|
|
||||||||
|
First published online June 5, 2003; 10.1104/pp.102.017533 Plant Physiology 132:1207-1216 (2003) © 2003 American Society of Plant Biologists Temperature Shift Coordinately Changes the Activity and the Methylation State of Transposon Tam3 in Antirrhinum majusLaboratories of Genetic Engineering (S.-n.H., K.K., T.M., Y.K.) and Plant Breeding (Y.K.), Graduate School of Agriculture, Hokkaido University, Sapporo 060-8589, Japan
The transposition frequency of Tam3 in Antirrhinum majus, unlike that of most other cut-and-paste-type transposons, is tightly controlled by temperature: Tam3 transposes rarely at 25°C, but much more frequently at 15°C. Here, we studied the mechanism of the low-temperature-dependent transposition (LTDT) of Tam3. Our results strongly suggest that LTDT is not likely to be due to either transcriptional regulation or posttranscriptional regulation of the Tam3 TPase gene. We found that temperature shift induced a remarkable change of the methylation state unique to Tam3 sequences in the genome: Higher temperature resulted in hypermethylation, whereas lower temperature resulted in reduced methylation. The methylation state was reversible within a single generation in response to a temperature shift. Although our data demonstrate a close link between LTDT and the methylation of Tam3, they also suggest that secondary factor(s) other than DNA methylation is involved in repression of Tam3 transposition.
Tam3 in Antirrhinum majus is exceptional among cut-and-paste-type transposons (TEs) in that it is the only known TE whose transpositional behavior can be strictly controlled by environmental influence. Tam3 transposition is strongly affected by temperature: It is active at low temperatures (around 15°C) and stable at high temperatures (around 25°C; Harrison and Fincham, 1964
Among the regulatory factors associated with TE activity, DNA methylation
is widely involved in the inhibition of transpositional events in plant TEs.
DNA methylation can regulate TE transposition at the levels of both
transposase (TPase) gene expression and the TPase binding process
(Schlappi et al., 1994 Here, we attempted to find differences between the active and inactive states of Tam3 in plants grown at different temperatures. We compared the amounts of the transcript of the TPase gene and compared the enzymatic activity of Tam3 TPase between plants grown at 25°C and 15°C. The results showed that neither the transcription of the TPase gene nor its enzymatic activity were markedly influenced by the temperature shift. Interestingly, the methylation state of the genomic Tam3 elements at different temperatures changed specifically in a manner that paralleled the low-temperature-dependent transposition (LTDT), and the original methylation state could be restored within a single generation after a temperature shift. The mechanism of LTDT of Tam3 appeared to be profoundly linked with the methylation state of the end regions of the element. However, our results do not prove that methylation is a direct cause of Tam3 inactivation, but they suggest that there is secondary factor(s) that suppresses Tam3 transposition in the LTDT process.
Expression of the TPase Gene
The HAM5 line of A. majus, which is homozygous for the
nivearecurrens:Tam3 (niv rec:Tam3)
allele, showed a number of flower variegation spots, which resulted from the
somatic reversion of niv expression, at 15°C, whereas only a few
spots were observed at 25°C due to the relative stability of Tam3 at the
higher temperature (Fig. 1).
This effect of temperature on Tam3 excision was previously described by
Harrison and Fincham (1964
To detect the transcriptional start sites of the TPase gene within the Tam3 sequence, primer extension analysis, which is rather more sensitive than northern analysis, was carried out using the same RNA samples employed in northern analysis. The adenine of the putative first ATG of the Tam3 TPase gene is present at nucleotide 690 of the Tam3 sequence, and the TATA box and transcription initiator element (INR) were predicted to be located between nucleotides 480 and 530 of Tam3 (Fig. 2). Primer Tam3/587 (nucleotides 587-613 of Tam3) generated several extension products in the predicted promoter region of the Tam3 TPase gene (Fig. 2). Corresponding signals were also obtained using a different primer (primer Tam3/825; nucleotides 825-847 of Tam3; data not shown). The multiple signals might have originated from the transcription of different sequences of various Tam3 copies in the genome. The same signals were detected in the 25°C and 15°C RNA samples (Fig. 2). These results indicated that the Tam3 TPase gene was similarly transcribed from the sites proximal to its putative promoter sequence at the two temperatures.
