Plant Physiol. Illumina
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online June 12, 2003; 10.1104/pp.102.018564

Plant Physiology 132:1186-1195 (2003)
© 2003 American Society of Plant Biologists

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
132/3/1186    most recent
pp.102.018564v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (18)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, H.-T.
Right arrow Articles by Zhou, R.-G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, H.-T.
Right arrow Articles by Zhou, R.-G.
Agricola
Right arrow Articles by Liu, H.-T.
Right arrow Articles by Zhou, R.-G.
CELL BIOLOGY AND SIGNAL TRANSDUCTION

Calmodulin Is Involved in Heat Shock Signal Transduction in Wheat1

Hong-Tao Liu, Bing Li, Zhong-Lin Shang, Xiao-Zhi Li, Rui-Ling Mu, Da-Ye Sun and Ren-Gang Zhou*

Institute of Molecular Cell Biology, Hebei Normal University, Shijiazhuang 050016, People's Republic of China (H.-T.L., B.L., Z.-L.S., R.-L.M., D.-Y.S., R.-G.Z.); and Institute of Agro-physics, Physiology, and Biochemistry, Hebei Academy of Agricultural Sciences, Shijiazhuang 050051, People's Republic of China (H.-T.L., B.L., X.-Z.L., R.-L.M., R.-G.Z.)


    ABSTRACT
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
The involvement of calcium and calcium-activated calmodulin (Ca2+-CaM) in heat shock (HS) signal transduction in wheat (Triticum aestivum) was investigated. Using Fluo-3/acetoxymethyl esters and laser scanning confocal microscopy, it was found that the increase of intracellular free calcium ion concentration started within 1 min after a 37°C HS. The levels of CaM mRNA and protein increased during HS at 37°C in the presence of Ca2+. The expression of hsp26 and hsp70 genes was up-regulated by the addition of CaCl2 and down-regulated by the calcium ion chelator EGTA, the calcium ion channel blockers LaCl3 and verapamil, or the CaM antagonists N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide and chlorpromazine. Treatment with Ca2+ also increased, and with EGTA, verapamil, chlorpromazine, or trifluoperazine decreased, synthesis of HS proteins. The temporal expression of the CaM1-2 gene and the hsp26 and hsp70 genes demonstrated that up-regulation of the CaM1-2 gene occurred at 10 min after HS at 37°C, whereas that of hsp26 and hsp70 appeared at 20 min after HS. A 5-min HS induced expression of hsp26 after a period of recovery at 22°C after HS at 37°C. Taken together, these results indicate that Ca2+-CaM is directly involved in the HS signal transduction pathway. A working hypothesis about the relationship between upstream and downstream of HS signal transduction is presented.


Organisms have developed a diverse array of mechanisms for adapting to environmental changes. One of the best characterized responses is the induction of heat shock proteins (HSPs). The heat shock (HS) response has been found in almost every organism studied to date. The HSPs are synthesized by cells in response to elevated temperature but are also induced by other environmental stresses (Noven et al., 1992Go; Kilstrup et al., 1997Go) and play an important role in the thermotolerance of plants (Queitsch et al., 2000Go; Burke, 2001Go). A connection between HS response and oxidative stress has been observed (Gong et al., 1997aGo; Lee et al., 2000Go; Larkindale and Knight, 2002Go; Panchuk et al., 2002Go). The HSPs are divided into several families based on their molecular mass, and most have molecular chaperones functions (for review, see Boston et al., 1996Go; Miernyk, 1999Go). Angiosperms synthesize more small HSPs (smHSPs) than other organisms. These smHSPs are likely critical for survival of heat stress and for specific developmental processes in plants (Waters et al., 1996Go).

The changes in cytoplasmic calcium levels act as a ubiquitous signal in eukaryotic cells. HS induced a large increase in intracellular free calcium ion concentration ([Ca2+]i) in Chinese hamster (Cricetulus barabensis) HA-1 fibroblasts (Calderwood et al., 1988Go). In plants, Gong et al. (1998Go) observed that HS caused a transient increase in [Ca2+]i. The change in [Ca2+]i is also involved in regulating the binding activity of the HS transcription factor (HSF) to the HS element (Mosser et al., 1990Go), the synthesis of HSPs (Kiang et al., 1994Go; Kuznetsov et al., 1998Go), and acquisition of HS-induced thermotolerance in plants (Gong et al., 1997bGo; Kuznetsov et al., 1998Go). Calmodulin (CaM) is an important intermediate of calcium-mediated signal transduction. In plants, the role of CaM in regulating a variety of calcium-dependent signaling pathways within the cell (Roberts and Harmon, 1992Go) and in the extracellular matrix (Ma et al., 1999Go; Sun et al., 2001Go) has been documented. The level of CaM protein is also up-regulated by HS in maize (Zea mays) seedlings (Gong et al., 1997bGo), as is expression of CaM-related TCH genes in cultured Arabidopsis cells (Braam, 1992Go).

The downstream events in HS signal transduction have been investigated (for review, see Morimoto, 1998Go; Schöffl et al., 1998Go; Pirkkala et al., 2001Go). In eukaryotes, the expression of the HSP genes induced by HS is mediated by HSF (Wu, 1995Go; Nover et al., 2001Go). During HS, the HSF is activated by conversion from a transcriptionally inactive monomer to a trimer. The activation of HSF is also influenced by phosphorylation (Kline and Morimoto, 1997Go; Reindl et al., 1997Go). Biochemical and genetic evidence supports a role of HSP70 (and/or HSP90) in negative regulation of the HS responses (Lee and Schöffl, 1996Go; Shi et al., 1998Go; Zou et al., 1998Go; Bharadwaj et al., 1999Go; Bonner et al., 2000Go; Marchler and Wu, 2001Go; Kim and Schöffl, 2002Go).

Although some studies about upstream (primary Ca2+-CaM response) and downstream (expression of HSP genes) of HS signal transduction have been reported, a role of Ca2+-CaM in regulation of HSP gene expression and HSP synthesis has not been documented. Herein, we provide evidence for the involvement of the Ca2+-CaM signaling system in HSP gene expression or HSP synthesis and the order of signal transduction steps during HS. A possible regulatory model of Ca2+-CaM in the signal transduction pathway for heat stress is proposed.


