg-74 to Cys, Asp-167 to Glu, and Lys-377 to Gln, whereas one, in the second half of the first exon, changed amino acid residue Lys-232 to an in-frame translation stop codon (TAA). This would cause premature termination approximately halfway through the protein. The other differences included three nucleotide changes, a three-nucleotide indel 5' to the coding region and one polymorphism in intron 1. No differences were found in intron 2 or in the 3'-flanking sequence (Fig. 1).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 1. Nucleotide and amino acid changes in the FRI gene of the five accessions Cvi, Wil-2, Shakhdara, Kondara, and Kz-9 relative to the active FRI allele from H51 (accession no. AF228499). Sequences containing a stop codon are underlined. a.a., Amino acid; Nucl., nucleotide; nd, not determined. The asterisk indicates an insertion. *a, *b, and *c are the first, second, and third nucleotide insertions after nucleotide 459 from H51. These changes have been used to infer the evolutionary relationship between the different FRI alleles, and this is represented schematically. The Wil-2 allele is represented as arising from a recombination event between a Cvi-like and a Shakhdara/Kondara/Kz-9-like allele.

 

The FRI alleles from Shakhdara (GenBank accession no. AY198401), Kz-9 (AY198402), and Kondara (AY198403) were found to encode identical proteins that differed by only one amino acid (amino acid residue Phe-55 to Ile) from the H51 FRI allele. This may be a functionally silent substitution because Phe and Ile are both hydrophobic amino acids. Again, in comparison with H51, several polymorphisms were found 5' to the coding region, one in intron 1 but none in intron 2 or 3' to the gene.

Two differences were detected between the predicted FRI proteins of H51 and Wil-2 (GenBank accession no. AY198405; Fig. 1). These resulted in changes in amino acids Arg-74 to Cys and Asp-167 to Glu in the first exon. The same amino acid differences were also present in the Cvi allele. Depending on whether the Wil-2 FRI allele is active or inactive affects the interpretation of the loss-of-function Lys-232 to stop codon mutation in the Cvi allele. If Wil-2 FRI is functional, then the in-frame stop codon could be the primary cause of FRI loss-of-function in the Cvi accession. Alternatively, if the Wil-2 allele is inactive, the stop codon could have arisen as a secondary mutation due to loss of selection on a nonfunctional coding sequence. The 5'-flanking region of the Wil-2 FRI allele showed greater similarity to that of Shakhdara, Kz-9, and Kondara; therefore, the Wil-2 allele may have resulted from a recombination event within the FRI gene (Fig. 1).


Genetic Analysis to Test FRI Function in the Early Flowering Accessions

To begin to assess whether FRI was functional in Cvi, Shakhdara, Kz-9, Kondara, and Wil-2, the flowering time of F1 seedlings from crosses of the accessions to different backgrounds was determined. This provides a preliminary indication of the activity of the different alleles; however, a definitive conclusion on allele functionality requires more extensive genetic analysis or transformation of the different alleles into a common genetic background. The five accessions were crossed to Col, which carries a nonfunctional FRI and a strong FLC allele (Koornneef et al., 1994Go) and in some cases to FRI (Sf-2)flc-3 (Michaels and Amasino, 1999Go), which carries an active FRI but a nonfunctional FLC. The former is most informative for analyzing whether the new accession carries an active FRI allele, whereas the latter gives information on the strength of the FLC allele. The F1 plants from the cross between Cvi and Col were early flowering (Table I), supporting a model where Cvi carries an inactive FRI allele, consistent with the presence of the in-frame translation stop codon. The F1 plants from the cross between Shakhdara and Col were late flowering (Table I), most likely due to combining an active FRI and a strong FLC allele in the F1 seedlings, thus suggesting that Shakhdara carries a functional FRI allele. The major quantitative trait locus (QTL) for lateness mapping near FRI in the Shakhdara x Bay-0 recombinant inbred population, therefore, is likely to represent activity from an active Shakhdara FRI (Loudet et al., 2002Go). Preliminary analysis of F2 populations from a Shakhdara x Col cross had suggested the earliness of Shakhdara was due to a weak (and recessive) FLC allele (Johanson et al., 2000Go), and this is supported by the early flowering of F1 plants derived from the Shakhdara x FRI(Sf-2) flc-3 cross (Table I).


View this table:
[in this window]
[in a new window]
 
Table I. Flowering time analysis

The flowering time of the indicated genotypes or their F1 progeny of a cross to Columbia or FRI(Sf-2)flc-3 (in the Columbia background) was determined by counting total leaf no. Plants were grown in long-day (16 h of light and 8 h of dark) conditions (see "Materials and Methods").

 

Kondara and Kz-9 were not as early flowering in our conditions as had been reported previously (Karlsson et al., 1993Go; Nordborg and Bergelson, 1999Go), but the F1 plants from the crosses to Col flowered even later, suggesting that Kondara and Kz-9 FRI alleles are fully functional and confer very late flowering in the presence of the strong Col FLC allele. Given the identical amino acid sequence, it is likely that the three accessions Shakhdara, Kondara, and Kz-9 carry the same functional FRI allele. The F1 plants from the cross of Kz-9 to FRI(Sf2)flc-3 flowered early, supporting the view that, like Shakhdara, Kz-9 earliness is due to a weak FLC allele. The Kondara FRI(Sf2)flc-3 F1 seedlings were not as early, suggesting that variation at both FLC and other loci account for the intermediate flowering time of Kondara. A QTL analysis on F2 seedlings, F3 families, or recombinant inbred populations derived from these crosses will be necessary to determine the contribution of the different loci to the flowering time variation.

F1 plants originating from the cross between Wil-2 and Col flowered early (Table I), suggesting that Wil-2 carries either a nonfunctional FRI allele or a dominant suppressor of FRI function. Late-flowering individuals (>50 leaves) were not found in the F2 progeny from this cross (C. Shindo and C. Dean, unpublished data). Because FRI can be introduced into Col and confer late flowering (Johanson et al., 2000Go), Col cannot carry a dominant suppressor of FRI function; therefore, these results point to Wil-2 carrying a nonfunctional FRI allele or a dominant suppressor being very closely linked to FRI. No obvious loss-of-function mutation was present in the Wil-2 allele, and the two amino acid polymorphisms between Wil-2 and H51, Arg-74 to Cys and Asp-167 to Glu, have both been found in FRI alleles from late- or very late-flowering accessions, ALL2 and CUR (Le Corre et al., 2002Go). Further analysis is clearly necessary to determine whether the Arg-74 to Cys and Asp-167 to Glu polymorphisms affect the function of the FRI protein and, if not, why Wil-2 is early flowering.