To analyze the Tam3 TPase activity, we prepared plasmid constructs
containing a Tam3 element in which there was a deletion of the internal
sequence. If Tam3 TPase activity is present in a plant cell, the Tam3 element
is expected to be excised from the plasmid DNA after integration into the
cell. A transient assay for Ac activity used to demonstrate Ds excision after
bombardment of transgenic barley (Hordeum vulgare) callus lines
containing Ac has been reported (McElroy
et al., 1997
Next, to examine the methylation state of the Tam3 sequences in
the HAM5 genome, we performed hybridization analysis using a
methylation-sensitive enzyme, HpaII, and a partially
methylcytosine-sensitive isoschizomer, MspI. We examined plants
exposed to different temperature conditions: The seeds were reared at 25°C
for 2 months (sample 1), then the plants were shifted to 15°C and grown
for 4 months (sample 2), and then they were shifted back to 25°C for 4
months (sample 3; Fig. 1). DNA
sampling of the HAM5 leaves was performed before the end of the growth period
at each temperature. The three probes employed were designed from the region
containing the first ATG (probe A), the middle region (Tam3 nucleotides
1,419-1,799), and the region containing the stop codon of the putative
Tam3 TPase gene (Fig.
3). The blotting results represent the whole Tam3 family in the
A. majus genome, which contains about 50 copies of Tam3. A
chloroplast DNA fragment (Kishima et al.,
1995
The blotting patterns obtained using the three Tam3 probes showed a common trend (Fig. 3). The MspI (first lane) and HpaII (second lane) digests of DNA from sample 1 showed different digestion patterns, indicating that the Tam3 sequences were considerably methylated in the HAM5 genomic DNA at 25°C. Preferential digestion of DNA from sample 2 (third lane) compared with DNA from sample 1 was observed with HpaII, indicating that the Tam3 sequences reduced the methylated level at 15°C relative to 25°C. The digestion patterns obtained for sample 3 had reverted to those of sample 1 (fourth lane). These results showed that the methylation state of Tam3 changes reversibly depending on the temperature. The methylation state varied depending on the region within Tam3. As shown in each panel of Figure 3, the results obtained with probes B and C revealed relatively heavier methylation of the Tam3 TPase coding sequence at both the temperatures, compared with the 5' region of the gene as revealed by the hybridization of probe A with the smallest possible HpaII fragment (0.7 kb). This implies that the TPase coding sequence is highly methylated at 25°C despite production of the transcript.
We then investigated the methylation state of the end regions of the Tam3
copies inserted in the S-6, S-78, and S-99 loci
(Kishima et al., 1999
The hybridization patterns in Figure 4 revealed the methylation states of the end regions in the three copies. In each panel, the MboI/HpaII digestion patterns of samples 1 and 3 (the two 25°C samples) were similar, whereas the digestion pattern of the 15°C sample (sample 2) was different except in the case of the inactive Tam3 at S-6. With MboI/HpaII double digestion, most of the 25°C samples produced the same largest sized bands as produced by MboI single digestion, but in the 15°C samples, these bands disappeared in the active copies at the S-78 and S-99 loci. The largest bands in the 25°C samples resulted from extensive and heavy methylation of HpaII sites in the MboI fragment. The methylation occurred in the initial 25°C growth condition, and it recurred when the temperature was shifted back to 25°C after growth at 15°C. The reversion to the high degree of methylation within single generation is a unique phenomenon for the plant genome. Smaller sized bands, which indicated a less methylated state at the Tam3 end, arose in the active Tam3 copies at the S-78 and S-99 loci in the 15°C condition. In the 3' region of Tam3: S-78, the most active copy (extra bands due to Tam3 excision reflect the activity at S-78; see Fig. 4), the temperature-dependent alteration of the methylation pattern was limited in the outermost sites of the HpaII cluster. The results showed that methylation of the Tam3 end regions also parallels the temperature change, like methylation of the Tam3 internal regions, and is a somatically reversible reaction. Taken together, the results showed that the degree of methylation state of the Tam3 sequences of the high-temperature samples was much heavier than that of the low-temperature sample and that the change of the Tam3 methylation state was well correlated with the LTDT response. However, except in the case of the 5' end of S-6, the smaller bands, indicative of hypomethylation, did not disappear in the 25°C samples, implying that methylation at the terminal sites was not complete in the inactive condition of Tam3. This leads us to suppose that methylation in the end regions might not be the sole determinant of the suppression of Tam3 transposition at the higher temperature, although the varying transposition activities among the copies appeared to be related to the methylation level at the terminal sites of each locus.