    RESULTS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

The Increase of [Ca2+]i during HS of Wheat (Triticum aestivum) Cells

To investigate the role of [Ca2+]i upstream in HS signal transduction, we examined kinetics of change in [Ca2+]i at the early stage of HS. A thin tissue section was stripped from the sheath of the first leaf of a 10-d-old green wheat seedling and observed using laser scanning confocal microscopy (LSCM). The value of fluorescence intensity is an average value obtained by scanning >10 cells in three different repeats each experiment. The fluorescence intensity did not change (both were 15.3) if 10 µM Fluo-3 in 100 nM CaCl2 solution was observed from 22°C to 37°C (Fig. 1A, 1 and 2), so the effect of temperature on dye fluorescence in the 22°C to 37°C temperature range was negligible. The fluorescence intensity was from 14.3 to 14.6 if the tissue non-loaded was incubated from 22°C to 37°C (Fig. 1A, 3 and 4), showing that autofluorescence during HS was negligible. Treatment with 25 µM A23187 and 5 mM CaCl2 resulted in a fluorescence intensity of 227.2 (Fig. 1A, 6), whereas fluorescence intensity in tissue treated with 5 mM EGTA and 25 µM A23187 was 26 (Fig. 1A, 8). This result verified that Fluo-3-fluorescence increase does report [Ca2+]i increase. To observe clearly where the dye is located, we made a full LSCM image of a protoplast. The protoplasts were obtained from tissue treated by cellulase and incubated in 10 µM Fluo-3/AM solution at 22°C or 37°C, then observed under LSCM. The image (Fig. 1B) showed that Fluo-3 is located in the cytoplasm. The dye did not move to the vacuole or apoplast during HS treatment. The Fluo-3-fluorescence in the cytoplasm increased obviously during HS treatment (Fig. 1B, 1-4). This proved that HS caused an increase of [Ca2+] in the cytoplasm. In measurement of [Ca2+]i from wheat tissue during HS, the measured tissue was incubated in medium containing 10 µM Fluo-3/AM at 24°C in the dark for 2 h. Then, the fluorescence of the cells was observed by LSCM. Fluorescence intensity was measured every 0.5 min to a total of 10 min. Control cells maintained at 22°C remained constant in fluorescence during the experiment (Fig. 1, C and E). A significant increase in [Ca2+]i was observed in the cells during HS at 37°C (Fig. 1, D and E). The initiation of this [Ca2+]i increase occurred within 1 min of HS. After 4 min of HS, the [Ca2+]i reached a maximum 3-fold increase (Fig. 1E).



View larger version (56K):
[in this window]
[in a new window]
 
Figure 1. The change in [Ca2+]i in wheat cells at 22°C or during HS at 37°C. Tissue sections from sheath of first leaf of 10-d-old green wheat seedlings were incubated in medium containing 10 µM Fluo-3/acetoxymethyl esters at 24°C in the dark for 2 h. The tissues loaded with Fluo-3/AM were heat shocked at 37°C or maintained at 22°C as the control and observed by LSCM. Excitation (488 ± 10 nm) and emission (530 ± 40 nm) filters were used in this experiment. The scan mode was XY-T (three dimensional). The fluorescence intensity was measured once every 0.5 min. Fluorescence intensity was an average value of that obtained by scanning over 10 cells from three different repeats of each experiment. A, Lane 1, dye fluorescence, 10 µM Fluo-3 + 100 nM CaCl2 at 22°C; lane 2, 10 µM Fluo-3 + 100 nM CaCl2 at 37°C; lane 3, autofluorescence in tissue non-loaded dye at 22°C; lane 4, autofluorescence in tissue non-loaded dye at 37°C; lane 5, corresponding bright-field image of cells in lanes 3 and 4; lane 6, Fluo-3-fluorescence in the tissue treated with 5 mM CaCl2 and 25 µM A23187 at 22°C; lane 7, corresponding bright-field image of the cells in lane 6; lane 8, Fluo-3-fluorescence in the tissue treated with 5 mM EGTA and 25 µM A23187 at 22°C; lane 9, corresponding bright-field image of the cells in lane 8. B, Lane 1, Fluo-3-fluorescence in the protoplast at 22°C; lane 2, corresponding bright-field image of protoplast in lane 1; lane 3, Fluo-3-fluorescence in the protoplast at 37°C; lane 4, corresponding bright-field image of protoplast in lane 3. C, Lanes 1 to 7, pseudocolor images of the wheat cells at 22°C for 0, 1.5, 3.0, 4.5, 6.0, 7.5, and 9.0 min, respectively; lane 8, transmission drawing of the cells in lanes 1 to 7 under LSCM. D, Lanes 1 to 7, pseudocolor images of the wheat cells at 0, 1.5, 3.0, 4.5, 6.0, 7.5, and 9.0 min after HS at 37°C; lane 8, the transmission drawing of the cells in lanes 1 to 7 under LSCM. E, The kinetics of [Ca2+]i in cells from wheat leaf sheath at 22°C or during HS at 37°C. The fluorescent intensity in the figure represents [Ca2+]i.

 


Changes in CaM Protein and mRNA Levels during HS

The levels of CaM protein in tissues treated with distilled water, 10 mM CaCl2, or 5 mM EGTA before HS were similar. The level of CaM protein in tissue with each treatment before HS was normalized to 100%. The concentration of CaM protein in wheat tissue treated with distilled water increased during HS at 37°C and reached a maximum 2-fold increase after 90 min of HS. Treatment with 10 mM CaCl2 promoted the increase during HS at 37°C. The accumulation of CaM protein reached a maximum 3-fold increase after 90 min of HS. The calcium ion chelator EGTA prevented CaM accumulation during HS, suggesting that CaM accumulation is dependent on calcium (Fig. 2).



View larger version (17K):
[in this window]
[in a new window]
 
Figure 2. The change in CaM protein level during HS at 37°C. Seeds imbibed overnight were germinated at 22°C in the dark for 3d. The 1.5-cm-long tissues cut from 3-d-old etiolated wheat seedlings were placed wound-side down in 1 mL of 10 mM CaCl2, 5 mM EGTA, or distilled water as a control, and incubated at 37°C. CaM was extracted from treated samples and quantified by ELISA. CaM level in tissue before HS was normalized to 100%. Each data point is the mean of three repeats.

 

Northern analysis using the wheat CaM cDNA CaM1-2 as the probe showed that the CaM1-2 is constitutively expressed, and its mRNA has a basal expression level at normal temperature (22°C). The CaM1-2 gene expression started to increase after HS at 37°C for 10 min, then reached its maximum 20 min after HS. The mRNA returned to the basal expression level after 1 h of HS.