Analysis of FRI/FLC RNA Levels

To complement the genetic analysis, we also determined the expression levels of FRI and FLC. RNA levels and flowering time were compared in the five accessions and the early flowering Ler and Col genotypes. A fast neutron-induced early flowering fri mutant line (FN13; Michaels and Amasino, 2001Go) and a late-flowering line carrying a cosmid clone containing the active FRI allele from the H51 genotype (84M13; Johanson et al., 2000Go) were also included in the comparison (Fig. 2, A and B). FRI is expressed in Cvi, Shakhdara, Kz-9, Kondara, and Wil-2 (Fig. 2B) at a level similar to Col, which is higher than Ler but lower than lines carrying the H51 FRI allele. There does not appear to be a clear correlation between FRI RNA levels and flowering time in the five accessions (Fig. 2B). FLC RNA levels in general correlate with flowering time, with the notable exception of Cvi. The very early flowering accessions Shakhdara and Wil-2 have low FLC RNA levels and the later flowering accessions Kz-9 and Kondara have higher levels, approaching those in lines carrying the active H51 FRI allele. The exception is Cvi, which has relatively high FLC RNA levels but flowers very early. If Cvi carries a nonfunctional FRI allele as suggested by the sequence and genetic analyses, then these results suggest that additional loci other than FRI are important in the up-regulation of FLC in the Cvi accession. These may include ART1 (Grbic and Bleecker, 1996Go), VIP4 (Zhang and Van Nocker, 2002Go), HOS1 (Lee et al., 2001Go), or the FLG QTL, mapped in the Cvi x Ler recombinant inbred population, which shows a synergistic interaction with a QTL most likely to be FLC (Alonso-Blanco et al., 1998Go).



View larger version (32K):
[in this window]
[in a new window]
 
Figure 2. A, Flowering time analysis of the five accessions Cvi, Wil-2, Shakhdara, Kondara, and Kz-9 assayed as total leaf number at flowering. B, Northern analysis of FRI and FLC in the five accessions Cvi, Wil-2, Shakhdara, Kondara, and Kz-9.

 


Analysis of Allelic Variation at FLC

Allelic variation at FLC does appear to contribute to the flowering time variation in Shakhdara, Kz-9, and Kondara. To date, the most well-characterized FLC alleles are from the Ler and Col accessions (Koornneef et al., 1994Go; Lee et al., 1994Go; Sanda and Amasino, 1996Go). The Ler FLC allele has been described as a weak allele as when combined with active FRI alleles lines are significantly earlier than those carrying Col FLC alleles (Koornneef et al., 1994Go; Lee et al., 1994Go). In the presence of active alleles of FRI or loss-of-function mutations of the autonomous pathway FLC RNA levels from the Ler alleles are much lower than FLC levels from a Col allele (Schlappi, 2001Go). C24 and Niederzenz accessions are also considered to carry genetically weak FLC alleles (Sanda and Amasino, 1995Go; Schlappi, 2001Go). However, genomic blot and sequence analysis of the FLC cDNA encoded by the Ler, Col, C24, and Nd accessions revealed no polymorphism (Sheldon et al., 2000Go; Schlappi, 2001Go). We examined FLC promoter and intron sequences from the Col (strong FLC allele) and C24 (weak FLC allele) accessions from position -109 (relative to ATG as +1) and all of intron 1 (accession nos. AL356332 and AF116528, respectively). Single-nucleotide differences were found (positions +217, +515, +1,281, and +2,229), and a 30-bp repeat was present in the first intron of Col but not C24 (Fig. 3, A and B). This repeat does not occur elsewhere in the genome, and it is present in a region required for the maintenance of FLC expression after vernalization and for the repression of FLC by FCA (Sheldon et al., 2002Go). We designed a PCR-based marker for this polymorphism and surveyed a total of 23 accessions. This repeat was detected in accessions with strong FLC alleles including Col, Li-5, H51 (derived from a Stockholm/Li-5 cross; Napp-Zinn, 1957Go) and S96 (derived from a Dijon/Li-5 cross; van der Veen, 1965Go), and also in accessions with weak FLC alleles (Niederzenz; Table II; Schlappi, 2001Go). Therefore, it would not appear to interfere with FLC function.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 3. Transposon Insertion in FLC. A, Untranslated (gray boxes) and coding regions (white boxes) and start and stop codons (ATG and TAG, respectively) of FLC are indicated. The position of the 30-bp repeat is indicated by black arrows, and the insertion site of the transposon in Ler, DiG, and Di2 is indicated by a triangle. Single-nucleotide substitutions are shown by asterisks. Numbering is based on the A of the ATG start codon as +1. B, Sequence of the 30-bp sequence repeated n times, where n = 1 or 2. C, Sequence flanking the insertion site in Ler is shown in plain text, the 9-bp target site duplication (TSD) is underlined, and the transposon sequence is indicated in bold. The Col sequence shown corresponds to bacterial artificial chromosome T31P16 (accession no. AL356332), positions 40,620 to 40,591. D, Inverted repeat of the TE showing the first and last 50 bp of the transposon in Ler, with complementary residues indicated by vertical lines.

 

View this table:
[in this window]
[in a new window]
 
Table II. Molecular variation in FLC

The presence (+) or absence (-) of the transposon insertion and 30-bp repeat in FLC was detected by PCR- and cleaved-amplified polymorphic sequence-based markers respectively. nd, Not determined. Flowering time categories were as in Karlsson et al. (1993Go) and Nordborg and Bergelson (1999Go), but the early flowering category was extended to cover early and intermediate flowering times due to our observations that Kondara and Kz-9 flowered significantly later than Shakhdara, Wil-2, and Cvi.

 

PCR-based analysis of the Ler allele of FLC revealed no major structural changes, apart from one large insertion within intron 1 (Fig. 3, A and C). The sequence of this 1,233-bp insertion was very homologous to three regions of the Col genome cloned in bacterial artificial chromosomes T32N4, MBK23, and F24H14, exhibiting 97%, 94%, and 92% identity over 1,195, 1,242, and 1,187 nucleotides, respectively. It was somewhat less homologous to approximately 17 other regions of the Col genome. It had several characteristics suggesting it was a TE. First, the sequence was delimited by a 9-bp direct repeat, resembling a TSD that occurs upon integration of TEs. The putative TSD sequence 5'-TTATTAAAT is present as a single copy in Col FLC (Fig. 3C). Analysis of the homologous sequences revealed that many of them were also flanked by a 9-bp TSD. These TSDs revealed a strong A/T-bias, with only 9% of the nucleotides being G or C, a characteristic feature of Mutator-like elements (Yu et al., 2000Go; for full details, see Supplementary Table I at http://www.plantphysiol.org). Second, the ends of the insertion form an inverted repeat with 32 matches in the first 50 bp (Fig. 3D) and 67 matches over a 120-bp region. Third, the elements share conserved terminal regions: 50% identity over 100 bp at the 5' end and 22.5% identity over 111 bp at the 3' end and an additional region of homology (88%–100% identity) between nucleotides 590 and 960.