We performed 5-methylcytosine analysis using sodium bisulfite sequencing to
confirm the above results. The genomic DNAs from plant samples 1 and 2 (see
Fig. 1) were examined, and
primers were designed to amplify the 3' regions of Tam3 at the
S-6 and S-99 loci (unfortunately, we were unable to amplify
the 5' regions of the two Tam3 loci). The sense strands of 120
nucleotides from the 3' end of Tam3 that contains six sites of CpG, 15
sites of CpNpG (where N is either A, C, G, or T), and 22 asymmetric (CpHpH,
where H is either A, C, or T) cytosine sites were analyzed. As expected in the
above results, the 3' regions of both the Tam3 loci in the 25°C
sample exhibited the hypermethylation state compared with that of each locus
in the 15°C samples (Fig.
5). The difference in the methylation levels at the two loci also
reflected the results obtained by Southern hybridization analysis
(Fig. 4) where the methylation
state of Tam3 of S-6 was heavier than that of S-99. In the
S-6 locus, about 65% of the total cytosines in the 3' end
region were methylated in the plant grown at 25°C, and the methylcytosines
in the plant grown at 15°C were reduced to one-half of those in the plant
grown at 25°C. In the Tam3 3' end region of S-99, 20% of
the overall cytosines in the 25°C sample were methylated, whereas in the
15°C sample, only 10% of cytosines were detected as methylcytosine. These
results also show that the methylation level remarkably varies among Tam3
copies, which inserted into different genomic locations. As shown in
Figure 5A, the regions where
the methylation levels were affected by a temperature change corresponded
between S-6 and S-99. However, no specific relationships
seem to be present between the change of methylation level and CpG, CpNpG, and
CpHpH sites (Fig. 5B). The
methylcytosines that responded to the temperature shift were localized on the
terminal inverted repeat and the hairpin loop cluster in the 3'
subterminal region of Tam3 (Yamashita et
al., 1999
To examine whether the methylation state of other repetitive sequences in
the A. majus genome changes depending on the temperature, we used the
Southern-blot method using two different repetitive sequences as probes
(Fig. 6). A TE-like short
sequence in the A. majus genome, Tam661
(Yamashita et al., 1998
We showed here that LTDT of Tam3 was coordinated with a change of the methylation level of the Tam3 sequence. One striking finding of our study was that shifting the temperature affected the DNA methylation level of a specific sequence during a single generation of plant growth. Although genomic methylation in mammals undergoes resetting early in development, the methylation state of plant DNA is generally well maintained throughout the lifespan of the organism, and methylation at some loci has been reported to be heritably stable over a number of generations (Cubas et al., 1999
DNA methylation seems to be a key factor for repressing the transposition
of plant TEs. A number of studies have addressed the relationship between DNA
methylation and TPase gene expression. An increased level of DNA
methylation of the promoter regions of autonomous elements such as Ac, Spm,
and MuDR tends to reduce the production of TPase transcripts and the
transposition frequency (Chandler and
Walbot, 1986
Several possible mechanisms of regulating the level of methylation in the
Tam3 ends can be suggested, including the following: (a) Tam3 DNA contains a
total of 16 firm hairpin structures with high GC content in sequences that lie
within 500 bp from each end of the element
(Yamashita et al., 1999
The arrest of Tam3 transposition at the high temperature might not be
determined solely by methylation. This possibility is suggested by two
features of the stable condition of Tam3: The transcriptional and
posttranscriptional activities of the Tam3 TPase gene were detectable
(Figs. 2 and
3), and methylation was not
complete at the end regions of the active Tam3 copies (Figs.