The Effect of Exogenous Ca2+ on the Expression of Wheat CaM1-2 and hsp26 at Non-HS Temperature

The tissue cut from 3-d-old wheat seedlings was incubated in 1-mL solutions of 5, 10, or 50 mM CaCl2, respectively, at 22°C (non-HS temperature) for 30 min. Then, northern analysis using the wheat CaM1-2 and hsp26 cDNAs as probes was performed. Wheat CaM1-2 has a low, basal expression at 22°C (Fig. 3A), and wheat hsp26 mRNA was undetectable at 22°C (Fig. 3B). Treatment with 5 mM CaCl2 had little effect on the expression of CaM1-2 and hsp26. Treatment with 10 mM CaCl2 promoted expression of the two genes, and the effect of 50 mM CaCl2 was more marked (Fig. 3). Treatment with MgCl2 up to 50 mM did not affect expression of the genes (data not shown).



View larger version (22K):
[in this window]
[in a new window]
 
Figure 3. The effects of exogenous Ca2+ on the expression of the CaM1-2 and hsp26 genes at 22°C. Seedling growth conditions were described in the legend for Figure 2. The tissues were treated with distilled water or 5, 10, or 50 mM CaCl2, respectively, at 22°C for 30 min. Total RNA was extracted and then analyzed by RNA-blot hybridization. Each filter was hybridized with the probe indicated on the right. Equal quantities of total RNA were loaded in each lane.

 


The Effects of Ca2+-CaM on the Expression of HSP Genes

Various compounds that affect the Ca2+-CaM signaling system were employed to investigate the role of Ca2+-CaM in up-regulating expression of HSP genes. Total RNA was used for northern analysis, using the hsp26 and hsp70 cDNAs as probes. In control experiments, the treatments with EGTA, LaCl3, or verapamil under non-HS condition (22°C) did not affect expression of hsp26 or hsp70. The hsp26 mRNA was undetectable, and there was low-level expression of hsp70 at 22°C (Fig. 4A). A 37°C HS increased the expression of hsp26 and hsp70. Treatment with 10 mM CaCl2 increased the expression of hsp26 and hsp70, whereas treatment with the Ca2+ chelator EGTA decreased their expression (Fig. 4B). Treatment with the calcium ion channel blockers showed that 100 µM LaCl3 only slightly lowered the expression of hsp26, whereas 300 µM LaCl3 lowered the expression level significantly (Fig. 4C). Expression of hsp26 was strongly inhibited by both 100 and 200 µM verapamil (Fig. 4D).



View larger version (23K):
[in this window]
[in a new window]
 
Figure 4. The effects of Ca2+, EGTA, LaCl3, verapamil, and CaM antagonists on the expression of hsp26 and hsp70 at 22°C or during HS at 37°C. The growth conditions were the same as described for Figure 2. The tissues were treated with reagents indicated above each lane at 37°C for 1 h (B-G) or kept at 22°C as control (A and H). Total RNA was extracted, followed by northern analysis. Each filter was hybridized with the probe indicated on the right.

 

The expression of hsp26 and hsp70 decreased with increasing concentrations of the CaM antagonist N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide (W7). Treatment with 100 and 150 µM W7 had little effect on HSP gene expression, whereas treatment with higher concentrations caused a remarkable decrease in the level of hsp26 and hsp70 mRNAs (Fig. 4E). Treatment with 100 to 300 µM N-(6-aminohexyl)-1-naphthalene sulfonamide (W5), an inactive structural analog of W7, did not influence the expression of the HSP genes (Fig. 4F). Another CaM antagonist, chlorpromazine (CPZ), also down-regulated the expression of hsp26 (Fig. 4G). Control experiments showed that at 22°C, treatments with W7 or CPZ did not change the expression of hsp26 (Fig. 4H).


The Involvement of Ca2+-CaM in Synthesis of HSPs

Proteins were isolated from wheat tissue labeled with [35S]-Met at 37°C or at 22°C (control) and were separated by SDS-PAGE (Fig. 5). At non-HS temperature, the protein patterns from tissue treated with 5 mM EGTA or 50 µM CPZ (data not shown) were similar to that from untreated tissue (Fig. 5, lane 2). In response to HS at 37°C, the synthesis of specific proteins was induced. The proteins with molecular weights corresponding to the 70- to 80-kD HSPs and 17- to 20-kD smHSPs increased during HS (Fig. 5, lane 3). Treatment with 10 mM CaCl2 at 37°C led to increased accumulation of protein bands that correlate mainly with the 70- to 90-kD HSPs and the 26- to 28-kD smHSPs (Fig. 5, lane 4). In contrast, when treated with 5 mM EGTA at 37°C, there was decreased synthesis of HS-induced proteins (Fig. 5, lane 5). The synthesis of these proteins induced by HS was also inhibited by treatment with the CaM antagonists, 50 µM CPZ or 25 µM TFP (Fig. 5, lanes 6 and 7).



View larger version (37K):
[in this window]
[in a new window]
 
Figure 5. The effects of Ca2+, EGTA, CPZ, or trifluoperazine (TFP) on the synthesis of HSPs at 22°C or during HS at 37°C. The growth conditions were the same as described for Figure 2. The tissues were treated with reagents indicated above each lane at 37°C for 2 h or at 22°C as control. Forty microcuries of [35S]-Met was then added, and labeling was performed for another 2 h at the same temperature. Proteins were isolated from the treated and labeled tissues and separated on an SDS-PAGE. Approximately equal amounts of soluble proteins were loaded. The gels were dried and subjected to autoradiography at –80°C.

 


The Expression Kinetics of CaM1-2 and hsp26 and hsp70 during HS

CaM1-2 has a low, basal level of expression at normal temperature. However, we observed a increase in the accumulation of CaM1-2 mRNA after treatment at 37°C for only 10 min. The increased level of expression of CaM1-2 reached its maximum after 20 min of HS, then returned to basal levels after 1 h of HS (Fig. 6A). The Hsp26 expression was induced by HS treatment. At non-HS temperature, the hsp26 mRNA was undetectable and was still undetectable 10 min after HS. However, the hsp26 mRNA levels began to appear 20 min after HS treatment at 37°C. The accumulation of hsp26 mRNA increased with prolonged HS treatment (Fig. 6B). There was a low, basal level of hsp70 expression at normal temperature, and expression did not change after HS for 10 min. After HS treatment at 37°C for 20 min, the hsp70 expression levels began to increase (Fig. 6C). Similar expression patterns for hsp70 and hsp26 were observed. The activation of hsp26 or hsp70 gene expression was slower than CaM1-2 expression.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 6. The expression kinetics of CaM1-2, hsp26, and hsp70 genes during HS at 37°C. The growth conditions were the same as described for Figure 2. The tissues were incubated in distilled water at 37°C for the times indicated above each lane. Total RNA was extracted and analyzed by northern blot. Each filter was hybridized with the probe indicated on the right.

 

To determine the shortest HS treatment that can induce expression of hsp26, wheat seedlings were initially heat shocked at 37°C for various lengths of time and then returned to 22°C for recovery. Using this approach, we found that the induction of hsp26 expression was first detected after only 5 min of HS and peaked after 15 min of HS (Fig. 7). These results suggest that 5 min of HS is adequate to switch a key factor in the cell and initiate a signal transduction process that can carry on at a normal temperature (22°C for wheat).



View larger version (25K):
[in this window]
[in a new window]
 
Figure 7. The expression of hsp26 during a recovery (RC) at 22°C after different HS time at 37°C. The growth conditions were the same as described for Figure 2. The tissues were incubated in distilled water at 37°C and then returned to 22°C for the times indicated above each lane. The total RNA was extracted and analyzed by northern blot. Each filter was hybridized with the probe indicated on the right.

 


    DISCUSSION
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Increase of [Ca2+]i and CaM Gene Expression Induced by HS

In plant cells, the list of messengers used by signaling pathways includes Ca2+, lipids, pH, and cyclic GMP (Sanders et al., 1999Go). However, no single messenger has been demonstrated to respond to more stimuli than cytoplasmic free Ca2+. Environmental stimuli such as water stress, cold, wind, mechanical stimuli, and wounding cause increase of [Ca2+]i (Knight et al., 1991Go, 1996Go, 1997Go). CaM appears to be ubiquitous among eukaryotes and is thought to be involved in fundamental cellular processes because of its extraordinary sequence conservation (Roberts and Harmon, 1992Go). As a mediator protein of Ca2+ signal, CaM is activated by binding Ca2+, inducing a cascade of regulatory events. The expression of CaM or CaM-related genes is induced by many environmental stresses such as wind, touch, cold shock, pathogen attack, and wounding in plants (Braam, 1992Go; Depege et al., 1997Go; Heo et al., 1999Go; van der Luit et al., 1999Go).

A significant change in [Ca2+]i induced by HS has been reported in both animal (Calderwood et al., 1988Go) and plant cells (Biyaseheva et al., 1993Go; Gong et al., 1998Go). Our results are consistent with their findings; however, in addition, we examined the kinetics of the changes in [Ca2+]i during HS at 37°C in wheat cells. An important finding reported herein is that the increase in [Ca2+]i took place only 1 min after HS and peaked after 4 min (Fig. 1, D and E). The accumulation of the CaM protein in the wheat seedlings was also induced by Ca2+ (Fig. 2), confirming a previous report in maize seedlings (Gong et al., 1997bGo). In addition, expression of the wheat CaM1-2 gene was up-regulated only 10 min after HS (Fig. 6A), later than the increase in [Ca2+]i but earlier than HSP gene expression. Further results showed that 10 to 50 mM CaCl2 increased the expression level of the wheat CaM1-2 gene at non-HS temperature (22°C), indicating the dependence of CaM gene expression on [Ca2+]i (Fig. 3). Possible roles of [Ca2+]i in CaM gene expression have been documented (Polisensky and Braam, 1996Go; Depege et al., 1997Go; Heo et al., 1999Go). The rapid change in [Ca2+]i implies that this increase could be a very early step in HS signal transduction. Expression of the CaM gene at an early stage of HS response and the dependence of CaM gene expression on Ca2+ confirm that the involvement of the Ca2+-CaM signal system is upstream of HS signal transduction.


Involvement of Ca2+-CaM in the Expression of HSPs during HS

The HS response is ubiquitous when cells are exposed to elevated temperatures. However, little is known about how the HS signal is perceived and transduced to activate the genes encoding the HSPs. Ca2+ and CaM are proposed to be important components upstream in HS signal transduction due to the rapid response of Ca2+ and CaM to HS. More studies are needed to verify this proposal.

The involvement of Ca2+ in activation of HSF (Mosser et al., 1990Go) and HSP synthesis (Kiang et al., 1994Go; Kuznetsov et al., 1998Go) has been reported, but the involvement of Ca2+ and CaM in expression of HSP genes or synthesis of HSPs has not been reported previously. The northern analysis results showed that CaCl2 increased the mRNA level of the hsp70 and hsp26 genes and the calcium ion chelator EGTA, and the calcium ion channel blockers, LaCl3 and verapamil, lowered them (Fig. 4, B-D). The expression of hsp26 and hsp70 genes was decreased by treatment with the CaM antagonist W7 or CPZ, but W5, an inactive structural analog of W7, did not affect the expression of HSP genes (Fig. 4, E-G). Treatment with CaCl2 increased the synthesis of wheat HSPs remarkably, and removal of Ca2+ by EGTA lowered the synthesis of HSPs. The synthesis of HSPs was also lowered by treatment with the CaM antagonists CPZ or TFP in wheat (Fig. 5). In addition, we found that 10 to 50 mM CaCl2 not only increased the expression level of the wheat CaM1-2 gene but also up-regulated the expression level of the wheat hsp26 gene under non-HS conditions. This means that increasing [Ca2+]i instead of HS is able to induce the expression of HSP genes (Fig. 3B).

Some compounds such as EGTA, La3+, and all other inhibitors were used to investigate the role of Ca2+ and CaM in this study. These compounds do affect living cells. In particular, La3+ has been shown to drastically perturb [Ca2+]i homeostasis (Plieth 2001Go). Control experiments were performed before these compounds were used (for example, see Fig. 4, A and H). The results of control experiments showed these compounds in the concentration range we used under non-HS condition did not affect expression of genes used in this research. Employment of inhibitors such as verapamil and W7 should be feasible to study the role of Ca2+ and CaM in the cells. Considering their low specificity, further research such as the proofs in vivo is going on.

Evidence is given that there is considerable interlinking between heat and oxidative stress responses (Gong et al., 1997; Dat et al., 1998Go; Larkindale and Knight, 2002Go; Panchuk et al., 2002Go). However, the oxidative stress induced by HS is very weak under our experimental condition. First, we found in our previous experiments that mild heat treatment increased superoxide dismutase and catalase activities and also enhanced membrane thermostability in the wheat tolerant cultivar, 90-80, but not in the wheat sensitive cultivar (Zhou et al., 1995Go). The membrane injury caused by oxidative stress during heat treatment is lower in the tolerant cultivar than in the sensitive cultivar (Zhou et al., 1995Go). In this experiment, the tolerant cultivar 90-80 was used as our material. Second, our experimental results indicated that the malondialdehyde in wheat seedlings showed no significant increase at 37°C treatment for 0 to 120 min (data not shown). The change of [Ca2+] was measured within 10 min of HS, and the increase of CaM1-2, hsp26, and hsp70 gene expression appeared within 20 min after HS in this study. The oxidative stress was negligible under this condition, and the changes of [Ca2+] and gene expression patterns shown in this study are mainly due to heat stress.


The Temporal Expression of the CaM1-2, hsp26, and hsp70 Genes

Our experimental results establish the kinetics of the [Ca2+]i increase induced by HS and the expression of wheat CaM1-2, hsp26, and hsp70 genes. These results define the order of the signal transduction steps during and immediately after HS. The increase of [Ca2+]i induced by HS at 37°C occurs very quickly, taking only 1 min after HS (Fig. 1). The level of CaM1-2 mRNA significantly increased 10 min after HS, but the increase in expression of hsp26 and hsp70 was detected 20 min after HS (Fig. 6). The expression of CaM1-2 appears to increase more rapidly than expression of the HSP genes. The different temporal expression between CaM and HSP genes indicates that CaM is located upstream in HS signal transduction.

Only 5 min of HS at 37°C was needed to induce hsp26 gene expression if a recovery time of 55 min at 22°C after HS was allowed (Fig. 7). However, a longer time of 20 min HS at 37°C was needed for expression of hsp26 gene if without recovery time (Fig. 6B). This result is consistent with previous work done with soybeans (Glycine max) by Kimpel et al. (1990Go) in which 7 min HS at 40°C followed by 113 min of recovery at 28°C caused expression of soybean HSP genes. These results indicate that 5 min of HS at 37°C is sufficient to activate a key factor in the cell and turn on the HS signal transduction pathway. We consider that [Ca2+]i is probably the key factor because the increase of [Ca2+]i induced by HS takes place within 1 min after HS, and [Ca2+]i reaches its steady-state level 4 min after HS.

Our previous work has shown that there is a CaM-binding site within maize cytoplasmic HSP70 and that HSP70 binds CaM in a Ca2+-dependent manner (Sun et al., 2000Go). The conservation of the CaM-binding sequence in cytoplasmic HSP70 family members from eukaryotes implies that the binding of CaM to HSP70 could have an essential biological function. CaM is a regulatory protein involved in a variety of cellular calcium-dependent signaling pathways. The functions of CaM are performed mainly through binding to target proteins (Roberts and Harmon, 1992Go). HSP70 is a potential autoregulatory factor (Shi et al., 1998Go; Bonner et al., 2000Go); therefore, we consider that CaM might play a regulatory function during the expression of HSPs through the binding directly to cytoplasmic HSP70. An increase in the Ca2+ and CaM concentration induced by HS enhances the binding of CaM to cytoplasmic HSP70, causing the HSF-HSP70 complex to release HSF, which binds to the HS element and activates transcription of HSP genes.

It is possible that there are several different pathways of HS signal transduction in cells. Mosser et al. (1990Go) suggested that HSF is activated directly by a conformational change caused by calcium or other biochemical conditions. The activation of HSF induced by denatured proteins under HS has been documented. Based on our findings herein, we propose a Ca2+-CaM pathway of HS signal transduction. The HS signals are perceived by an as yet unidentified receptor. Receptor activation is closely followed by an increase in [Ca2+]i through opening of Ca2+ channels in the plasma membrane or intracellular Ca2+ store membrane. This elevated level of cytoplasmic [Ca2+]i then directly activates CaM and promotes the expression and accumulation of CaM. Activated CaM promotes the DNA-binding activity of HSF. Activation of HSF initiates the transcription and translation of HSP genes. Here, we propose two possible mechanisms by which active CaM might regulate the DNA-binding activity of HSF. One is through the binding of CaM directly to cytoplasmic HSP70. The other pathway is the regulation of HSF phosphorylation by regulation of CaM-dependent kinase activity. The mechanism of how CaM regulates activation of HSF to initiate the expression of HSPs remains to be solved and is the subject of ongoing studies in our laboratory.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Reagents

All enzymes were purchased from Promega (Madison, WI) or Sino-American Biotechnology Company (Luoyang, People's Republic of China). Both the reverse transcription-PCR system and agarose are from Promega. W7, W5, CPZ, TFP, and verapamil were obtained from Sigma (St. Louis). Nylon membranes were the product of Gelman Instrument Co. (Ann Arbor, MI). [35S]-Met was the product of Amersham Biosciences UK, Ltd. (Little Chalfont, Buckinghamshire, UK). [{alpha}-32P]dCTP was from the Beijing Yahui Bio-medical Technology Company (Beijing, People's Republic of China). The Random Primer DNA Labeling Kit was from the Beijing Dingguo Biotechnology Development Center (Beijing, People's Republic of China). All other reagents used were of analytical purity.


Plant Growth and Treatments

Seeds of winter wheat (Triticum aestivum L. cv 90-80) were imbibed overnight (12 h) in distilled water at 22°C. The soaked seeds were sown on three layers of filter paper wetted with distilled water for germination in the dark at 22°C for 3 d. Segments (1.5 cm long) excised from 3-d-old etiolated seedlings were used in all experiments. The tissue segments were placed wound-side down in 1 mL of different solutions (distilled water as control, CaCl2, EGTA, verapamil, LaCl3, W7, W5, CPZ, and TFP, respectively; the concentrations of compounds are described in the figure legends) at 22°C for 20 min, and then the tissue was subjected to a direct HS by placing in a controlled temperature incubator at 37°C for 1 h. In the experiments on kinetics of gene expression during HS, tissue incubated in distilled water was heat shocked in an incubator at 37°C for different times. In the recovery experiment, the tissue was heat shocked at 37°C for different times, then returned to 22°C. All treated tissues were immediately frozen in liquid N2.


Measurement of [Ca2+]i

Tissue sections of 1.5 cm from 3-d-old etiolated wheat seedlings were used in all experiments except measurement of [Ca2+]i. For measurement of [Ca2+]i, a thin tissue section was needed to load the dye and make the LSCM observations. A thin segment with intact cell layers could be obtained from the leaf sheath of 10-d-old green wheat seedlings. We had to use the 10-d-old green seedlings for investigation of [Ca2+]i, although the 3-d-old wheat etiolated seedlings were used in all other experiments. The seedlings were grown in pots in growth chamber at 22°C day/18°C night under a fluorescent light (approximately 250 µmol m–1 s–1) with a 12-h photoperiod. Fluo-3/AM was used as the Ca2+-sensitive fluorescent probe. Thin tissue sections, about three cell layers thick and 0.5 cm long, were stripped from the sheath of the first leaf of a 10-d-old green seedling and rinsed with an isotonic solution three times, then incubated in medium containing 10 µM Fluo-3/AM at 24°C in the dark for 2 h. A section loaded with Fluo-3/AM was placed on outer surface of a glass tube, through which water was circulated from a bath with the aid of a pump. The temperature of the tissue on the outer surface of the glass tube was able to reach 37°C within 2 min and maintained at 37°C, whereas the warm water was circulated from water bath at 39°C into an inner glass tube. The subepidermal leaf sheath cells were observed under LSCM (MRC-1024 with a four-line argon laser box, Bio-Rad Laboratories, Hercules, CA). Excitation filter (488 ± 10 nm) and emission filter (530 ± 40 nm) were used in this experiment. The scan mode was XY-T (three dimensional). The change of fluorescence intensity in the cells with time was recorded with the Lasersharp 2000 time lapse program (Bio-Rad Laboratories). After that, the kinetics of fluorescence intensity were measured with the software Laserpix 4.0 (Bio-Rad Laboratories).


Preparation of Probes for Northern Analysis

The plasmid encoding the soybean (Glycine max) hsp70 cDNA was kindly provided by Professor Joe L. Key (Botany Department, University of Georgia, Athens; Roberts and Key, 1991Go). The plasmid encoding the wheat CaM1-2 cDNA was a gift from Professor Hillel Fromm (Weizmann Institute of Science, Rehovot, Israel; Yang et al., 1996Go). The plasmid encoding the soybean hsp70 cDNA was digested with PstI. The 5' end of hsp70 cDNA sequence, an approximately 2,000-bp DNA fragment, was isolated, purified, and used as an hsp70 probe. The CaM1-2 cDNA was obtained by PCR with primer T3 (ATTAACCCTCACTAAAGGGA) and T7 (TAATACGACTCACTATAGGG) and used as probe in northern analysis.

According to the published sequence (Joshi et al., 1997Go), the 3' non-coding region of wheat hsp26 cDNA was obtained by reverse transcription-PCR reaction with forward primer (CGGAATTCCGTATGTGCGA GACTG) and reverse primer (CGGAATTCCGATGCAGTAATTAA). The PCR product was then purified, digested with EcoRI, and ligated with pUC19 previously digested with EcoRI. The hsp26 probe was obtained by the PCR reaction. The plasmid encoding the maize (Zea mays) rRNA gene was digested with EcoRI. An approximately 600-bp DNA fragment was isolated, purified, and used as the control probe.


Northern Analysis

The tissues frozen in liquid N2 were ground with a mortar and pestle. The extraction of total RNA was performed essentially as described by Ausubel et al. (1998Go). Electrophoresis of RNA through formaldehyde-containing 1.2% (w/v) agarose gels, transfer onto Hybond N+ nylon membranes, and hybridization with DNA probe were according to established methods (Sambrook et al., 1989Go). The DNA probes were labeled with [{alpha}-32P]dCTP using a Random Prime DNA Labeling Kit. Prehybridization and hybridization were accomplished at 42°C for 4 and 16 h. respectively. The hybridized membranes were subjected to autoradiography after washing.


Determination of CaM Protein Level in Wheat Seedlings

For isolation of CaM, wheat tissue treated with Ca2+ or EGTA at 37°C was ground in liquid N2, then homogenized in buffer (50 mM Tris-HCl [pH 8.0], 1 mM EGTA, 0.5 mM phenylmethylsulfonyl fluoride, 20 mM NaHSO4, and 0.15 M NaCl) at 1:1 (w/v). The homogenates were disintegrated by sonication for total of 2 min, treated in a water bath of 90°C to 95°C for 3 min followed by cooling, then centrifuged at 10,000g for 30 min. The supernatants were used for measurement of protein quantity and CaM concentration. It has been reported that the content of apoplastic CaM is only 2.7% of total CaM in cells (Ye and Sun, 1988Go); therefore, total CaM was assumed to be cytoplasmic CaM in this experiment. Protein was quantified by the Bradford method using bovine serum albumin as the standard. The CaM concentration was determined by ELISA according to Sun et al. (1995Go). Recombinant potato (Solanum tuberosum) CaM was purified to electrophoretic homogeneity from Escherichia coli by a phenyl-Sepharose affinity chromatography. The antiserum against potato CaM was described by Bai et al. (2002Go).


In Vivo Labeling and Gel Electrophoresis

Wheat tissues were incubated in 1 mL of various treatment solutions (as described in the figure legends) and heat shocked at 37°C or kept at 22°C as control with gentle shaking. Forty microcuries of [35S]-Met was added to each sample after 2 h at 37°C. Labeling was carried out for another 2 h at 37°C. The labeled tissues were rinsed thoroughly with rinse buffer (1 mM K-PO4 [pH 7.5], 1% [w/v] Suc, and 5 mM Met), then immediately placed into liquid N2. For protein isolation, the tissues were ground in liquid N2 and then homogenized in homogenization buffer (50 mM Tris-HCl [pH 7.5], 2% [w/v] {beta}-mercaptoethanol, and 5 mM EDTA). Homogenates were centrifuged at 12,000g at 4°C for 20 min. The supernatants were separated by 12.5% (w/v) SDS-PAGE. After gels were dried under vacuum, autoradiography was performed using Kodak x-ray film at –80°C.


    ACKNOWLEDGMENTS
 
We thank Professor Hillel Fromm (Weizmann Institute of Science, Rehovot, Israel) for the wheat CaM1-2 cDNA and Professor Joe L. Key (Botany Department, University of Georgia, Athens) for the soybean hsp70 cDNA. We also thank Dr. Jan A. Miernyk (Plant Genetics Research Unit, U.S. Department of Agriculture, Agricultural Research Service, Columbia, MO) for critical reading of the manuscript and comments.

Received December 6, 2002; returned for revision January 14, 2003; accepted March 17, 2003.


    FOOTNOTES
 
Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.102.018564.

1 This work was supported by the National Natural Science Foundation of China (grant no. 3977075), by the Natural Science Foundation of Hebei Province, China (grant no. 301447), and by the National Key Basic Research Special Funds, China (G1999011700). Back

* Corresponding author; e-mail zhourengang{at}163.com; fax 0086-311-7042490.


    LITERATURE CITED
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K (1998) Short Protocols in Molecular Biology. Science Publisher, Beijing, pp 125-126

Bai J, Mao GH, Guo Y, Wang ZL (2002) Preparation and identification of antibody against potato CaM (PCM6) purified from the engineering bacteria. J Hebei Normal Univ 26: 292-294

Bharadwaj S, Ali A, Ovsenek KN (1999) Multiple components of the HSP90 chaperone complex function in regulation of heat shock factor 1 in vivo. Mol Cell Biol 19: 8033-8041[Abstract/Free Full Text]

Biyaseheva AE, Molotkovskii YG, Mamonov LK (1993) Increase of free Ca2+ in the cytosol of plant protoplasts in response to heat shock as related to Ca2+ homeostasis. Russ Plant Physiol 40: 540-544

Bonner JJ, Carlson T, Fackenthal DL, Paddock D, Storey K, Lea K (2000) Complex regulation of the yeast heat shock transcription factor. Mol Biol Cell 11: 1739-1751[Abstract/Free Full Text]

Boston RS, Viitanen PV, Vierling E (1996) Molecular chaperones and protein folding in plants. Plant Mol Biol 32: 191-222[CrossRef][Web of Science][Medline]

Braam J (1992) Regulated expression of the calmodulin-related TCH genes in cultured Arabidopsis cells: induction by calcium and heat shock. Proc Natl Acad Sci USA 89: 3213-3216[Abstract/Free Full Text]

Burke JJ (2001) Identification of genetic diversity and mutations in higher plant acquired thermotolerance. Physiol Plant 112: 167-170[CrossRef]

Calderwood SK, Stevenson MA, Hahn GM (1988) Effects of heat on cell calcium and inositol lipid metabolism. Radiation Res 113: 414-425[Web of Science][Medline]

Dat JF, Foyer CH, Scott IM (1998) Change in salicylic acid and antioxidants during induced thermotolerance in mustard seedlings. Plant Physiol 118: 1455-1461[Abstract/Free Full Text]

Depege N, Thonat C, Coutand C, Julien JL, Boyer N (1997) Morphological responses and molecular modifications in tomato plants after mechanical stimulation. Plant Cell Physiol 38: 1127-1134[Abstract/Free Full Text]

Gong M, Chen SN, Song YQ, Li ZG (1997a) Effect of calcium and calmodulin on intrinsic heat tolerance in relation to antioxidant systems in maize seedlings. Aust J Plant Physiol 24: 371-379

Gong M, Li YJ, Dai X, Tian M, Li ZG (1997b) Involvement of calcium and calmodulin in the acquisition of heat-shock induced thermotolerance in maize. J Plant Physiol 150: 615-621[Web of Science]

Gong M, ver dan Luit AH, Knight MR, Trewavas AJ (1998) Heat-shock-induced changes in intracellular Ca2+ level in tobacco seedlings in relation to thermotolerance. Plant Physiol 116: 429-437[Abstract/Free Full Text]

Heo WD, Lee SH, Kim MC, Kim JC, Chung WS, Chun HJ, Lee KJ, Park CY, Park HC, Choi JY et al. (1999) Involvement of specific calmodulin isoforms in salicylic acid-independent activation of plant disease resistance responses. Proc Natl Acad Sci USA 96: 766-771[Abstract/Free Full Text]

Joshi CP, Klueva NY, Morrow KJ, Nguyen HT (1997) Expression of a unique plastid-localized heat-shock protein is genetically linked to acquired thermotolerance in wheat. Theor Appl Genet 95: 834-841[CrossRef]

Kiang JG, Carr FE, Burns MR, McClain DE (1994) HSP-70 synthesis is promoted by increase in [Ca2+]i or activation of G proteins but not pHi or cAMP. Cell Physiol 267: c104-c114

Kilstrup M, Jacobsen S, Hammer K, Vogensen FK (1997) Induction of heat shock proteins DnaK, GroEL, and GroES by salt stress in Lactococcus lactis. Appl Environ Microbiol 63: 1826-1837[Abstract/Free Full Text]

Kim BH, Schöffl F (2002) Interaction between Arabidopsis heat shock transcription factor 1 and 70 KDa heat shock proteins. J Exp Bot 53: 371-375[Abstract/Free Full Text]

Kimpel JA, Nagao RT, Goekjian V, Key JL (1990) Regulation of the heat shock response in soybean seedlings. Plant Physiol 94: 988-995[Abstract/Free Full Text]

Kline MP, Morimoto RI (1997) Repression of the heat shock factor 1 transcriptional activation domain is modulated by constitutive phosphorylation. Mol Cell Biol 17: 2107-2115[Abstract/Free Full Text]

Knight H, Trewavas AJ, Knight MR (1996) Cold calcium signaling in Arabidopsis involves two cellular pools and a change in calcium signature after acclimation. Plant Cell 8: 489-503[Abstract]

Knight H, Trewavas AJ, Knight MR (1997) Calcium signaling in Arabidopsis thaliana responding to drought and salinity. Plant J 12: 1067-1078[CrossRef][Web of Science][Medline]

Knight MR, Campbell AK, Smith SM, Trewavas AJ (1991) Transgenic plant aequorin reports the effects of touch and cold shock and elicitors on cytoplasmic calcium. Nature 352: 524-526[CrossRef][Medline]

Kuznetsov VV, Andreev IM, Trofimova MS (1998) The synthesis of HSPs in sugar beet suspension culture cells under hyperthermia exhibits differential sensitivity to calcium. Biochem Mol Biol Int 45: 269-278[Medline]

Larkindale J, Knight MR (2002) Protection against heat stress-induced oxidative damage in Arabidopsis involves calcium, abscisic acid, ethylene, and salicylic acid. Plant Physiol 128: 682-695[Abstract/Free Full Text]

Lee BH, Won SH, Lee HS, Miyao M. Chung WI, Kim IJ, Jo J (2000) Expression of the chloroplast-localized small heat shock protein by oxidative stress in rice. Gene 245: 283-290[CrossRef][Web of Science][Medline]

Lee JH, Schöffl F (1996) An Hsp70 antisense gene affects the expression of HSP70/HSC70, the regulation of HSF, and the acquisition of thermotolerance in transgenic Arabidopsis thaliana. Mol Gen Genet 252: 11-19[CrossRef][Web of Science][Medline]

Ma LG, Xu XD, Cui SJ, Sun DY (1999) The presence of a heterotrimeric G protein and its role in signal transduction of extracellular calmodulin in pollen germination and tube growth. Plant Cell 11: 1351-1363[Abstract/Free Full Text]

Marchler G, Wu C (2001) Modulation of Drosophila heat shock transcription factor activity by the molecular chaperone DROJ1. EMBO J 20: 499-509[CrossRef][Web of Science][Medline]

Miernyk JA (1999) Protein folding in the plant cell. Plant Physiol 121: 695-703[Free Full Text]

Morimoto RI (1998) Regulation of the heat shook transcriptional response: cross talk between a family of heat shock factors, molecular chaperones, and negative regulators. Genes Dev 12: 3788-3796[Free Full Text]

Mosser DD, Kotzbauer PT, Sarge KD, Morimoto RI (1990) In vitro activation of heat shock transcription factor DNA-binding by calcium and biochemical conditions that affect protein conformation. Proc Natl Acad Sci USA 87: 3748-3752[Abstract/Free Full Text]

Noven LG, Haskell DW, Guy CL, Denslow N, Klein PA, Green LG, Silverman A (1992) Association of 70-kilodalton heat-shock cognate proteins with acclimation to cold. Plant Physiol 99: 1362-1369[Abstract/Free Full Text]

Nover L, Bharti K, Doring P, Mishra SK, Ganguli A, Scharf KD (2001) Arabidopsis and the heat stress transcription factor world: how many heat stress transcription factors do we need? Cell Stress Chap 6: 177-189[Web of Science][Medline]

Panchuk II, Volkov RA, Schöffl F (2002) Heat stress- and heat shock transcription factor-dependent expression and activity of ascorbate peroxidase in Arabidopsis. Plant Physiol 129: 838-853[Abstract/Free Full Text]

Pirkkala L, Nykänen P, Sistonen L (2001) Poles of the heat shock transcription factors in regulation of the heat shock response and beyond. FASEB J 15: 1118-1131[Abstract/Free Full Text]

Plieth C (2001) Plant calcium signaling and monitoring-pros and cons and recent experimental approaches. Protoplasma 218: 1-23[CrossRef][Web of Science][Medline]

Polisensky DH, Braam J (1996) Cold-shock regulation of the Arabidopsis TCH genes and the effects of modulating intracellular calcium levels. Plant Physiol 111: 1271-1279[Abstract]

Queitsch C, Hong SW, Vierling E, Lindquest S (2000) Heat shock protein 101 plays a crucial role in thermotolerance in Arabidopsis. Plant Cell 12: 479-492[Abstract/Free Full Text]

Reindl A, Schöffl F, Schell J, Koncz C, Bako L (1997) Phosphorylation by a cyclin-dependent kinase modulates DNA-binding of the Arabidopsis heat shock transcription factor HSF1 in vitro. Plant Physiol 115: 93-100[Abstract]

Roberts DM, Harmon AC (1992) Calcium-modulated proteins: targets of intracellular calcium signals in higher plants. Annu Rev Plant Physiol Plant Mol Biol 43: 375-414[CrossRef][Web of Science]

Roberts JK, Key JL (1991) Isolation and characterization of a soybean hsp70 gene. Plant Mol Biol 16: 671-683[Medline]

Sambrook J, Frisch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual, Ed 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY

Sanders D, Brownlee C, Harper JF (1999) Communication with calcium. Plant Cell 11: 691-706[Free Full Text]

Schöffl F, Prandl R, Reindl A (1998) Regulation of the heat-shock response. Plant Physiol 117: 1135-1141[Free Full Text]

Shi Y, Mosser DD, Morimoto RI (1998) Molecular chaperones as HSF1-specific transcriptional repressors. Genes Dev 12: 654-666[Abstract/Free Full Text]

Sun DY, Bian YQ, Zhao BH, Zhao LY, Yu XM, Duan SJ (1995) The effects of extracellular calmodulin on cell wall regeneration of protoplasts and cell division. Plant Cell Physiol 36: 133-138[Abstract/Free Full Text]

Sun DY, Tang WQ, Ma LG (2001) Extracellular calmodulin: a polypeptide signal in plants? Sci China Ser C 44: 449-460

Sun XT, Li B, Zhou GM, Tang WQ, Bai J, Sun DY, Zhou RG (2000) Binding of the maize cytosolic hsp70 to calmodulin, and identification of calmodulin-binding site in hsp70. Plant Cell Physiol 41: 804-810

van der Luit AH, Olivari C, Haley A, Knight MR, Trewavas AJ (1999) Distinct calcium signaling pathways regulate calmodulin gene expression in tobacco. Plant Physiol 121: 705-714[Abstract/Free Full Text]

Waters ER, Lee GJ, Vierling E (1996) Evolution, structure and function of the small heat shock proteins in plants. J Exp Bot 47: 325-338

Wu C (1995) Heat shock transcription factor: structure and regulation. Annu Rev Cell Dev Biol 11: 441-469[CrossRef][Web of Science][Medline]

Yang T, Segal G, Abbo S, Feldman M, Fromm H (1996) Characterization of the calmodulin gene family in wheat: structure, chromosomal location, and evolutional aspects. Mol Gen Genet 252: 684-694[Medline]

Ye ZH, Sun DY (1988) Study of apoplastic CaM in wheat. Chin Sci Bull 33: 624-626

Zhou RG, Fan ZH, Li XZ, Wang ZW, Han W (1995) The effect of heat acclimation on membrane thermostability and relative enzyme activity. Acta Agron Sin 21: 568-572

Zou J, Guo Y, Guettouche T, Smith DF, Voellmy R (1998) Repression of heat shock transcription factor HSF1 activation by HSP90 (HSP90 complex) that forms a stress-sensitive complex with HSF1. Cell 94: 471-480[CrossRef][Web of Science][Medline]




This article has been cited by other articles:


Home page
Plant Physiol.Home page
W. Zhang, R.-G. Zhou, Y.-J. Gao, S.-Z. Zheng, P. Xu, S.-Q. Zhang, and D.-Y. Sun
Molecular and Genetic Evidence for the Key Role of AtCaM3 in Heat-Shock Signal Transduction in Arabidopsis
Plant Physiology, April 1, 2009; 149(4): 1773 - 1784.
[Abstract] [Full Text] [PDF]


Home page
ANN BOT (LOND)Home page
T. Hewezi, M. Leger, and L. Gentzbittel
A Comprehensive Analysis of the Combined Effects of High Light and High Temperature Stresses on Gene Expression in Sunflower
Ann. Bot., July 1, 2008; 102(1): 127 - 140.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
X. Pang, T. Halaly, O. Crane, T. Keilin, A. Keren-Keiserman, A. Ogrodovitch, D. Galbraith, and E. Or
Involvement of calcium signalling in dormancy release of grape buds
J. Exp. Bot., September 1, 2007; 58(12): 3249 - 3262.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
B. Li, H.-T. Liu, D.-Y. Sun, and R.-G. Zhou
Ca2+ and Calmodulin Modulate DNA-Binding Activity of Maize Heat Shock Transcription Factor in Vitro
Plant Cell Physiol., May 15, 2004; 45(5): 627 - 634.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
132/3/1186    most recent
pp.102.018564v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (18)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, H.-T.
Right arrow Articles by Zhou, R.-G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, H.-T.
Right arrow Articles by Zhou, R.-G.
Agricola
Right arrow Articles by Liu, H.-T.
Right arrow Articles by Zhou, R.-G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY® THE PLANT CELL
Copyright © 2003 by the American Society of Plant Biologists