To assess the prevalence of this putative Mutator-like element in different FLC alleles, a PCR marker was designed and 27 Arabidopsis accessions analyzed (Table II). The transposon insertion was detected in Dijon-G and Di-2 accessions but not in the closely related Landsberg-0 or Di-1 accessions. The close relationship of Dijon-G and Ler has been described previously (Koornneef et al., 1994Go). Analysis of nine additional polymorphic markers failed to identify any differences between Ler and Di-G (data not shown), implying that they may be the same, or a very closely related, genotype. A number of early flowering accessions, including Shakhdara, do not contain the transposon insertion in the FLC locus. If the transposon is the cause of the reduced upregulation of the Ler FLC allele, then other mechanisms have led to the weak FLC alleles in other Arabidopsis accessions.


    DISCUSSION
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
The molecular analysis of natural variation of Arabidopsis flowering time focused initially on FRI because allelic variation at this locus had been shown to be a major genetic determinant of phenotypic variability (Napp-Zinn, 1985Go; Burn et al., 1993Go; Lee et al., 1993Go; Clarke and Dean, 1994Go). Independent fri loss-of-function mutations could account for the earliness of 13 of the 18 rapid-cycling accessions analyzed, suggesting that rapid-cycling accessions had evolved multiple times from winter annual progenitors (Johanson et al., 2000Go). In this study, we focused on the molecular basis of flowering time variation in the five accessions where the two fri deletion alleles did not account for the early flowering behavior. One of these accessions, Cvi, carries an FRI allele with an in-frame translation stop codon within exon 1. F1 analysis suggested the allele was nonfunctional, and this is consistent with the lack of a QTL near FRI in the Cvi x Ler recombinant inbred analysis (Alonso-Blanco et al., 1998Go). The other accessions show amino acid differences relative to the active H51 FRI allele, with three of them, Shakhdara, Kz-9, and Kondara encoding identical, apparently functional, FRI proteins. Further analysis is required to establish whether Wil-2 carries an active FRI allele and the functional effects of the Arg-74 to Cys and Asp-167 to Glu substitutions.

The polymorphisms found in the FRI alleles described in this study are predominantly in the large first exon of FRI. Hypervariability of exon 1 was also found by Le Corre et al. (2002Go), who argued that the observed excess of non-synonymous polymorphisms and reduced synonymous variation meant that this region of the protein was under strong selection presumably to generate adaptively significant flowering time variation. The first exon contains the first of the two coiled-coil domains, thought to play a role in protein-protein or protein-nucleic acid interactions (Johanson et al., 2000Go). However, protein partners of FRI remain to be identified; therefore, interpretation of the consequences of this molecular variability awaits an improved understanding of FRI function. The lack of polymorphism in intron 2 and the 3' region of the gene is striking and may point to purifying selection acting on these regions of the gene. Whether these non-coding sequences have any regulatory function remains to be established.

In addition to continuing with the analysis of molecular variation at FRI, we also initiated the analysis of molecular variation at FLC. Genetic analysis has suggested that variation at FLC also contributes to natural variation in flowering time (Koornneef et al., 1994Go; Sanda and Amasino, 1996Go; Johanson et al., 2000Go), and our results further support this notion. Comparison of the two sequenced FLC alleles revealed a 30-bp insertion sequence near the beginning of intron 1, but the presence of this did not appear to be correlated with flowering time. Sequence analysis of the genomic region of FLC from Ler, however, revealed the insertion of a non-TIR Mutator-like TE near the 3' end of intron 1, with the only other changes detected being single-nucleotide changes. The possibility that the transposon is causing the weak FLC allele in Ler is consistent with the observation that the FLC cDNAs from Ler and Col encode identical proteins. Therefore, the weakness of the allele is not due to a polymorphism changing the protein sequence and affecting the function of the protein. How could a transposon positioned within an intron affect a reduced level of RNA in the Ler genotype compared with Col and a reduced degree of up-regulation by FRI? The insertion of transposons within genes can perturb normal gene expression in a number of different ways, particularly by disrupting or reducing the efficiency of normal splicing events or by affecting transcription (for review, see Weil and Wessler, 1990Go). Thus, the transposon could affect the processing or stability of the primary FLC transcript, although there is no evidence of major differences in the pattern of FLC transcripts produced by Ler and other accessions. The transposon insertion in Ler may lead to reduced transcription of FLC, particularly if the insertion interrupts sequences within intron 1 that may normally be involved in the FRI-mediated up-regulation. Recent analysis of the cis-elements required for FLC regulation has shown that the 3' region of intron 1(position +3,175 to +3,703), which includes the transposon insertion site in Ler, is required for both the FRI-regulated expression of FLC and the repression by vernalization (Sheldon et al., 2002Go). Alternatively, Mutator-like transposons are normally transcriptionally silenced in Arabidopsis through epigenetic modifications (Singer et al., 2001Go), and these could influence the transcription of the adjacent FLC. It will be important to definitively establish that the transposon is the cause of the weak allele through analysis of chimeric FLC alleles where the transposon is inserted into a Col FLC allele at the same location as it is found in Ler. We can then pursue the mechanism of how the transposon affects FLC regulation.

QTL analysis of Cvi x Ler recombinant inbred lines had shown that four QTLs (EDI, FLF, FLG, and FLH), accounted for the majority of the variation observed (Alonso-Blanco et al., 1998Go). The FLF QTL was considered likely to correspond to FLC, and a synergistic interaction of FLF and FLG suggested that FLG functions in a similar way to active FRI alleles (Alonso-Blanco et al., 1998Go). The Cvi FLG allele may explain why FLC is expressed at relatively high levels in this accession. The high FLC levels but early flowering makes Cvi an exception to the general correlation between FLC levels and flowering time in Arabidopsis genotypes (Michaels and Amasino, 1999Go; Sheldon et al., 1999Go, 2000Go). The Cvi EDI QTL may account for this earliness because it was found to encode a novel allele of CRYPTOCHROME2 CRY2 (El-Assal et al., 2001Go). CRY2 is a blue-light photoreceptor that in most accessions promotes flowering in Arabidopsis in long-day photoperiods (El-Assal et al., 2001Go). In Cvi, the CRY2 allele confers early flowering in short-day photoperiods, and this enhanced CRY2 activity could function to activate downstream floral pathway integrators, therefore bypassing the repression conferred by high FLC levels (Simpson and Dean, 2002Go).

A number of molecular mechanisms have provided the basis for the evolution of flowering time variation found in Arabidopsis accessions; however, the predominant variation appears to be through changes at FRI. Further understanding of the molecular control of flowering time and fitness analysis of different genotypes will be required before we can address the question of why so much of the variation in flowering is caused by mutation at FRI rather than at other loci. In laboratory mutagenesis experiments, mutations in a large number of loci gave rise to early flowering genotypes. Why has variation at these other loci not been selected for in nature? The timing of the floral transition is probably one of the most important variables in the adaptation of Arabidopsis accessions to new locations. Study of the molecular changes underlying that variation, therefore, is an excellent way to study the molecular basis of adaptation. New Arabidopsis accessions have been or are now being collected with an evolutionary analysis in mind, and these should enable identification of the selective forces driving changes in flowering time.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Plant Lines

The Arabidopsis accessions (and their Nottingham Arabidopsis Stock Centre nos.) used in this study were Cvi (N1096), Wil-2 (N1596), Shakhdara (N929), Kz-9 (N22441; different batches of this seed have been found to vary in their flowering time), Kondara (N916), Ler (NW20), Dijon-G (N910), Ws (N1602), H55 (N923), St (N1534), Rsch-4 (N1494), Gr (N1198), Tsu-0 (N1564), C24 (N906), Öst (N1430), Col (N933), Li-5 (N1320), Nd (N1390), S96 (N914), H51 (no stock center no.), Est-0 (N1148), Di-1 (N1108), Te (N1550), Can (N1064), EDI (N1122), and Dijon-2 (N1110).

Crosses of Col to the five accessions Cvi, Wil-2, Shakhdara, Kondara, and Kz-9 were performed. Plants were grown at 20°C with 16 h of light (12 h of fluorescent plus incandescent light at approximately 100 µmol photons m-2 s-1, plus 4 h of incandescents only). Crosses of the FRI(Sf-2)flc-3 line to Shakhdara, Kondara Ler, La0, and Dijon were carried out in a separate experiment. The F1 progeny of the crosses and the control plants were grown at 20°C, with a 16-h light photoperiod (fluorescent lights at approximately 100 µmol photons m-2 s-1). The flowering time was measured by considering total leaf number, which was scored as the number of rosette leaves plus the number of cauline leaves.


DNA Extraction

Genomic DNA for sequence analysis of the FRI allele in the five accessions Cvi, Wil-2, Shakhdara, Kz-9, and Kondara was isolated from young leaves and flowers using a cetyl-trimethyl-ammonium bromide method (Lister et al., 2000Go). DNA for analysis of the transposon was isolated as described (Dellaporta et al., 1983Go).


Sequence Analysis of FRI Alleles

Overlapping fragments covering the full FRI coding sequence, part of the 5' FRI-flanking region (573 bp), and part of the 3' FRI-flanking region (876 bp in Cvi and Shakhdara and 475 bp in Wil-2, Kz-9, and Kondara) were amplified from genomic DNA preparations from the accessions Cvi, Wil-2, Shakhdara, Kz-9, and Kondara. PCR products were purified using the QIAquick Gel Extraction kit (Qiagen USA, Valencia, CA) and used as templates for sequence analysis (for full details, see Supplementary Table II at www.plantphysiol.org). Comparison of at least two independent products of amplification was carried out for each FRI fragment. Cycle sequencing reactions were performed using the ABI Prism BigDye Terminator kit (Perkin-Elmer Applied Biosystems, Foster City, CA). Sequences analysis and alignment were performed using the Staden Xgap program (Staden et al., 1998Go).


RNA Extraction Analysis

Total RNA was extracted from 12 seedlings from each of the five accessions Cvi, Wil-2, Shakhdara, Kondara, and Kz-9 after being grown for 14 d in growth room at 20°C with a 16-h-light/8-h-dark cycle under fluorescent lights at approximately 100 µmol photons m-2 s-1. RNA extraction was performed using the TRIzol Reagent (Life Technologies/Gibco-BRL, Cleveland) according to manufacturer's instructions. Total RNA (approximately 10 µg) was fractionated on 1.2% (w/v) formaldehyde-agarose gel and blotted onto Hybond N+ nylon filters. The RNA gel blot was probed with the full 32P-ATP-labeled FRI cDNA. After stripping in boiling 0.5% (w/v) SDS, the same blot was rehybridized with an FLC probe, a 403-bp PCR-amplified cDNA fragment lacking MADS domain sequences (corresponding to nucleotides 298–700 of the FLC cDNA; Sheldon et al., 1999Go). Loading was normalized by stripping in boiling 0.5% (w/v) SDS and hybridization with a {beta}-TUBULIN coding region probe (Snustad et al., 1992Go). Blots were exposed to PhosphorImager screens (Molecular Dynamics, Sunnyvale, CA).


Genotyping FLC Alleles

Crosses of FRI(Sf-2)flc-3 to the various accessions were analyzed by isolating DNA from individual F1 plants and PCR amplification with primers 5'GCAATAGTTCAATCCGTATCG and 5'TTGTAGCTCGTGCGTAGTCTAGCATAG, which amplifies a 917-bp fragment in FLC and 813 bp in flc-3 because flc-3 has a 104-bp deletion (Michaels and Amasino, 1999Go). In all cases, two bands of the anticipated sizes were detected, indicating a true cross (corresponding to a heterozygote with a genotype of FLC flc-3). To detect the transposon in FLC, DNA was PCR amplified with primers 5'AAACAATCTGGACAGTAGAGGCTTAT and 5'CAGGCTGGAGAGATGACAAAA, which amplifies a 527-bp fragment in the absence of the insertion and a 1,741-bp fragment if the insertion is present. The 30-bp intron 1 repeat was detected by PCR amplification using primers 5'AAATGTAAGCCACATTAATTGGGAAA and 5'ATTAAATCATAATTAAGACCAGGAG, and digestion with TaqI restriction enzyme, which produces bands of 342, 287, and 42 bp in accessions with a single repeat, and 372, 287, and 42 bp in accessions with two repeats.


Sequencing and Analysis of Mutator-Like Transposon

The 1,741-kb region containing the transposon was amplified from Ler and Dijon-G using the primers above. PCR products from multiple independent reactions were sequenced directly using primers used for amplification and 5'CATTGGATAACTAATCTTTGAGC, 5'TGTGAGCTTTATTTAGGTTCTAAG, 5'CACTAATCAAATCACTTAACATCC, and 5'TTTTTGTTTATCTAACATGTTTG. Sequences were complied using the Seq-Man program within the LASERGENE software (DNASTAR, Inc., Madison, WI) and analyzed by BLAST searches of GenBank at the National Center for Biotechnology Information (Altschul et al., 1997Go). Regions showing high similarity were further analyzed for the presence of the conserved ends and the presence of TSDs.


    ACKNOWLEDGMENTS
 
We thank Rick Amasino for supplying the FRI(Sf2)flc-3 line, Thomas Bureau for discussions on transposons, and Mervyn Smith for looking after the Arabidopsis plants.

Received February 4, 2003; returned for revision February 24, 2003; accepted March 28, 2003.


    FOOTNOTES
 
Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.103.021212.

1 This work was supported by the Biotechnology and Biological Sciences Research Council (Core Grant to the John Innes Centre and studentship grant to S.G.). Back

[w] The online version of this article contains Web-only data. The supplemental material is available at http://www.plantphysiol.org. Back

2 These authors contributed equally to the paper. Back

3 Present address: Department of Botany, La Trobe University, Victoria 3086, Australia. Back

* Corresponding author; e-mail caroline.dean{at}bbsrc.ac.uk; fax 44–1603–450025.


    LITERATURE CITED
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Alonso-Blanco C, El-Assal SE-D, Coupland G, Koornneef M (1998) Analysis of natural allelic variation at flowering time loci in the Landsberg erecta and Cape Verde Islands ecotypes of Arabidopsis thaliana. Genetics 149: 749-764[Abstract/Free Full Text]

Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25: 3389-3402[Abstract/Free Full Text]

Burn JE, Smyth DR, Peacock WJ, Dennis ES (1993) Genes conferring late flowering in Arabidopsis thaliana. Genetica 90: 147-155[CrossRef]

Clarke JH, Dean C (1994) Mapping FRI, a locus controlling flowering time and vernalization response in Arabidopsis thaliana. Mol Gen Genet 242: 81-89[CrossRef][Web of Science][Medline]

Clarke JH, Mithen R, Brown JK, Dean C (1995) QTL analysis of flowering time in Arabidopsis thaliana. Mol Gen Genet 248: 278-286[CrossRef][Web of Science][Medline]

Dellaporta S, Wood J, Hicks J (1983) A plant DNA minipreparation: version II. Plant Mol Biol Rep 1: 19-21

El-Assal SE-D, Alonso-Blanco C, Peeters AJ, Raz V, Koornneef M (2001) A QTL for flowering time in Arabidopsis reveals a novel allele of CRY2. Nat Genet 29: 435-440[CrossRef][Web of Science][Medline]

Grbic V, Bleecker AB (1996) An altered body plan is conferred on Arabidopsis plants carrying dominant alleles of two genes. Development 122: 2395-2403[Abstract]

Hagenblad J, Nordborg M (2002) Sequence variation and haplotype structure surrounding the flowering time locus FRI in Arabidopsis thaliana. Genetics 161: 289-298[Abstract/Free Full Text]

Jansen RC, van Ooijen JW, Stam P, Lister C, Dean C (1995) Genotype-by-environment interaction in genetic mapping of multiple quantitative trait loci. Theor Appl Genet 91: 33-37[Web of Science]

Johanson U, West J, Lister C, Michaels S, Amasino R, Dean C (2000) Molecular analysis of FRIGIDA, a major determinant of natural variation in Arabidopsis flowering time. Science 290: 344-347[Abstract/Free Full Text]

Karlsson BH, Sills GR, Nienhuis J (1993) Effects of photoperiod and vernalization on the number of leaves at flowering in 32 Arabidopsis thaliana (Brassicaceae) ecotypes. Am J Bot 80: 646-648[CrossRef][Web of Science]

Koornneef M, Blankestijn-de Vries H, Hanhart C, Soppe W, Peeters T (1994) The phenotype of the some late-flowering mutants is enhanced by a locus on chromosome 5 that is not effective in the Landsberg erecta wild-type. Plant J 6: 911-919[CrossRef][Web of Science]

Le Corre V, Roux F, Reboud X (2002) DNA polymorphism at the FRIGIDA gene in Arabidopsis thaliana: extensive nonsynonymous variation is consistent with local selection for flowering time. Mol Biol Evol 19: 1261-1271[Abstract/Free Full Text]

Lee H, Xiong L, Gong Z, Ishitani M, Stevenson B, Zhu JK (2001) The Arabidopsis HOS1 gene negatively regulates cold signal transduction and encodes a RING finger protein that displays cold-regulated nucleocytoplasmic partitioning. Genes Dev 15: 912-924[Abstract/Free Full Text]

Lee I, Bleecker A, Amasino R (1993) Analysis of naturally occurring late flowering in Arabidopsis thaliana. Mol Gen Genet 237: 171-176[CrossRef][Web of Science][Medline]

Lee I, Michaels SD, Masshardt AS, Amasino RM (1994) The late-flowering phenotype of FRIGIDA and mutations in LUMINIDEPENDENS is suppressed in the Landsberg erecta strain of Arabidopsis. Plant J 6: 903-909[CrossRef][Web of Science]

Lister C, Anderson M, Dean C (2000) Genetic mapping using recombinant inbred lines. In Z Wilson, ed, Arabidopsis: a Practical Approach. Oxford University Press, Oxford, pp 51-75

Loudet O, Chaillou S, Camilleri C, Bouchez D, Daniel-Vedele F (2002) Bay-0 x Shahdara recombinant inbred line population: a powerful tool for the genetic dissection of complex traits in Arabidopsis. Theor Appl Genet 104: 1173-1184[CrossRef][Web of Science][Medline]

Michaels SD, Amasino RM (1999) FLOWERING LOCUS C encodes a novel MADS domain protein that acts as a repressor of flowering. Plant Cell 11: 949-956[Abstract/Free Full Text]

Michaels SD, Amasino RM (2001) Loss of FLOWERING LOCUS C activity eliminates the late-flowering phenotype of FRIGIDA and autonomous pathway mutations but not responsiveness to vernalization. Plant Cell 13: 935-941[Abstract/Free Full Text]

Mitchell-Olds T (1996) Genetic constraints on life-history evolution: quantitative-trait loci influencing growth and flowering in Arabidopsis thaliana. Evolution 50: 140-145[CrossRef][Web of Science]

Napp-Zinn K (1957) Untersuchungen zur genetik des kältebedürfnisses bei Arabidopsis thaliana L. Heynh. Z Indukt Abstamm Vererbungsl 88: 253-285

Napp-Zinn K (1985) Arabidopsis thaliana. In AH Halevy, ed, Handbook of Flowering, Vol 1. CRC Press, Boca Raton, FL, pp 492-503

Nordborg M, Bergelson J (1999) The effect of seed and rosette cold treatment on germination and flowering time in some Arabidopsis thaliana (Brassicaceae) ecotypes. Am J Bot 86: 470-475[Abstract/Free Full Text]

Sanda SL, Amasino RM (1995) Genetic and physiological analysis of flowering time in the C24 line of Arabidopsis thaliana. Weeds World 2: 2-8

Sanda SL, Amasino RM (1996) Ecotype-specific expression of a flowering mutant phenotype in Arabidopsis thaliana. Plant Physiol 111: 641-644[Abstract]

Schlappi M (2001) RNA levels and activity of FLOWERING LOCUS C are modified in mixed genetic backgrounds of Arabidopsis thaliana. Int J Plant Sci 162: 527-537[CrossRef]

Sheldon CC, Burn JE, Perez PP, Metzger J, Edwards JA, Peacock WJ, Dennis ES (1999) The FLF MADS box gene: a repressor of flowering in Arabidopsis regulated by vernalization and methylation. Plant Cell 11: 445-458[Abstract/Free Full Text]

Sheldon CC, Conn AB, Dennis ES, Peacock WJ (2002) Different regulatory regions are required for the vernalization-induced repression of FLOWERING LOCUS C and for the epigenetic maintenance of repression. Plant Cell 14: 2527-2537[Abstract/Free Full Text]

Sheldon CC, Rouse DT, Finnegan EJ, Peacock WJ, Dennis ES (2000) The molecular basis of vernalization: the central role of FLOWERING LOCUS C (FLC). Proc Natl Acad Sci USA 97: 3753-3758[Abstract/Free Full Text]

Simpson GG, Dean C (2002) Arabidopsis, the Rosetta stone of flowering time? Science 296: 285-289[Abstract/Free Full Text]

Singer T, Yordan C, Martienssen RA (2001) Robertson's Mutator transposons in A. thaliana are regulated by the chromatin-remodeling gene Decrease in DNA methylation (DDM1). Genes Dev 15: 591-602[Abstract/Free Full Text]

Snustad DP, Haas NA, Kopczak SD, Silflow CD (1992) The small genome of Arabidopsis contains at least nine expressed {beta}-tubulin genes. Plant Cell 4: 549-556[Abstract/Free Full Text]

Staden R, Beal KF, Bonfield JK (1998) The Staden Package: computer methods in molecular biology. In S Misener, SA Krawetz, eds, Bioinformatics Methods and Protocols, Vol 132. The Humana Press Inc., Totowa, NJ, pp 115-130

van der Veen JH (1965) Genes for late-flowering in Arabidopsis. In G Röbbelen, ed, Arabidopsis Research, Proceedings of the Gottingen Symposium. Gerd Wasmund and Co., Gelsenkirchen, Germany pp 162-171

Weil CF, Wessler SR (1990) The effects of plant transposable element insertion on transcription initiation and RNA processing. Annu Rev Plant Physiol Plant Mol Biol 41: 527-552[CrossRef]

Yu Z, Wright SI, Bureau TE (2000) Mutator-like elements in Arabidopsis thaliana: structure, diversity and evolution. Genetics 156: 2019-2031[Abstract/Free Full Text]

Zhang H, Van Nocker S (2002) The VERNALIZATION INDEPENDENCE 4 gene encodes a novel regulator of FLOWERING LOCUS C. Plant J 31: 663-673[CrossRef][Web of Science][Medline]




This article has been cited by other articles:


Home page
GeneticsHome page
C. Schwartz, S. Balasubramanian, N. Warthmann, T. P. Michael, J. Lempe, S. Sureshkumar, Y. Kobayashi, J. N. Maloof, J. O. Borevitz, J. Chory, et al.
Cis-regulatory Changes at FLOWERING LOCUS T Mediate Natural Variation in Flowering Responses of Arabidopsis thaliana
Genetics, October 1, 2009; 183(2): 723 - 732.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
X. Zhang and J. O. Borevitz
Global Analysis of Allele-Specific Expression in Arabidopsis thaliana
Genetics, August 1, 2009; 182(4): 943 - 954.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
G. C. K. Chiang, D. Barua, E. M. Kramer, R. M. Amasino, and K. Donohue
Major flowering time gene, FLOWERING LOCUS C, regulates seed germination in Arabidopsis thaliana
PNAS, July 14, 2009; 106(28): 11661 - 11666.
[Abstract] [Full Text] [PDF]


Home page
Mol PlantHome page
Y. He
Control of the Transition to Flowering by Chromatin Modifications
Mol Plant, July 1, 2009; 2(4): 554 - 564.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
C. Alonso-Blanco, M. G.M. Aarts, L. Bentsink, J. J.B. Keurentjes, M. Reymond, D. Vreugdenhil, and M. Koornneef
What Has Natural Variation Taught Us about Plant Development, Physiology, and Adaptation?
PLANT CELL, July 1, 2009; 21(7): 1877 - 1896.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
N. Geraldo, I. Baurle, S.-i. Kidou, X. Hu, and C. Dean
FRIGIDA Delays Flowering in Arabidopsis via a Cotranscriptional Mechanism Involving Direct Interaction with the Nuclear Cap-Binding Complex
Plant Physiology, July 1, 2009; 150(3): 1611 - 1618.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
D. Jiang, X. Gu, and Y. He
Establishment of the Winter-Annual Growth Habit via FRIGIDA-Mediated Histone Methylation at FLOWERING LOCUS C in Arabidopsis
PLANT CELL, June 1, 2009; 21(6): 1733 - 1746.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
A. L. Caicedo, C. Richards, I. M. Ehrenreich, and M. D. Purugganan
Complex Rearrangements Lead to Novel Chimeric Gene Fusion Polymorphisms at the Arabidopsis thaliana MAF2-5 Flowering Time Gene Cluster
Mol. Biol. Evol., March 1, 2009; 26(3): 699 - 711.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
A. C. Wollenberg, B. Strasser, P. D. Cerdan, and R. M. Amasino
Acceleration of Flowering during Shade Avoidance in Arabidopsis Alters the Balance between FLOWERING LOCUS C-Mediated Repression and Photoperiodic Induction of Flowering
Plant Physiology, November 1, 2008; 148(3): 1681 - 1694.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
J. D. Wilkie, M. Sedgley, and T. Olesen
Regulation of floral initiation in horticultural trees
J. Exp. Bot., September 1, 2008; 59(12): 3215 - 3228.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
S. Y. Kim, X. Yu, and S. D. Michaels
Regulation of CONSTANS and FLOWERING LOCUS T Expression in Response to Changing Light Quality
Plant Physiology, September 1, 2008; 148(1): 269 - 279.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
K. M. Veley and S. D. Michaels
Functional Redundancy and New Roles for Genes of the Autonomous Floral-Promotion Pathway
Plant Physiology, June 1, 2008; 147(2): 682 - 695.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
A. Lazaro, A. Gomez-Zambrano, L. Lopez-Gonzalez, M. Pineiro, and J. A. Jarillo
Mutations in the Arabidopsis SWC6 gene, encoding a component of the SWR1 chromatin remodelling complex, accelerate flowering time and alter leaf and flower development
J. Exp. Bot., February 21, 2008; (2008) erm332v1.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
C. R. Andersson, C. A. Helliwell, D. J. Bagnall, T. P. Hughes, E. J. Finnegan, W. J. Peacock, and E. S. Dennis
The FLX Gene of Arabidopsis is Required for FRI-Dependent Activation of FLC Expression
Plant Cell Physiol., February 1, 2008; 49(2): 191 - 200.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
H. Kuittinen, A. Niittyvuopio, P. Rinne, and O. Savolainen
Natural Variation in Arabidopsis lyrata Vernalization Requirement Conferred by a FRIGIDA Indel Polymorphism
Mol. Biol. Evol., February 1, 2008; 25(2): 319 - 329.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
N. Scarcelli, J. M. Cheverud, B. A. Schaal, and P. X. Kover
Antagonistic pleiotropic effects reduce the potential adaptive value of the FRIGIDA locus
PNAS, October 23, 2007; 104(43): 16986 - 16991.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
T. H. Kebrom and T. P. Brutnell
The molecular analysis of the shade avoidance syndrome in the grasses has begun
J. Exp. Bot., October 5, 2007; (2007) erm205v1.
[Abstract] [Full Text] [PDF]


Home page
ANN BOT (LOND)Home page
C. Shindo, G. Bernasconi, and C. S. Hardtke
Natural Genetic Variation in Arabidopsis: Tools, Traits and Prospects for Evolutionary Ecology
Ann. Bot., June 1, 2007; 99(6): 1043 - 1054.
[Abstract] [Full Text] [PDF]


Home page
Crop Sci.Home page
C. F. Weil and R.-A. Monde
Getting the Point--Mutations in Maize
Crop Sci., January 1, 2007; 47(Supplement_1): S-60 - S-67.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
M. R. Schlappi
FRIGIDA LIKE 2 Is a Functional Allele in Landsberg erecta and Compensates for a Nonsense Allele of FRIGIDA LIKE 1
Plant Physiology, December 1, 2006; 142(4): 1728 - 1738.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
S. Kim, K. Choi, C. Park, H.-J. Hwang, and I. Lee
SUPPRESSOR OF FRIGIDA4, Encoding a C2H2-Type Zinc Finger Protein, Represses Flowering by Transcriptional Activation of Arabidopsis FLOWERING LOCUS C
PLANT CELL, November 1, 2006; 18(11): 2985 - 2998.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
S Marquardt, P. Boss, J Hadfield, and C Dean
Additional targets of the Arabidopsis autonomous pathway members, FCA and FY
J. Exp. Bot., October 1, 2006; 57(13): 3379 - 3386.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
S. Guyomarc'h, M. Benhamed, G. Lemonnier, J.-P. Renou, D.-X. Zhou, and M. Delarue
MGOUN3: evidence for chromatin-mediated regulation of FLC expression
J. Exp. Bot., June 1, 2006; 57(9): 2111 - 2119.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. Wang, L. Tian, H.-S. Lee, and Z. J. Chen
Nonadditive Regulation of FRI and FLC Loci Mediates Flowering-Time Variation in Arabidopsis Allopolyploids
Genetics, June 1, 2006; 173(2): 965 - 974.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
M. Martin-Trillo, A. Lazaro, R. S. Poethig, C. Gomez-Mena, M. A. Pineiro, J. M. Martinez-Zapater, and J. A. Jarillo
EARLY IN SHORT DAYS 1 (ESD1) encodes ACTIN-RELATED PROTEIN 6 (AtARP6), a putative component of chromatin remodelling complexes that positively regulates FLC accumulation in Arabidopsis
Development, April 1, 2006; 133(7): 1241 - 1252.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
C. Darrah, B. L. Taylor, K. D. Edwards, P. E. Brown, A. Hall, and H. G. McWatters
Analysis of Phase of LUCIFERASE Expression Reveals Novel Circadian Quantitative Trait Loci in Arabidopsis
Plant Physiology, April 1, 2006; 140(4): 1464 - 1474.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
K. D. Edwards, P. E. Anderson, A. Hall, N. S. Salathia, J. C.W. Locke, J. R. Lynn, M. Straume, J. Q. Smith, and A. J. Millar
FLOWERING LOCUS C Mediates Natural Variation in the High-Temperature Response of the Arabidopsis Circadian Clock
PLANT CELL, March 1, 2006; 18(3): 639 - 650.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
M. E. El-Lithy, L. Bentsink, C. J. Hanhart, G. J. Ruys, D. Rovito, J. L. M. Broekhof, H. J. A. van der Poel, M. J. T. van Eijk, D. Vreugdenhil, and M. Koornneef
New Arabidopsis Recombinant Inbred Line Populations Genotyped Using SNPWave and Their Use for Mapping Flowering-Time Quantitative Trait Loci
Genetics, March 1, 2006; 172(3): 1867 - 1876.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
A. K. Grennan
Variations on a Theme. Regulation of Flowering Time in Arabidopsis
Plant Physiology, February 1, 2006; 140(2): 399 - 400.
[Full Text] [PDF]


Home page
DevelopmentHome page
R. J. Schmitz, L. Hong, S. Michaels, and R. M. Amasino
FRIGIDA-ESSENTIAL 1 interacts genetically with FRIGIDA and FRIGIDA-LIKE 1 to promote the winter-annual habit of Arabidopsis thaliana
Development, December 15, 2005; 132(24): 5471 - 5478.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
S. Y. Kim, Y. He, Y. Jacob, Y.-S. Noh, S. Michaels, and R. Amasino
Establishment of the Vernalization-Responsive, Winter-Annual Habit in Arabidopsis Requires a Putative Histone H3 Methyl Transferase
PLANT CELL, December 1, 2005; 17(12): 3301 - 3310.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Bot.Home page
J. R. Stinchcombe, A. L. Caicedo, R. Hopkins, C. Mays, E. W. Boyd, M. D. Purugganan, and J. Schmitt
Vernalization sensitivity in Arabidopsis thaliana (Brassicaceae): the effects of latitude and FLC variation
Am. J. Botany, October 1, 2005; 92(10): 1701 - 1707.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
K. Choi, S. Kim, S. Y. Kim, M. Kim, Y. Hyun, H. Lee, S. Choe, S.-G. Kim, S. Michaels, and I. Lee
SUPPRESSOR OF FRIGIDA3 Encodes a Nuclear ACTIN-RELATED PROTEIN6 Required for Floral Repression in Arabidopsis
PLANT CELL, October 1, 2005; 17(10): 2647 - 2660.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
I. R. Henderson, F. Liu, S. Drea, G. G. Simpson, and C. Dean
An allelic series reveals essential roles for FY in plant development in addition to flowering-time control
Development, August 15, 2005; 132(16): 3597 - 3607.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
A. Loukoianov, L. Yan, A. Blechl, A. Sanchez, and J. Dubcovsky
Regulation of VRN-1 Vernalization Genes in Normal and Transgenic Polyploid Wheat
Plant Physiology, August 1, 2005; 138(4): 2364 - 2373.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. D. Werner, J. O. Borevitz, N. H. Uhlenhaut, J. R. Ecker, J. Chory, and D. Weigel
FRIGIDA-Independent Variation in Flowering Time of Natural Arabidopsis thaliana Accessions
Genetics, July 1, 2005; 170(3): 1197 - 1207.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
A. Hay and M. Tsiantis
From genes to plants via meristems
Development, June 15, 2005; 132(12): 2679 - 2684.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
C. Shindo, M. J. Aranzana, C. Lister, C. Baxter, C. Nicholls, M. Nordborg, and C. Dean
Role of FRIGIDA and FLOWERING LOCUS C in Determining Variation in Flowering Time of Arabidopsis
Plant Physiology, June 1, 2005; 138(2): 1163 - 1173.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. D. Werner, J. O. Borevitz, N. Warthmann, G. T. Trainer, J. R. Ecker, J. Chory, and D. Weigel
Quantitative trait locus mapping and DNA array hybridization identify an FLM deletion as a cause for natural flowering-time variation
PNAS, February 15, 2005; 102(7): 2460 - 2465.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
S. Jeong and S. E. Clark
Photoperiod Regulates Flower Meristem Development in Arabidopsis thaliana
Genetics, February 1, 2005; 169(2): 907 - 915.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
S. D. Michaels, E. Himelblau, S. Y. Kim, F. M. Schomburg, and R. M. Amasino
Integration of Flowering Signals in Winter-Annual Arabidopsis
Plant Physiology, January 1, 2005; 137(1): 149 - 156.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
J. Liu, Y. He, R. Amasino, and X. Chen
siRNAs targeting an intronic transposon in the regulation of natural flowering behavior in Arabidopsis
Genes & Dev., December 1, 2004; 18(23): 2873 - 2878.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
Y. He, M. R. Doyle, and R. M. Amasino
PAF1-complex-mediated histone methylation of FLOWERING LOCUS C chromatin is required for the vernalization-responsive, winter-annual habit in Arabidopsis
Genes & Dev., November 15, 2004; 18(22): 2774 - 2784.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. L. Caicedo, J. R. Stinchcombe, K. M. Olsen, J. Schmitt, and M. D. Purugganan
Epistatic interaction between Arabidopsis FRI and FLC flowering time genes generates a latitudinal cline in a life history trait
PNAS, November 2, 2004; 101(44): 15670 - 15675.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. Hagenblad, C. Tang, J. Molitor, J. Werner, K. Zhao, H. Zheng, P. Marjoram, D. Weigel, and M. Nordborg
Haplotype Structure and Phenotypic Associations in the Chromosomal Regions Surrounding Two Arabidopsis thaliana Flowering Time Loci
Genetics, November 1, 2004; 168(3): 1627 - 1638.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
R. Amasino
Vernalization, Competence, and the Epigenetic Memory of Winter
PLANT CELL, October 1, 2004; 16(10): 2553 - 2559.
[Full Text] [PDF]


Home page
DevelopmentHome page
I. R. Henderson and C. Dean
Control of Arabidopsis flowering: the chill before the bloom
Development, August 15, 2004; 131(16): 3829 - 3838.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Bot.Home page
M. Riihimaki and O. Savolainen
Environmental and genetic effects on flowering differences between northern and southern populations of Arabidopsis lyrata (Brassicaceae)
Am. J. Botany, July 1, 2004; 91(7): 1036 - 1045.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
K. M. Olsen, S. S. Halldorsdottir, J. R. Stinchcombe, C. Weinig, J. Schmitt, and M. D. Purugganan
Linkage Disequilibrium Mapping of Arabidopsis CRY2 Flowering Time Alleles
Genetics, July 1, 2004; 167(3): 1361 - 1369.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
I. M. Scott, S. M. Clarke, J. E. Wood, and L. A.J. Mur
Salicylate Accumulation Inhibits Growth at Chilling Temperature in Arabidopsis
Plant Physiology, June 1, 2004; 135(2): 1040 - 1049.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
P. K. Boss, R. M. Bastow, J. S. Mylne, and C. Dean
Multiple Pathways in the Decision to Flower: Enabling, Promoting, and Resetting
PLANT CELL, June 1, 2004; 16(suppl_1): S18 - S31.
[Full Text] [PDF]


Home page
Plant Physiol.Home page
E. J.M. Clerkx, M. E. El-Lithy, E. Vierling, G. J. Ruys, H. Blankestijn-De Vries, S. P.C. Groot, D. Vreugdenhil, and M. Koornneef
Analysis of Natural Allelic Variation of Arabidopsis Seed Germination and Seed Longevity Traits between the Accessions Landsberg erecta and Shakdara, Using a New Recombinant Inbred Line Population
Plant Physiology, May 1, 2004; 135(1): 432 - 443.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
M. E. El-Lithy, E. J.M. Clerkx, G. J. Ruys, M. Koornneef, and D. Vreugdenhil
Quantitative Trait Locus Analysis of Growth-Related Traits in a New Arabidopsis Recombinant Inbred Population
Plant Physiology, May 1, 2004; 135(1): 444 - 458.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. R. Stinchcombe, C. Weinig, M. Ungerer, K. M. Olsen, C. Mays, S. S. Halldorsdottir, M. D. Purugganan, and J. Schmitt
A latitudinal cline in flowering time in Arabidopsis thaliana modulated by the flowering time gene FRIGIDA
PNAS, March 30, 2004; 101(13): 4712 - 4717.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
L. Yan, A. Loukoianov, A. Blechl, G. Tranquilli, W. Ramakrishna, P. SanMiguel, J. L. Bennetzen, V. Echenique, and J. Dubcovsky
The Wheat VRN2 Gene Is a Flowering Repressor Down-Regulated by Vernalization
Science, March 12, 2004; 303(5664): 1640 - 1644.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. D. Michaels, I. C. Bezerra, and R. M. Amasino
FRIGIDA-related genes are required for the winter-annual habit in Arabidopsis
PNAS, March 2, 2004; 101(9): 3281 - 3285.
[Abstract] [Full Text] [PDF]


Home page
Cold Spring Harb Symp Quant BiolHome page
J. MYLNE, T. GREB, C. LISTER, and C. DEAN
Epigenetic Regulation in the Control of Flowering
Cold Spring Harb Symp Quant Biol, January 1, 2004; 69(0): 457 - 464.
[Abstract] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
132/2/1107    most recent
pp.103.021212v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (113)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gazzani, S.
Right arrow Articles by Dean, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gazzani, S.
Right arrow Articles by Dean, C.
Agricola
Right arrow Articles by Gazzani, S.
Right arrow Articles by Dean, C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY® THE PLANT CELL
Copyright © 2003 by the American Society of Plant Biologists