4 and
5). Although the correlation
between the Tam3 activity and the methylation state accords well with the fact
that DNA methylation is often found in inactive transposons, our results raise
the question of whether methylation is a direct cause of LTDT or an event that
occurs simultaneously with LTDT. Evidence that methylation is not essential
for repression of the TE activity was reported for the retrotransposon MAGGY
of Magnaporthe grisea
(Nakayashiki et al., 2001
There is evidence that temperature affects the transposition of plant TEs
in several descriptions of unstable pigmentation phenotypes: petal flaking
frequency in Portulaca grandyflora
(Beale and Faberge, 1941
Plant Materials and Extraction of DNA and RNA
We used the HAM5 and HAM3 lines of Antirrhinum majus, which were
kindly provided by Dr. Cathie Martin (John Innes Center, Norwich, UK). HAM5,
derived from the
nivearecurrens:Tam3/stabilizer line, was
initially grown at 25°C for 2 months, and subsequently shifted to a
15°C growth chamber and grown for 4 months, then shifted back to 25°C
and grown for 4 months. The HAM5 isogenic line HAM3, which carries the
stabilizer+ allele, was grown at 25°C. DNA was extracted from young leaves
(3-4 cm in length) of A. majus plants. The procedure of the DNA
extraction was modified from the one described by Murray and Thompson
(1980
Twenty micrograms of each RNA sample was electrophoresed on a 1% (w/v) agarose gel containing formaldehyde and transferred onto a nylon membrane (Positively Charged, Boehringer Mannheim/Roche, Basel). A 1,300-bp (nucleotide positions 1,700-3,000 in the Tam3 sequence) region of the Tam3 TPase coding region was employed as the template for the probe. The Tam3 probe was prepared using a PCR-based labeling system with PCR DIG labeling mix (Roche) and the following primers: Tam3-1700F, 5'GTTGCATTACCGCACATTGG3'; and Tam3-C, 5'TCTCTATATTGTTGGTCGAGCATGTCT3'. Hybridization was carried out overnight at 65°C, and detection was performed using a DIG Nucleic Acid Detection Kit (Roche).
For determination of the transcription initiation sites of the Tam3 TPase gene, primer extension experiments were performed using polyadenylated poly(A+) RNA isolated from the leaves. Poly(A+) RNA was isolated using the PolyATtract mRNA isolation systems (Promega, Madison, WI). Oligonucleotide primers 5'-CACCGTGGAGGTATGAC-3' (primer-Tam3/587), and 5'-GTGAATCTTCATATGGTGTATC-3' (primer-Tam3/825), corresponding to sequences starting at nucleotide positions 587 and 825 of Tam3, respectively, were end labeled with IRD800 and IRD700 (LI-COR, Lincoln, NE), respectively. Poly(A+) RNA (2 µg) was hybridized with the labeled primers in a solution containing 250 mM KCl, 10 mM Tris/HCl (pH 8.3), and 1 mM dithiothreitol at 85°C for 10 min and then at room temperature for 90 min. The extension reaction was carried out in 50 mM Tris/HCl (pH 8.3), 75 mM MgCl2, 1 mM dithiothreitol, each dNTP at 0.25 mM, 1 unit of RNAsin (Takara, Kyoto), and 5 µL of reverse transcriptase (100 units µL1 MMLV Reverse Transcriptase RNaseH, TOYOBO, Tokyo, Japan) at 42°C for 1h. After RNase treatment (16 µg mL1, 37°C for 30 min), the cDNA products were extracted with phenol and chloroform and precipitated with ethanol. The DNA was analyzed by electrophoresis on a 4.5% (w/v) polyacrylamide sequencing gel. Dideoxy sequencing products primed with the corresponding primers were electrophoresed in parallel for size comparison. The fluorescent signals were detected using a DNA Sequencer model LIC400 (LI-COR).
A plasmid, pBS18-10E, carrying a 1,370-bp partial Tam3 sequence with an
internal deletion of the 2,260-bp region from the BalI to the
TthHB81 site was used for monitoring Tam3 excision. This plasmid was
constructed by combining the vector pBluescriptSK with the Tam3 5'
region from AG1400 (SK; from the XbaI to the BalI site) and
the Tam3 3' region from Tam3:S-18 (SK; from the TthHB81 to the
EaeI site). The Tam3 5' and 3' regions were ligated to
each other and then treated by filling in with T4 DNA polymerase.
This plasmid does not have 8-bp duplications at the ends of Tam3 and,
therefore, does not undergo loop-out recombination between the target site
duplications. Thus, the plasmid produced pBS18-10E, which was delivered via
the bombardment method into leaves isolated from plants grown at different
temperatures. For the bombardment delivery, surface-sterilized A.
majus leaves were placed directly on agar plates containing 0.8% (w/v)
agar in water. Gold particles (2 mg, 1.0-µm diameter, Bio-Rad Laboratories,
Hercules, CA) were coated with a 6:1 (w/v) ratio of the reporter plasmid
carrying the internally deleted Tam3 to the reference plasmid carrying the
renilla luciferase reporter gene. The plant material was bombarded with 1
µg of DNA-coated gold particles using a helium-driven Biolistic PDS 1000
System (Bio-Rad Laboratories) with a 28-mmHg vacuum. The distance between the
rupture disc and the macrocarrier was 1 cm. The bombarded leaves were
incubated for 16 h at 15 or 25°C. Leaves from HAM5, HAM3, and tobacco
(Nicotiana tabacum cv SR1) were obtained from plants grown at
15°C or 25°C. The leaf DNA was extracted after incubation at 15°C
or 25°C for 16 h. To recover the plasmid, an aliquot of the DNA solution
was used for transformation of Escherichia coli (DH5
The methylation state of Tam3 and the other repetitive elements was
investigated by Southern-blot analysis using the C-methylation-sensitive
enzyme HpaII, partially sensitive enzyme MspI (isoschizomer
of HpaII), and insensitive enzymes EcoRV and MboI.
HAM5 genomic DNA was isolated from the plants as described above. The
following probes were prepared using a PCR-based labeling system with PCR DIG
labeling mix (Roche): Tam3 probe A, CCTCACATTTTTATTTCTTAGTG +
GGGTCGGTACTTGGAACTCC; Tam3 probe B, CACCGTGGAGGTATGAC + GAGGACATTGTGGCATCGCG;
Tam3 probe C, CTAACCCCTGTCTTGGC + ACGCGTCGACGCAACTACAACAAAGGTGC;
5'-flanking sequence of (5' fla.) S-6, CAAACAGGTTCAGCTCTCC +
GTATCTACACCAATAACTGCG; 3' flanking sequence of (3' fla.) S-6,
AAAATATGTCATCTTGGTCACTGGTTGC + GTGTACTTACTGCATAGCGTTCCTT; 5' fla. S-78,
CTTGTTCGTGGATTGGTTGGTGGTCGCCTG + GTTGTAGCATAGTGTAGTTAG; 3' fla. S-78,
GCAATAGATACAACAATAGCAGG + GATCATGAACCAATTTCAAAACTCTCC; 5' fla. S-99,
AACTTCCTCCTACGATATTGCTC + CCCTTTAATTGAGTGGTCATCTCTC; and 3' fla. S-99,
ACAGTGGACTATGTCTCCTAGTATAC + AATTCGCGGCCGCT. The DNA templates (the plasmid
clones; Kitamura et al., 2001
Before the sodium bisulfite reaction, the genomic DNAs of samples 1 and 2
(see Fig. 1) were digested with
MboI to facilitate the reaction. The sodium bisulfite modification
procedures were adapted as described by Frommer et al.
(1992
We are especially grateful to Dr. Cathie Martin (John Innes Center, Norwich, UK) for valuable comments on the manuscript. We thank Prof. Yoshio Sano and Dr. Tomohiko Kubo (Hokkaido University, Faculty of Agriculture, Japan) for providing a sequencing machine and technical advice, and Dr. Cathie Martin for gifts of the A. majus seeds. Part of this work was done at the Research Center for Molecular Genetics, Hokkaido University. Received November 11, 2002; returned for revision January 20, 2003; accepted March 6, 2003.
Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.102.017533. * Corresponding author; e-mail kishima{at}abs.agr.hokudai.ac.jp; fax 81-11-706-4934.
Beale GH, Faberge AC (1941) Effect of temperature on the mutation rate of an unstable gene in Portulaca grandiflora. Nature 147: 356-357 Bennetzen JL (1987) Covalent DNA modification and the regulation of Mutator element transposition in maize. Mol Gen Genet 208: 45-51[CrossRef][ISI] Brown J, Sundaresan V (1992) Genetic study of the loss and restoration of Mutator transposon activity in maize: evidence against dominant-negative regulator associated with loss of activity. Genetics 130: 889-898[Abstract] Brutnell TP, Dellaporta SL (1994) Somatic inactivation and reactivation of Ac associated with changes in cytosine methylation and transposase expression. Genetics 138: 213-225[Abstract] Cao X, Jacobsen SE (2002) Locus-specific control of asymmetric and CpNpG methylation by the DRM and CMT3 methyltransferase genes. Proc Natl Acad Sci USA 99; 16491-16498 Carpenter R, Martin C, Coen E (1987) Comparison of genetic behaviour of the transposable element Tam3 at two unlinked pigment loci in Antirrhinum majus. Mol Gen Genet 207: 82-89[CrossRef]
Chandler VL, Walbot V (1986) DNA modification
of a maize transposable element correlates with loss of activity. Proc
Natl Acad Sci USA 83:
1767-1771
Chen X, Mariappan SV, Catasti P, Ratliff R, Moyzis RK, Laayoun
A, Smith SS, Bradbury EM, Gupta G (1995) Hairpins are
formed by the single DNA strands of the fragile X triplet repeats: structure
and biological implications. Proc Natl Acad Sci USA
92:
5199-5203 Chomet PS, Wessler S, Dellaporta SL (1987) Inactivation of the maize transposable element Activator (Ac) is associated with its DNA modification. EMBO J 6: 295-302[ISI][Medline] Coen ES, Robbins TP, Almeida J, Hudson A, Carpenter R (1989) Consequences and mechanisms of transposition in Antirrhinum majus. In DE Berg, MH Howe, eds, Mobile DNA. American Society for Microbiology, Washington, DC, pp 413-436 Cubas P, Vincent C, Coen E (1999) An epigenetic mutation responsible for natural variation in floral symmetry. Nature 401: 157-161[CrossRef][Medline] Ellis TH, Delseny M, Lee D, Burcham KW (1990) Methylated and under-methylated rDNA repeats are interspersed at random in two higher plant species. Plant Mol Biol 14: 73-80[CrossRef][ISI][Medline]
Frommer M, McDonald LE, Millar DS, Collis CM, Watt F, Grigg
GW, Molloy PL, Paul CL (1992) A genomic sequencing
protocol that yields a positive display of 5-methylcytosine residues in
individual DNA strands. Proc Natl Acad Sci USA
89:
1827-1831 Fuks F, Burgers WA, Brehm A, Hughes-Davies L, Kouzarides T (2000) DNA methyltransferase Dnm1 associates with histone deacetylase activity. Nat Genet 24: 88-91[CrossRef][ISI][Medline]
Godde JS, Kass SU, Hirst MC, Wolffe AP (1996)
Nucleosome assembly on methylated CGG triplet repeats in the Fragile X Mental
Retardation gene 1 promoter. J Biol Chem
271:
24325-24328 Gorbunova V, Ramos C, Hohn B, Levy AA (2000) A nuclear protein that binds specifically to several maize transposons is not essential for Ds1 excision. Mol Gen Genet 263: 492-497[Medline] Harrison BJ, Fincham JRS (1964) Instability at the pal locus in Antirrhinum majus: I. Effects of environment on frequencies of somatic and germinal mutation. Heredity 19: 237-258[ISI] Hehl R, Nacken WK, Krause A, Saedler H, Sommer H (1991) Structural analysis of Tam3, a transposable element from Antirrhinum majus, reveals homologies to the Ac element from maize. Plant Mol Biol 16: 369-371[CrossRef][ISI][Medline] Kakutani T, Munakata K, Richards EJ, Hirochika H (1999) Meiotically and mitotically stable inheritance of DNA hypomethylation induced by ddm1 mutation of Arabidopsis thaliana. Genetics 15: 831-838 Kishima Y, Ogura K, Mizukami K, Mikami T, Adachi T (1995) Chloroplast DNA analysis in buckwheat species: phylogenetic relationships, origin of the reproductive systems and extended inverted repeats. Plant Sci 108: 173-179[CrossRef] Kishima Y, Yamashita S, Martin C, Mikami T (1999) Structural conservation of the transposon Tam3 family in Antirrhinum majus and estimation of the number of copies able to transpose. Plant Mol Biol 39: 299-308[CrossRef][Medline] Kitamura K, Hashida S, Mikami T, Kishima Y (2001) Position effect of the excision frequency of the Antirrhinum transposon Tam3: implication for the degree of position-dependent methylation in the ends of the element. Plant Mol Biol 47: 475-490[CrossRef][ISI][Medline] Kunze R, Starlinger P (1989) The putative transposase of transposable element Ac from Zea mays L. interacts with subterminal sequences of Ac. EMBO J 8: 3177-3185[ISI][Medline] Kunze R, Starlinger P, Schwartz D (1988) DNA methylation of the maize transposable element Ac interferes with its transcription. Mol Gen Genet 214: 325-327[CrossRef] Kunze R, Stochaj U, Laufs J, Starlinger P (1987) Transcription of transposable element Activator (Ac) of Zea mays L. EMBO J 6: 1555-1563[ISI][Medline] Martin C, Prescott A, Lister C, MacKay S (1989) Activity of the transposon Tam3 in Antirrhinum and tobacco: possible role of DNA methylation. EMBO J 8: 997-1004[ISI][Medline] McElroy D, Louwerse DJ, McElory SM, Lemaux PG (1997) Development of a simple transient assay for Ac/Ds activity in cells of intact barley tissue. Plant J 11: 157-165[CrossRef][Medline]
Murray MG, Thompson WF (1980) Rapid isolation
of high molecular weight plant DNA. Nucleic Acids Res
8:
4321-4325
Nakayashiki H, Ikeda K, Hashimoto Y, Tosa Y, Mayama S
(2001) Methylation is not the main force repressing the
retrotransposon MAGGY in Magnaporthe grisea. Nucleic Acids
Res 29:
1278-1284 Nan X, Ng HH, Johnson CA, Laherty CD, Turner BM, Eisenman RN, Bird A (1998) Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex. Nature 393: 386-389[CrossRef][Medline] Rhoades M (1941) The genetic control of mutability in maize. Cold Spring Harbor Symp Quant Biol 9: 138-144 Robertson KD, Ait-Si-Ali S, Yokochi T, Wade PA, Jones PL, Wolffe AP (2000) Dnmt1 forms a complex with Rb, E2F1 and HDAC1 and represses transcription from E2F-responsive promoters. Nat Genet 25: 338-342[CrossRef][ISI][Medline]
Ros F, Kunze R (2001) Regulation of
activator/dissociation transposition by replication and DNA methylation.
Genetics 157:
1723-1733
Sand SA (1957) Phenotypic variability and the
influence of temperature on somatic instability in cultures derived between
Nicotiana langsdorffii and N. sanderae.
Genetics 42:
685-703 Sano Y, Sano R (1990) Variation of the intergenic spacer region of ribosomal DNA in cultivated and wild rice species. Genome 33: 209-218 Schlappi M, Raina R, Fedoroff N (1994) Epigenetic regulation of the maize Spm transposable element: novel activation of a methylated promoter by TnpA. Cell 77: 427-437[CrossRef][ISI][Medline] Schwartz D, Dennis E (1986) Transposase activity of the Ac controlling element in maize is regulated by its degree of methylation. Mol Gen Genet 205: 476-482[CrossRef]
Wolffe AP, Jones PL, Wade PA (1999) DNA
demethylation. Proc Natl Acad Sci USA
96:
5894-5896 Yamashita S, Mikami T, Kishima Y (1998) Tam3 in Antirrhinum majus is exceptional transposon in resistant to alteration by abortive gap repair: identification of nested transposons. Mol Gen Genet 259: 468-474[CrossRef][Medline]
Yamashita S, Shimizu-Takano T, Kitamura K, Mikami T, Kishima
Y (1999) Resistance to gap repair of the transposon Tam3 in
Antirrhinum majus: a role of the end regions. Genetics
153:
1899-1908 This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE |