First published online May 22, 2003; 10.1104/pp.102.019026
Plant Physiology 132:1217-1227 (2003)
© 2003 American Society of Plant Biologists
DEVELOPMENT AND HORMONE ACTION
Hormonal Control of Cell Proliferation Requires PASTICCINO Genes
Yaël Harrar,
Yannick Bellec,
Catherine Bellini and
Jean-Denis Faure*
Laboratoire de Biologie Cellulaire, Institut National de la Recherche
Agronomique, 78026 Versailles cedex, France
 |
ABSTRACT
|
|---|
PASTICCINO (PAS) genes are required for coordinated cell
division and differentiation during plant development. In loss-of-function
pas mutants, plant aerial tissues showed ectopic cell division that
was specifically enhanced by cytokinins, leading to disorganized tumor-like
tissue. To determine the role of the PAS genes in controlling cell
proliferation, we first analyzed the expression profiles of several genes
involved in cell division and meristem function. Differentiated and
meristematic cells of the pas mutants were more competent for cell
division as illustrated by the ectopic and enlarged expression profiles of
CYCLIN-DEPENDENT KINASE A and CYCLIN B1. The expression of
meristematic homeobox genes KNOTTED-LIKE IN ARABIDOPSIS (KNAT2,
KNAT6), and SHOOT MERISTEMLESS was also increased in
pas mutants. Moreover, the loss of meristem function caused by
shoot meristemless mutation can be suppressed by pas2. The
KNAT2 expression pattern defines an enlarged meristematic zone in
pas mutants that can be mimicked in wild type by cytokinin treatment.
Cytokinin induction of the primary cytokinin response markers, ARABIDOPSIS
RESPONSE REGULATOR (ARR5 and ARR6), was enhanced and lasted
longer in pas mutants, suggesting that PAS genes in wild
type repress cytokinin responses. The expression of the cytokinin-regulated
cyclin D, cyclin D3.1, was nonetheless not modified in pas
mutants. However, primary auxin response genes were down-regulated in
pas mutants, as shown by a lower auxin induction of IAA4 and
IAA1 genes, demonstrating that the auxin response was also modified.
Altogether, our results suggest that PAS genes are involved in the
hormonal control of cell division and differentiation.
Plant cell proliferation and differentiation are controlled by many factors
and, in particular, by the hormones auxin and the cytokinins. High
auxin/cytokinin ratios usually induce root formation, whereas low
auxin/cytokinin ratios induce shoot formation. Intermediate auxin/cytokinin
ratios induce cell dedifferentiation and proliferation, leading to callus
development. Several cytokinin signaling and early response genes were
recently found to be involved in the control of cell proliferation and
differentiation (for review, see Haberer
and Kieber, 2002 ). Cytokinin perception involves three
membrane-associated receptors (AtHK2, AtHK3, and AtHK4/CRE1/WOL) similar to
the lower eukaryotes two-component system, which are constituted by a sensor
His kinase (also termed sensor) and one or more response regulators. An
additional gene called CKI1, which is structurally related to
CRE1, is also able to activate the cytokinin signaling pathway, but
does not bind cytokinins, at least at physiological concentrations (for
review, see Hwang and Sheen,
2001). Cytokinins induce a multistep phosphorelay transfer from
the receptor to small phosphotransmitter proteins called Arabidopsis
His-phosphotransfer proteins (AHP). Upon phosphorylation by one of the
cytokinin-activated His kinase receptors, AHP1 and AHP2, but not AHP5, migrate
from the cytosol to the nucleus where they activate B-type response regulators
(ARR2 or ARR1; Hwang and Sheen,
2001). B-type response regulators are composed of a receiver
domain with a C terminus output domain related to those found in the
DNA-binding motifs of basic helix-loop-helix and MYB transcription factors
(Lohrmann and Harter, 2002).
B-type ARABIDOPSIS RESPONSE REGULATORS (ARRs) are located in
the nucleus where they activate the transcription of A-type ARRs such
as ARR5 or ARR6. The transcription of A-type ARRs
is rapidly induced by cytokinins, whereas that of B-type ARRs has
been reported to be unaffected by cytokinins
(Imamura et al., 1999;
Kiba et al., 1999;
D'Agostino et al., 2000).
Mutations in the AtHK4/CRE1/WOL gene decrease cell proliferation in
response to cytokinins (Inoue et al.,
2001). Overexpression of ARR2 and CKI1 leads to
extensive cell proliferation and shoot regeneration in the absence of
cytokinins (Kakimoto, 1996;
Hwang and Sheen, 2001).
Similarly, overexpression of ARR1 results in increased sensitivity to
cytokinins as illustrated in a cell proliferation assay
(Sakai et al., 2001).
Conversely, the arr1 mutant is less sensitive to cytokinins
(Sakai et al., 2001).
Overexpression of the cytokinin-induced gene Enhanced Shoot
Regeneration1 also confers cytokinin-independent shoot regeneration
(Banno et al., 2001). Mutations
in other yet-uncharacterized genes are also responsible for the deregulation
of cell proliferation and regeneration in vitro. Mutations in
POM1/ERH2 and IRE1 induce shoot regeneration in the presence
of suboptimal concentration of cytokinins, but do not modify cytokinin
endogenous levels (Cary et al.,
2001). The analysis of cytokinin responses demonstrated that
pom1 and ire1 mutants are cytokinin hyper-responsive rather
than hypersensitive. In contrast, ckh1 and ckh2 mutants,
isolated in similar screens, present typical cytokinin hypersensitivity
(Kubo and Kakimoto, 2000).
Cytokinins were also involved in regulating cell division in the shoot
apical meristem (Schmulling,
2002). Cell divisions in the apical meristem have been shown to be
controlled by the homeobox-related factors like SHOOT MERISTEMLESS
(STM; Weigel and Jurgens,
2002). STM was required for the maintenance of the
meristematic stem cells. KNOTTED-like1 (KNAT1), which is related to
STM, induces lobed leaves with ectopic meristems when overexpressed
in Arabidopsis (Chuck et al.,
1996). Both genes were up-regulated by cytokinins
(Rupp et al., 1999). The
converse is also true because overexpression of the maize (Zea mays)
KNOTTED1 (KN1) gene in tobacco (Nicotiana tabacum)
and overexpression of KNOTTED-LIKE IN ARABIDOPSIS (KNAT1) in
lettuce (Lactuca sativa) lead to cytokinin accumulation
(Hewelt et al., 2000;
Frugis et al., 2001). Ectopic
expression of maize KN1 resulted in cytokinin-autotrophic growth of cultured
tobacco tissues (Hewelt et al.,
2000).
Although a large set of mutants and genes have been isolated and
characterized from in vitro cell proliferation and regeneration experiments,
much less is known about the genetic control of cell proliferation and
differentiation in planta. Several mutant lines of Arabidopsis were directly
selected for their ability to grow as callus on hormone-free medium
(Frank et al., 2000). These
different mutant lines were altered in their cytokinin and/or auxin
sensitivity and contents. Unfortunately, these lines could not be studied
further because of their sterility. Recently, three different genes
TUMOROUS SHOOT DEVELOPMENT (TSD1, 2, 3) were genetically
identified because their loss of function resulting in disorganized tumorous
tissues instead of leaves and stems (Frank
et al., 2002). Inhibitory concentrations of cytokinins for wild
type enhance cell proliferation in tsd seedlings. The tsd
phenotype is reminiscent of the phenotype of the pasticcino
(pas) mutants (Faure et al.,
1998). The pas mutants were isolated in a screen for
uncontrolled growth in presence of cytokinins, leading to cell proliferation
and callus formation. Pas mutants had an altered development starting
at the embryo heart stage, leading to abnormal leaf and root development
(Faure et al., 1998).
Seedlings presented an enlarged hypocotyl and small rounded cotyledons, which
did not develop further after germination. The apical meristem structure was
variable, often showing a large disorganized meristematic-like zone. Organs of
the plant apices showed ectopic and anarchic cell divisions, which were not
observed in the root. The pas mutants represent three complementation
groups (Pas1, Pas2, and Pas3). Double-mutant analysis
revealed epistatic relationships between them, suggesting genetic interactions
between the PAS genes. The PAS1 gene was cloned and found to
encode an immunophillin-like protein of the FK506-binding protein family
(Vittorioso et al., 1998;
Harrar et al., 2001).
FK506-binding proteins probably hold signaling proteins in
"poised" states that can be triggered to active forms by protein
modifications, such as phosphorylation
(Rutherford and Zuker, 1994).
PAS2 gene was recently identified and found to encode a protein Tyr
phosphatase-like structurally conserved among eukaryotes
(Bellec et al., 2002).
As cytokinins are involved in cell differentiation and proliferation and
have been shown to enhance proliferation in the pas mutants, we have
analyzed the relationship between the pas phenotype and cytokinin
responses. Here, we present evidence that pas mutants have a modified
competence for cell division in meristematic and differentiated tissues that
is associated with the deregulation of cytokinin but also auxin primary
response genes.
|
RESULTS
|
|---|
The Expression Pattern of Cell Cycle Genes Is Deregulated in
pas Mutants
To evaluate the differentiation state of the cells in different seedling
tissues, we examined the expression of CYCLIN-DEPENDENT KINASE A
(CDKA), a marker of cell division competency, which is weakly
expressed in differentiated cells (Hemerly
et al., 1993). CDKA:: -glucuronidase
(GUS) expression was analyzed in 10-d-old pas and wild-type
seedlings (Fig. 1A). In wild
type, CDKA was mainly expressed in the root and apical meristems as
well as in the leaf primordia, but was absent or weakly expressed in
differentiated tissues like hypocotyls, roots, or cotyledons. In the three
pas mutants, CDKA expression was enhanced in seedling
apices, particularly in the meristematic area. CDKA expression was
also ectopically expressed in the hypocotyl and the cotyledons, demonstrating
that the cells of these normally differentiated tissues retained some
competence to divide. To examine whether CDKA expression was correlated with
the expression of other cell division markers, we monitored CYCLIN B1
(CYCB1 also named Cyc1a) expression in pas mutants
(Fig. 1, B and C).
CYCB1 is a mitotic cyclin specifically expressed at the G2/M
transition and provides a marker for cells undergoing mitotic divisions
(Ferreira et al., 1994). We
introduced CYCB1::GUS marker into the pas mutants to monitor
the pattern of cell divisions in seedlings. Due to the stability of GUS and
the absence of the cyclin "destruction box" (db) in the construct,
CYCB1::GUS does not indicate the cells dividing at the time of
observation, but rather the history of divisions that took place in the
different tissues the days preceding the observation. Wild-type seedlings
showed CYCB1 expression in roots and apical meristems as well as in
young leaf primordia. The three pas mutant seedlings showed enhanced
expression of CYCB1 in the meristems, but also ectopically in the
hypocotyl and the cotyledons. CYCB1 expression often appeared in
localized areas of pas leaves, suggesting heterogeneous activation of
cell division (Fig. 1C); this
patchy pattern was never observed in wild type. To monitor cell division at
the time of staining, CYCB1::db::GUS was introduced into pas
mutants and was analyzed in 5-d-old seedlings to check whether ectopic cell
division observed with CYCB1::GUS was occurring earlier in
development. In wild type, 5 d after germination CYCB1::db::GUS
staining was only observed in the root meristematic zone
(Fig. 1D). No staining could be
observed in the seedling apical part (Fig.
1F). In the pas mutants, CYCB1::db::GUS staining
in the root is similar to wild type, indicating that pas mutations
did not alter directly the cell cycle and thus the expression of
CYCB1. Contrary to the root, the apical part of pas seedling
showed ectopic expression of CYCB1::db::GUS in differentiated tissues
such as the hypocotyl and the cotyledons
(Fig. 1, G and H).
View larger version (146K):
[in this window]
[in a new window]
|
Figure 1. Expression of cell division and meristematic-associated markers in the
pas mutants. (A) CDKA::GUS expression in wild-type,
pas1, pas2, and pas3 seedlings (from left to right,
two seedlings each) 10 d after germination. Wild-type seedlings were grown in
the absence (left) or presence of 0.1 µM 6-benzyladenine (BA;
right). All of the pas mutants were grown in absence of cytokinins.
(B) CYCB1::GUS expression in wild-type, pas1, pas2,
and pas3 seedlings (from left to right, two seedlings each) 10 d
after germination. CDKA and CYCB1 were strongly expressed in
the meristems and were ectopically expressed in the leaves of the pas
mutants. (C) CYCB1::GUS expression in pas1 mutant 10 d after
germination showing localized area of ectopic CYCB1 expression in the
leaves. (D) CycB1::db::GUS expression in 5 d after germination
wild-type root. (E) CycB1::db::GUS expression 5 d after germination
in pas2-1 root. (F) CycB1::db::GUS expression 5 d after
germination in wild-type seedling. (G and H) CycB1::db::GUS
expression 5 d after germination in pas2-1 seedling. (I)
KNAT2::GUS expression in wild-type, pas1, pas2, and
pas3 seedlings (from left to right, two seedlings each) 10 d after
germination. Wild-type seedlings were grown in the absence (left) or presence
of 0.1 µM BA (right). The corresponding meristematic areas are
enlarged, showing increased expression of KNAT2 in the presence of
cytokinins (right insert) compared with control (left insert). The
pas mutants were grown in the absence of cytokinins. (J)
KNAT2::GUS expression in the pas2 mutant 18 d after
germination. (K) KNAT2::GUS expression in the pas3 mutant 10
d after germination. KNAT2::GUS staining shows the existence of
enlarged or doubled meristem in the pas mutants. (L)
KNAT2::GUS expression in mature wild-type embryo. (M)
KNAT2::GUS expression in mature pas2 embryo. Scale bar
represents 1 mm except for D, E, L, and M, where it represents 200 µm.
|
|
Several KNAT Genes are Up-Regulated in pas
Mutants
Analysis of cell division markers showed an enlarged meristematic region in
the three pas mutants. Enlargement of meristematic area was
associated with disorganized meristem structure, as already described
(Faure et al., 1998). Thus, we
analyzed the expression pattern of several KNOTTED-like in
Arabidopsis (KNAT) genes, which where found to be involved in
meristem function. Expression levels of KNAT1, KNAT2, KNAT6, and
STM were analyzed by reverse-transcriptase (RT)-PCR and real-time
quantitative PCR (for STM only). KNAT2, KNAT6, and
STM genes, but not KNAT1, showed increased expression levels
in pas seedlings compared with wild type, suggesting that
PAS genes act as negative regulators of the expression of several
KNAT genes (Fig. 2, A and
B).
View larger version (34K):
[in this window]
[in a new window]
|
Figure 2. Interaction between KNAT genes and pas phenotype. (A)
RT-PCR analysis of KNAT mRNA levels in wild-type and pas mutants. (B)
Real-time quantitative PCR of STM mRNA levels in wild-type and pas
mutants. (C) Phenotype of wild type, stm/stm, pas2/pas2, and
the double-mutant pas2/pas2;stm/stm.
|
|
KNAT expression was further analyzed in the case of
KNAT2, which is specifically expressed in the inner part of the
meristem that contains the founder cells that will be recruited by the
peripheral and rib zones to initiate organs
(Dockx et al., 1995).
KNAT2 provides a marker for the most undifferentiated cells of the
meristem. KNAT2::GUS was observed in 10-d-old wild-type and mutant
seedlings (Fig. 1I). Although
KNAT2::GUS was restricted in wild type to a small internal zone of
the meristem, the zone of its expression was enlarged in the three
pas mutants. In some pas2 and pas3 mutant
seedlings, KNAT2::GUS staining defined several distinct but connected
regions in the meristematic zone, suggesting the occurrence of meristematic
activity outside the usual bounds of the shoot apical meristem
(Fig. 1, J and K). The ectopic
formation of shoots in pas2 and pas3 suggests that multiple
sites of shoot initiation could develop from these enlarged meristematic
regions. KNAT2 enlarged expression could be a consequence of the
modified meristematic zone in the pas mutants. KNAT2::GUS
expression was analyzed in mature embryo imbibated for 16 h
(Fig. 1, L and M). The
pas embryos still presented an enlarged KNAT2::GUS
expression zone compared with wild type, even if the expression pattern was
not as pronounced as in the seedlings. As previously shown
(Hamant et al., 2002),
KNAT2 expression is enhanced in wild-type apical meristems of
seedlings treated with exogenous cytokinins
(Fig. 1I, inserts). Cytokinin
treatment also induced ectopic KNAT2 expression in the vascular
tissue of wild-type roots (data not shown). The KNAT2::GUS pattern in
pas mutants were similar to those observed in cytokinin-treated wild
type, i.e. enlarged meristematic GUS staining and ectopic staining in root
vascular bundles. In a wild-type background expressing KNAT2::GUS,
GUS activity as quantified by fluorometry was 2 ± 0.2 nmol MU
min–1 mg–1. In
pas seedlings, GUS activity was 7.2 ± 0.2 nmol MU
min–1 mg–1 for
pas1, 5.6 ± 1.5 for pas2, and 8.2 ± 0.2 for
pas3. This result confirmed the enhanced expression of KNAT2
in pas mutants.
To investigate how the increased cell division in pas meristems is
relevant to meristem function, we analyzed the phenotype of double mutants
between pas2-1 and a strong stm allele (stm dgh6),
which is unable to form a shoot apical meristem
(Fig. 2C). We have chosen
pas2 because it has the less altered postembryonic phenotype among
the pas mutants, in particular at the levels of leaves and stems
(Bellec et al., 2002). Plants
from the F2 population were genotyped by PCR. All the double
mutants pas2/pas2; stm/stm analyzed at the seedling stage showed
fused and deformed leaves characteristic of pas2 mutants. The
presence of leaves in the double mutants indicated that the shoot apical
meristem was functional and that pas2 mutation was able to suppress
strong stm mutation, restoring an active meristem.
Cytokinin Primary Response Genes Are Up-Regulated in pas
Mutants
Because KNAT expression and function were associated with
cytokinins in several studies (Rupp et
al., 1999; Hamant et al.,
2002), an attractive hypothesis could be that pas
mutations affect directly cytokinin responses. Thus, cytokinin responses were
analyzed in the pas mutants compared with wild type by quantifying
the expression of two A-type ARR genes, ARR5 and
ARR6 (Fig.
3). We used an experimental system that allowed rapid and
reproducible treatment of seedlings by hormones. Seedlings were germinated on
solid media and were grown in the light for about 12 d and were then
transferred to the same liquid media for 2 d and finally were directly treated
with cytokinins in liquid. Liquid culture allows homogeneous seedling
treatment and rapid access of the hormone to all seedling tissues.
View larger version (33K):
[in this window]
[in a new window]
|
Figure 3. Cytokinin regulation of ARR5 and ARR6 in pas
mutants. (A) ARR5 and ARR6 mRNA levels in wild-type and pas
mutant seedlings after 30 and 60 min cytokinin treatment, respectively. (B)
Time-course expression analysis of ARR5 (top) and ARR6
(bottom) in wild-type and pas mutants. Seedlings were transferred 12
d after germination to liquid media for 2 d and treated with 10
µM BA for the time indicated. ARR hybridization signals
were quantified and normalized with EF-1 as described in
"Materials and Methods."
|
|
ARR5 and ARR6 expression were first monitored in
wild-type and pas mutants after 30 and 60 min, respectively, of
induction with 10 µM BA (Fig.
3A). Pas mutants showed increased expression levels of
both genes after cytokinin treatment compared with wild type (5-, 24-, 16-,
and 23-fold for ARR5 at 30 min and 4-, 13-, 8-, and 10-fold for
ARR6 at 60 min, for wild type, pas1, pas2, and
pas3, respectively; Fig.
3A).
To investigate whether pas mutations modified not only the
amplitude but also the timing of cytokinin response, time-course analysis of
ARR5 and ARR6 expression was undertaken. ARR5 was
induced by cytokinins in wild-type treated seedlings in 15 min with a 19-fold
induction and then mRNA levels declined rapidly, reaching noninduced levels
after 60 min (Fig. 3B).
ARR6 mRNA showed a 4-fold induction by cytokinins after 10 min and
then reached basal levels after 60 min.
(Fig. 3B). Both genes were also
induced by cytokinins in pas mutants but with a higher amplitude than
in wild type. After a 15-min induction, ARR5 mRNA levels were 2-fold
higher in pas1 and pas2 mutants compared with wild type, and
after a 30-min induction, reached three to six times wild-type levels for the
three pas mutants. Induction of ARR5 in pas3
mutants was similar to wild type after 15 min of treatment, but mRNA levels
remained high after 60 min of induction. ARR6 induction was also
enhanced in the three pas mutants. Pas3 mutants showed the
highest response with a 4-fold wild-type level at 30 min. In all three
mutants, ARR6 expression was maintained at high levels even after 60
min of treatment, whereas wild-type mRNA levels returned to almost basal
level.
ARR5 expression was also analyzed in planta by following the
expression of an ARR5::GUS construct
(Fig. 4A-E). ARR5
expression in young seedlings was mainly expressed in apical and root
meristems, but was also found in vascular tissues (root, hypocotyl, and
cotyledons). Weak ARR5 expression was also observed in cotyledons and
mature leaves after prolonged staining
(Fig. 4A; D'Agostino et al., 2000).
Cytokinin treatment enhanced GUS staining in the meristem, confirming the
northern results (Fig. 4, A and
B, inserts). In the pas mutants, ARR5::GUS
expression was also mainly localized in meristems, but the staining intensity
was significantly increased compared with wild type in agreement with the
northern results (Fig. 1, C-E).
In young pas seedlings showing a strong phenotype, enhanced
ARR5::GUS expression can be found in cotyledon and hypocotyl cells
(data not shown). ARR5::GUS staining was also observed in the leaf
vascular tissues and in the roots of pas2 mutants and in leaves of
pas3 mutants (Fig. 4, D and
E).
View larger version (84K):
[in this window]
[in a new window]
|
Figure 4. Expression of cytokinin-associated markers in pas mutants. (A)
ARR5::GUS expression in a 15 d after germination wild-type seedling
with an enlarged view of the corresponding meristematic zone in the insert.
(B) ARR5::GUS expression in a 15 d after germination wild-type
seedling treated for 2 h with 10 µM BA. An enlarged view of the
corresponding meristematic zone is shown in the insert. (C) ARR5::GUS
expression 15 d after germination in pas1 seedlings treated with 10
µM BA (right) compared with control (left). (D)
ARR5::GUS expression 15 d after germination in pas2
seedlings treated with 10 µM BA (right) compared with control
(left). (E) ARR5::GUS expression 15 d after germination in
pas3 seedlings treated with 10 µM BA (right) compared
with control (left). (F) CYCD3::GUS expression 15 d after germination
in wild-type seedlings grown in the presence of 5 µM BA (right)
compared with control (left). (G) CYCD3::GUS expression in wild-type
(left) and pas1 (right) seedlings 15 d after germination. (H)
CYCD3::GUS expression in pas2 mutant. (I)
CYCD3::GUS expression in pas3-1 mutant. Scale bar represents
1 mm.
|
|
Cyclin D3.1 (CYCD3) Expression Is Not Enhanced in
pas Mutants
Our results indicated that in the pas mutants, differentiated
cells of the cotyledons or the hypocotyl were more competent for cell
division. Moreover, we found that cytokinin primary responses were enhanced,
suggesting that the PAS genes might control cell cycle regulation by
cytokinins. CYCD3 is one of the most well-characterized cell cycle
genes regulated by cytokinins. Constitutive expression of CYCD3 in
transgenic plants led to cell proliferation in the absence of exogenous
cytokinins (Riou-Khamlichi et al.,
1999). In wild-type seedlings, CYCD3 expression levels
showed an almost 2-fold induction after cytokinin treatment
(Fig. 5). CYCD3
expression after cytokinin induction was slightly higher in the pas2
mutant and lower in pas1 and pas3 mutants compared with wild
type. To confirm this result, CYCD3 expression was analyzed in planta
using a CYCD3::GUS marker in wild-type and pas mutants. In
wild type, CYCD3 was mainly expressed in the apical meristem, leaf
primordia, young leaves, and hydrathodes of older leaves
(Fig. 4, F and G).
Heterogeneous and weak staining was usually observed in pas mutants
(Fig. 4, G-I). Some seedlings
expressed CYCD3 with a similar pattern to that of wild type, whereas
most others showed no staining in apical meristems and leaf primordia but very
localized foci of expression. Some stainings were localized in structures
similar to the wild-type hydrathodes (Fig.
4G), whereas others were found in leaf cells clusters as for
CYCB1::GUS staining (Fig. 4, H and
I). CYCD3::GUS staining confirmed that CYCD3 was
not overexpressed in pas mutants. CYCD3::GUS staining was
maintained in mutant root meristems (data not shown), probably explaining why
pas2 showed higher CYCD3 expression than other pas
mutants in northern experiments because pas2 has an increased numbers
of secondary root (Faure et al.,
1998).
View larger version (42K):
[in this window]
[in a new window]
|
Figure 5. Cytokinin regulation of CYCD3 expression in pas mutants.
Steady-state mRNA levels of CYCD3 in wild-type and pas
mutants treated with 10 µM BA in liquid for 24 h. CYCD3
hybridization signals were quantified and normalized with eIF4A as
described in "Materials and Methods."
|
|
Auxin Induction of Primary Response Genes Is Reduced in pas
Mutants
Cell dedifferentiation and proliferation are usually induced by a balanced
auxin-to-cytokinin ratio. As pas mutants show an enhanced response to
cytokinins, we investigated whether auxin responses were also modified. Auxin
response was analyzed by the quantification of expression levels of primary
response genes rapidly induced by auxin. We chose indole-3-acetic
acid4 (IAA4) and IAA1 because they present a robust
auxin regulation and they are among the few IAA genes expressed in
shoot tissues (Abel et al.,
1995).
The IAA4 mRNA level was rapidly increased in wild-type seedlings,
five and 10 times, respectively, after 15 min and 3 h of auxin treatment
(Fig. 6A). IAA4 mRNA
basal levels were found to be lower in the three pas mutants compared
with wild type. Auxin induction of IAA4 was nonetheless observed in
pas mutants, but with a lower magnitude (10, 7, 3, and 6 times for
wild type, pas1, pas2, and pas3, respectively, relative to
noninduced levels after 3 h of treatment). A similar pattern of expression was
also observed for IAA1 with lower mRNA levels in the pas
mutants (Fig. 6B). After a
15-min induction, IAA1 levels were induced 82-, 62-, 49-, and 68-fold
in wild type, pas1, pas2, and pas3, respectively. These
results suggest that the expression of primary auxin response genes is also
modified in the pas mutants.
View larger version (36K):
[in this window]
[in a new window]
|
Figure 6. Auxin regulation of IAA4 and IAA1 gene expression in
pas mutants. (A) Time-course analysis of steady-state IAA4
mRNA levels in wild-type and pas seedlings. (B) Time-course analysis
of steady-state IAA1 mRNA levels in wild-type seedlings. Seedlings
were transferred to liquid media 12 d after germination for 2 d and were
treated with 20 µM IAA for the time indicated. IAA
hybridization signals were quantified and normalized with EF-1
as described in "Materials and Methods."
|
|
|
DISCUSSION
|
|---|
The pas mutants are characterized by ectopic cell divisions, which
are specifically enhanced by cytokinins. They provide an interesting genetic
model to study hormonal regulation of cell differentiation and proliferation
in planta. Mutations in PAS genes resulted into developmental defects
that can be tracked back to the heart stage of embryogenesis during the
transition from radial to bilateral symmetry
(Faure et al., 1998).
In this study, we found that the disorganized cell divisions are associated
with the deregulation of cell cycle marker genes like CDKA and
CYCB1, suggesting that cells would be maintained in a state competent
for cell proliferation. Ectopic figures of division are probably responsible
for the increased layers of cells observed, for instance, in the cortex and
the epidermis of the hypocotyl (Faure et
al., 1998). Increased cell division competency in pas
mutants was particularly pronounced in already undifferentiated cells such as
meristematic cells as illustrated by the expression of the cell division
markers CDKA and CYCB1. Previous observations found that
pas apical meristems were often enlarged and presented a loose
structure where the different layers and zones were difficult to distinguish
(Faure et al., 1998).
Alteration of pas meristem structure is correlated with the
up-regulation of several KNAT genes. The loss of PAS
function leads to an enlarged KNAT2 expression zone comprising almost
the entire apical meristem, confirming that most of the pas meristem
are constituted by L3-like type cells. This enlarged KNAT2 expression
zone could be already seen in mature embryos, suggesting that an altered
expression of KNAT2 is an early effect of pas mutations.
Increased propensity for cell division caused by the loss of PAS
function is also illustrated by the suppression of strong stm
phenotype by pas2. Loss of STM function leads to improper
corpus/tunica organization in the embryo meristem and a functional meristem is
never organized after germination (Barton
and Poethig, 1993). STM loss of function could also be
suppressed by a mutation in ASYMMETRYC LEAVES 1 (AS1), which
is a negative regulator of KNAT genes. Secondary suppressor screen of
as1 stm double mutants revealed that KNAT1 was involved in
the restoration of meristem function in stm background
(Byrne et al., 2002).
Similarly, a mutation in YABBY that is associated with STM
and KNAT2 up-regulation led to partial suppression of stm
phenotype (Kumaran et al.,
2002). The suppression of STM dysfunction by pas
mutations could be explained by the up-regulation of several KNAT
genes and by the fact that there is some functional redundancy among the
KNAT family members.
Several reports linked cytokinins to the expression of meristematic
homeobox transcription factors (Rupp et
al., 1999; Hamant et al.,
2002). The KNAT2 expression zone in cytokinin-treated
wild type was enlarged as in pas mutants, suggesting that the
deregulated KNOX expression in pas mutants could be related
to an altered cytokinin response. Several other characteristics of
pas phenotype suggest a defect in cytokinin responses. Earlier work
has shown that, associated with their cytokinin-enhanced cell proliferation,
pas mutants have two-dimensional protein profiles reminiscent to
cytokinin-treated wild-type (Faure et al.,
1998). The three pas mutants also show significant delay
of senescence (Y. Harrar, unpublished data). Finally, pas2 seedlings
exhibited ectopic shoot formation, which is a phenotype observed in
cytokinin-overproducing plants or cytokinin-treated callus
(Bellec et al., 2002).
Cytokinin primary response of the pas mutants was enhanced as
illustrated by the expression pattern of two A-type ARRs. The
response of the pas mutants to cytokinins may be caused by the
increased size or number of meristems in the mutants because ARR5 was
mainly expressed in the meristem. However, this seems unlikely because
differences in tissue expression have not been correlated with the level of
cytokinin response. Although ARR5 is mainly expressed in the
meristems and the vascular tissue, the RNA levels after cytokinin induction
are higher in leaves and stems than in buds and young flowers
(Brandstatter and Kieber,
1998). Furthermore, ARR6 that is expressed in most
tissues shows the strongest induction in leaves and not in buds
(D'Agostino et al., 2000).
Moreover, a higher number of responsive cells, as in pas meristems of
the pas mutants, would lead to increased expression levels but with
kinetics similar to that of the wild type. On the contrary, pas
mutants show not only an increased amplitude of ARR gene expression, but also
a delay in returning to basal levels. The modification of the amplitude of
ARR5 and ARR6 expression but not the timing of the maximum
cytokinin response suggests that the pas response to cytokinins could
not only be explained by an higher number of responsive cells. The transient
cytokinin induction of A-type ARRs is explained by the existence of a negative
feedback regulatory loop in which the A-type ARR genes repress their
own expression (Hwang and Sheen,
2001). The enhanced cytokinin response in pas mutants was
also associated with a prolonged ARR expression. Such an expression
pattern could not simply be the consequence of an increased amplitude of
ARRs expression because pas3 showed wild-type levels of
ARR5 induction, but its expression was nonetheless maintained after a
1-h induction. The proposed model for the maintenance of A-type ARR
expression after cytokinin induction in the pas mutants would be that
PAS genes are required for the A-type ARR negative
regulatory feedback loop.
As in A-type ARRs, CYCD3 is also inducible by cytokinins and thus
provides a valuable marker for cytokinin involvement in cell cycle regulation
(Soni et al., 1995;
Fuerst et al., 1996).
Surprisingly, its expression was not enhanced in the pas or
tsd mutants (Frank et al.,
2002). The absence of CYCD3 overexpression in the six
known classes of mutants with tumorous development suggests that in contrast
to mammals in which CYCD altered expression is very often associated
with cancer (Prober and Edgar,
2001), plant CYCD3 deregulation is not the main cause of
cytokinin-driven tumor development.
Cell dedifferentiation and proliferation is usually caused by a balanced
ratio of cytokinins and auxin. Callus-like development of pas
seedlings in the presence of cytokinins was not found to be caused by a
parallel increased of auxin sensitivity as judged by the phenotypic analysis
of auxin-treated seedlings (Faure et al.,
1998). Typical auxin responses such as secondary root formation in
light-grown seedlings or hypocotyl peeling in dark-grown seedlings can be
observed in pas mutants when exposed to auxin
(Faure et al., 1998; C.
Bellini, unpublished data). Auxin treatment could not compensate for
pas apical phenotypes nor could it induce callus-like development in
seedlings. The reduced induction of the early auxin-induced genes
IAA4 and IAA1 suggests that the pas mutants have a
reduced primary response to auxin. As several IAA genes have been
involved as negative regulators of auxin response, a decreased induction of
IAA genes in pas mutants could also be interpreted as an
adaptive response to an enhanced cytokinin response by increasing auxin
sensitivity (Tiwari et al.,
2001; Park et al.,
2002). The opposite case was illustrated for axr3 mutant,
which showed an increased auxin sensitivity and where an exogenous supply of
cytokinins was able to complement many aspects of the mutant phenotype,
demonstrating that increased cytokinin levels can compensate, to a certain
degree, an increase in auxin sensitivity
(Leyser et al., 1996).
Altogether, PAS genes appear as negative regulators of cell
proliferation by repressing cell division or by inducing cell differentiation.
The negative regulation of KNAT expression by PAS genes is
probably involved in maintaining cells in a differentiated state, avoiding
uncontrolled cell proliferation and tumor development. Competency for cell
division is dependent on the cell response to cytokinins and auxin.
PAS genes controlled the amplitude of cytokinin and auxin responses
and thus represent new regulators linking hormone response to the control of
cell division and differentiation. The elucidation of the biochemical function
of PAS proteins and their corresponding protein networks should shed light on
the mechanisms of hormonal control of cell proliferation and
differentiation.
|
MATERIALS AND METHODS
|
|---|
Plant Material and Hormone Treatment
The pas mutants were isolated from an ethyl methane
sulfonatemutagenized population of the Columbia ecotype (Col-0;
Faure et al., 1998). Seeds
were sterilized and grown in vitro as described previously
(Santoni et al., 1994) in a
controlled environment chamber (irradiance 200 µE
m2–2 s–1,
16 h of light, 60% humidity, 20°C day temperature, and 15°C night
temperature). Mutant lines expressing GUS were produced by crossing
wild-type lines expressing the GUS marker with the mutant lines.
Three different progeny lines were tested in GUS staining to avoid
background effect on GUS expression. pas2/pas2; stm/stm
double mutants were obtained by selfing of the progeny of the
pas2/pas2 x stm dgh6/+
(Aida et al., 2002) cross and
were genotyped with stm primers
(GAGACAGCAATTGATAGGAACAAT/ATGGTG-GAGGAGATGTGATCC).
For RNA analysis, mutant and wild-type plants were grown in vitro for 12 d
and were then transferred to liquid Arabidopsis medium. After 2 d in liquid
culture to avoid stress effects, culture medium was supplemented with 10
µM BA or 20 µM IAA for treated plants and dimethyl
sulfoxide or ethanol, respectively, for control plants. Plants were harvested
and stored in liquid nitrogen after different times of hormone induction
before RNA extraction.
For GUS analysis, plants were grown for 10 to 15 d with or without 0.1
µM BA. A short 2-h induction was performed in liquid medium for
ARR5::GUS-containing plants.
RNA Methods
Total RNA was extracted from seedlings as described previously
(Verwoerd et al., 1989).
Approximately 20 µg of RNA was separated in a denaturing 1.5% (w/v)
agarose-formaldehyde gel and then transferred to GeneScreen (NEN Life Science
Products, Boston) nylon membranes. Northern hybridization was performed in
church buffer at 65°C with probes obtained by PCR: EF-1
(CATTTGGCACCCTTCTTCAC, CCACGAGTCTGTTCTTGAGGC), or by enzymatic digestion of
plasmids: ARR5, ARR6, CYCD3, IAA1, and
IAA4. Blots were washed at 55°C in 2x SSC, 0.2% (w/v)
tetra-sodium diphosphate, and 0.5% (w/v) SDS, and were exposed to an Imaging
Plate (FUJI, Tokyo) or to film (Eastman-Kodak, Rochester, NY). Quantification
was performed with a phosphorimager (BAS 1500; FUJI), which has a higher
sensitivity and a broader linear range of measurement. As the quality of
images was not as good as x-ray films, each blot was also exposed to film
(Eastman-Kodak) and the corresponding image was used for the illustration.
Hybridization signals from different samples in a blot were normalized with
EF-1 A4 (Liboz et
al., 1989) or eIF4A
(Metz et al., 1992). To
compare samples from different blots, a wild-type Col-0 control sample was
loaded in each blot. Northern experiments were performed at least twice with
independent plant samples.
RT-PCR Methods
RTs were performed from total mRNA or poly(A) mRNA after DNase treatment,
using superscript II enzyme (Qiagen, Valencia, CA) according to standard
protocol. Poly(A) mRNA was obtained from total mRNA using the oligotex mRNA
Mini kit (Qiagen). RTs were tested and normalized with
EF-1A4 primers. Each PCR was done on the same
quantity of cDNA according to EF-1 A4 amplification
product intensity. For each gene tested by RT-PCR, EF-1
A4 amplification was done from the same mix as an internal
control. PCRs were performed using STM (CTTATGTCAATTGTCAGAAGG,
ATGGTGGAGGAGATGTGATCC), KNAT1 (TTCTTCTCTTCCATGTCACTTC,
CTGTTGTCATGCTGGTATTCTT), KNAT2 (CTTTTGTGTTTCTTCATATTCT,
CGATTTTGGATTTGATGACACT), and KNAT6 (GATAAGTCGGTTCTGATGATG,
TATCTTATCTCCTTCAGTAGGGT) primers. PCR programs were chosen for each gene to
recover PCR products during the exponential phase. RT-PCRs were done several
times on two or three independent experiments.
Real-time PCR was done using STM (AGAGAATAGGCAGGAGCACAA,
TGATGGTCCGATGTGTCCTATG), EF-1A4
(CGAAGGGTGGTGAAAGCAAGA, CTGGAGGTTTTGAGGCTGGTAT) primers. The PCR efficiency
calculated for each couple of primers was similar, allowing us to express
STM mRNA quantity as a percentage of EF-1A4
mRNA quantity.
GUS Staining
Histochemical analysis of the GUS reporter enzyme was performed as
described previously (Molier et al.,
1995). Sample tissues were fixed in 80% (w/v) ice-cold acetone for
10 min, washed three times with water, and placed under vacuum to increase the
penetration of reaction buffer into the tissue. Samples were incubated at
37°C for 1 to 16 h in reaction buffer. Staining time was 1, 16, 16, 3, 1,
and 16 h for CDKA::GUS, CYCB1::GUS, CYCB1::db::GUS
KNAT2::GUS, ARR5::GUS, and CYCD3::GUS transgenic lines,
respectively. Plant samples were destained in 70% (w/v) ethanol before
observation. GUS fluorometric assay was performed as described by Elmayan et
al. (1996) on 9 µg of total protein.
|
ACKNOWLEDGMENTS
|
|---|
We thank Dirk Inzé (University of Gent, Gent, Belgium) for
CDKA::GUS and CYCB1::GUS lines, Joe Kieber (University of
North Carolina, Chapel Hill, NC) for ARR5 and ARR6 cDNAs and
the ARR5::GUS transgenic line, Athanasios Theologis (Plant Gene
Expression Center, Albany, NY) for IAA4 and IAA1 cDNAs, John
Murray (University of Cambridge, Cambridge, UK) for the CYCD3::GUS
transgenic line, and Véronique Pautot and Olivier Hamant (Institut
National de la Recherche Agronomique, Versailles, France) for
KNAT2::GUS transgenic line and the different KNAT
oligonucleotides. We would also like to thank Céline Sorin and
Hervé Vaucheret for their technical help.
Received December 11, 2002;
returned for revision February 9, 2003;
accepted March 7, 2003.
|
FOOTNOTES
|
|---|
Article, publication date, and citation information can be found at
www.plantphysiol.org/cgi/doi/10.1104/pp.102.019026.
*
Corresponding author; e-mail
faure{at}versailles.inra.fr;
fax 33-1-30-83-30-99.
|
LITERATURE CITED
|
|---|
Abel S, Nguyen MD, Theologis A (1995) The
PS-IAA4/5-like family of early auxin-inducible mRNAs in
Arabidopsis thaliana. J Mol Biol
251:
533-549[CrossRef][Web of Science][Medline]
Aida M, Vernoux T, Furutani M, Traas J, Tasaka M
(2002). Roles of PIN-FORMED1 and MONOPTEROS in pattern formation
of the apical region of the Arabidopsis embryo. Development
129:
3965-3974[Abstract/Free Full Text]
Banno H, Ikeda Y, Niu QW, Chua NH (2001)
Overexpression of Arabidopsis ESR1 induces initiation of shoot
regeneration. Plant Cell 13:
2609-2618[Abstract/Free Full Text]
Barton MK, Poethig RS (1993). Formation of the
shoot apical meristem in Arabidopsis thaliana: an analysis of
development in the wild-type and in the shoot meristemless mutant.
Development 119:
823-831[Abstract/Free Full Text]
Bellec Y, Harrar Y, Bréard C, Darnet D, Bellini C, Faure
JD (2002) PASTICCINO2 is a protein tyrosine
phosphatase-like involved in cell proliferation and differentiation in
Arabidopsis. Plant J 32:
713-722[CrossRef][Web of Science][Medline]
Brandstatter I, Kieber JJ (1998) Two genes with
similarity to bacterial response regulators are rapidly and specifically
induced by cytokinin in Arabidopsis. Plant Cell
10:
1009-1019[Abstract/Free Full Text]
Byrne ME, Simorowski J, Martienssen RA (2002).
ASYMMETRIC LEAVES1 reveals knox gene redundancy in Arabidopsis.
Development 129:
1957-1965
Cary A, Uttamchandani SJ, Smets R, Van Onckelen HA, Howell
SH (2001) Arabidopsis mutants with increased organ
regeneration in tissue culture are more competent to respond to hormonal
signals. Planta 213:
700-707[CrossRef][Web of Science][Medline]
Chuck G, Lincoln C, Hake S (1996)
KNAT1 induces lobed leaves with ectopic meristems when overexpressed
in Arabidopsis. Plant Cell 8:
1277-1289[Abstract]
D'Agostino IB, Deruere J, Kieber JJ (2000)
Characterization of the response of the Arabidopsis response regulator gene
family to cytokinin. Plant Physiol
124:
1706-1717[Abstract/Free Full Text]
Dockx J, Quaedvlieg N, Keultjes G, Kock P, Weisbeek P, Smeekens
S (1995). The homeobox gene ATK1 of Arabidopsis
thaliana is expressed in the shoot apex of the seedling and in flowers
and inflorescence stems of mature plants. Plant Mol Biol
28: 723-737[CrossRef][Web of Science][Medline]
Elmayan T, Vaucheret H (1996) Expression of
single copies of a strongly expressed 35S transgene can be silenced
post-transcriptionally. Plant J
9: 787-797[CrossRef][Web of Science]
Faure JD, Vittorioso P, Santoni V, Fraisier V, Prinsen E,
Barlier I, Van Onckelen H, Caboche M, Bellini C (1998)
The PASTICCINO genes of Arabidopsis thaliana are involved in
the control of cell division and differentiation. Development
125:
909-918[Abstract]
Ferreira PC, Hemerly AS, Engler JD, van Montagu M, Engler G,
Inze D (1994) Developmental expression of the Arabidopsis
cyclin gene cyc1At. Plant Cell
6:
1763-1774[Abstract/Free Full Text]
Frank M, Guivarc'h, A., Krupkova E, Lorenz-Meyer I, Chriqui,
D. Schmülling T (2002) TUMOROUS SHOOT
DEVELOPMENT (TSD) genes are required for coordinated plant shoot
development. Plant J 29:
73-85[CrossRef][Web of Science][Medline]
Frank M, Rupp HM, Prinsen E, Motyka V, Van Onckelen H,
Schmulling T (2000) Hormone autotrophic growth and
differentiation identifies mutant lines of Arabidopsis with altered cytokinin
and auxin content or signaling. Plant Physiol
122:
721-729[Abstract/Free Full Text]
Frugis G, Giannino D, Mele G, Nicolodi C, Chiappetta A, Bitonti
MB, Innocenti AM, Dewitte W, Van Onckelen H, Mariotti D
(2001) Overexpression of KNAT1 in lettuce shifts leaf
determinate growth to a shoot-like indeterminate growth associated with an
accumulation of isopentenyl-type cytokinins. Plant Physiol
126:
1370-1380[Abstract/Free Full Text]
Fuerst RA, Soni R, Murray JA, Lindsey K (1996)
Modulation of cyclin transcript levels in cultured cells of Arabidopsis
thaliana. Plant Physiol 112:
1023-1033[Abstract]
Haberer G, Kieber JJ (2002) Cytokinins: new
insights into a classic phytohormone. Plant Physiol
128:
354-362[Free Full Text]
Hamant O, Nogué F, Belles-Boix E, Jublot D, Grandjean O,
Traas J, Pautot V (2002) The KNAT2
homeodomain protein interacts with ethylene and cytokinin signalling.
Plant Physiol 130:
657-665[Abstract/Free Full Text]
Harrar Y, Bellini C, Faure JD (2001) FKBPs: at
the crossroads of folding and transduction. Trends Plant Sci
6: 426-431[CrossRef][Web of Science][Medline]
Hemerly AS, Ferreira P, de Almeida Engler J, Van Montagu M,
Engler G, Inze D (1993) CDKAa expression in
Arabidopsis is linked with competence for cell division. Plant
Cell 5:
1711-1723[Abstract]
Hewelt A, Prinsen E, Thomas M, Van Onckelen H, Meins F Jr
(2000) Ectopic expression of maize knotted1 results in the
cytokinin-autotrophic growth of cultured tobacco tissues.
Planta 210:
884-889[CrossRef][Web of Science][Medline]
Hwang I, Sheen J (2001) Two-component circuitry
in Arabidopsis cytokinin signal transduction. Nature
413:
383-389[CrossRef][Medline]
Imamura A, Hanaki N, Nakamura A, Suzuki T, Taniguchi M, Kiba
T, Ueguchi C, Sugiyama T, Mizuno T (1999) Compilation
and characterization of Arabidopsis thaliana response regulators
implicated in His-Asp phosphorelay signal transduction. Plant Cell
Physiol 40:
733-742[Abstract/Free Full Text]
Inoue T, Higuchi M, Hashimoto Y, Seki M, Kobayashi M, Kato T,
Tabata S, Shinozaki K, Kakimoto T (2001)
Identification of CRE1 as a cytokinin receptor from Arabidopsis.
Nature 409:
1060-1063[CrossRef][Medline]
Kakimoto T (1996) CKI1, a histidine
kinase homolog implicated in cytokinin signal transduction.
Science 274:
982-985[Abstract/Free Full Text]
Kiba T, Taniguchi M, Imamura A, Ueguchi C, Mizuno T, Sugiyama
T (1999) Differential expression of genes for response
regulators in response to cytokinins and nitrate in Arabidopsis
thaliana. Plant Cell Physiol
40: 767-771[Abstract/Free Full Text]
Kubo M, Kakimoto T (2000) The
cytokinin-hypersensitive genes of Arabidopsis negatively regulate the
cytokinin-signaling pathway for cell division and chloroplast development.
Plant J 23:
385-394[CrossRef][Web of Science][Medline]
Kumaran MK, Bowman JL, Sundaresan V (2002).
YABBY polarity genes mediate the repression of KNOX homeobox genes in
Arabidopsis. Plant Cell 14:
2761-2770[Abstract/Free Full Text]
Leyser HM, Pickett FB, Dharmasiri S, Estelle M
(1996) Mutations in the AXR3 gene of Arabidopsis result
in altered auxin response including ectopic expression from the
SAUR-AC1 promoter. Plant J
10: 403-413[CrossRef][Web of Science][Medline]
Liboz T, Bardet C, Le Van Thai A, Axelos M, Lescure B
(1989) The four members of the gene family encoding the
Arabidopsis thaliana translation elongation factor
EF-1 are actively transcribed. Plant Mol Biol
14: 107-110
Lohrmann J, Harter K (2002) Plant two-component
signaling systems and the role of response regulators. Plant
Physiol 128:
363-369[Free Full Text]
Metz AM, Timmer RT, Browning KS (1992)
Sequences for two cDNAs encoding Arabidopsis thaliana eukaryotic
protein synthesis initiation factor 4A. Gene
120:
313-314[CrossRef][Web of Science][Medline]
Molier P, Montoro P, Delarue M, Bechtold N, Bellini C, Pelletier
G (1995) Promoterless gusA expression in a large
number of Arabidopsis thaliana transformants obtained by the in
planta infiltration method. C R Acad Sci Paris
318:
465-474
Park JY, Kim HJ, Kim J (2002). Mutation in
domain II of IAA1 confers diverse auxin-related phenotypes and represses
auxin-activated expression of Aux/IAA genes in steroid
regulator-inducible system. Plant J
32: 669-683[CrossRef][Web of Science][Medline]
Prober DA, Edgar BA (2001) Growth regulation by
oncogenes: new insights from model organisms. Curr Opin Genet
Dev 11:
19-26[CrossRef][Web of Science][Medline]
Riou-Khamlichi C, Huntley R, Jacqmard A, Murray JA
(1999) Cytokinin activation of Arabidopsis cell division through
a D-type cyclin. Science 283:
1541-1544[Abstract/Free Full Text]
Rupp HM, Frank M, Werner T, Strnad M, Schmulling T
(1999) Increased steady-state mRNA levels of the STM and
KNAT1 homeobox genes in cytokinin overproducing Arabidopsis
thaliana indicate a role for cytokinins in the shoot apical meristem.
Plant J 18:
557-563[CrossRef][Web of Science][Medline]
Rutherford SL, Zuker CS (1994) Protein folding
and the regulation of signaling pathways. Cell
79:
1129-1132[CrossRef][Medline]
Sakai H, Honma T, Aoyama T, Sato S, Kato T, Tabata S, Oka A
(2001) ARR1, a transcription factor for genes
immediately responsive to cytokinins. Science
294:
1519-1521[Abstract/Free Full Text]
Santoni V, Bellini C, Caboche M (1994) Use of
two-dimensional electrophoresis protein-pattern analysis for the
characterization of Arabidopsis thaliana mutants.
Planta 192:
557-566[CrossRef][Web of Science]
Schmulling T (2002) New insights into the
functions of cytokinins in plant development. J Plant Growth
Regul 21:
40-49[Medline]
Soni R, Carmichael JP, Shah ZH, Murray JA
(1995) A family of cyclin D homologs from plants differentially
controlled by growth regulators and containing the conserved retinoblastoma
protein interaction motif. Plant Cell
7: 85-103[Abstract]
Tiwari SB, Wang XJ, Hagen G, Guilfoyle TJ
(2001) AUX/IAA proteins are active repressors, and their
stability and activity are modulated by auxin. Plant Cell
13:
2809-2822[Abstract/Free Full Text]
Verwoerd TC, Dekker BM, Hoekema A (1989) A
small-scale procedure for the rapid isolation of plant RNAs. Nucleic
Acids Res 17:
2362[Free Full Text]
Vittorioso P, Cowling R, Faure JD, Caboche M, Bellini C
(1998) Mutation in the Arabidopsis PASTICCINO1 gene,
which encodes a new FK506-binding protein-like protein, has a dramatic effect
on plant development. Mol Cell Biol
18:
3034-3043[Abstract/Free Full Text]
Weigel D, Jurgens G (2002) Stem cells that make
stems. Nature 415:
751-754.[Medline]
This article has been cited by other articles:
|
|
|
|
 
L. Bach, L. V. Michaelson, R. Haslam, Y. Bellec, L. Gissot, J. Marion, M. Da Costa, J.-P. Boutin, M. Miquel, F. Tellier, et al.
The very-long-chain hydroxy fatty acyl-CoA dehydratase PASTICCINO2 is essential and limiting for plant development
PNAS,
September 23, 2008;
105(38):
14727 - 14731.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Lee, H.-S. Lee, J.-S. Lee, S.-K. Kim, and S.-H. Kim
Hormone- and light-regulated nucleocytoplasmic transport in plants: current status
J. Exp. Bot.,
September 1, 2008;
59(12):
3229 - 3245.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. U. Andersen, S. Buechel, Z. Zhao, K. Ljung, O. Novak, W. Busch, C. Schuster, and J. U. Lohmann
Requirement of B2-Type Cyclin-Dependent Kinases for Meristem Integrity in Arabidopsis thaliana
PLANT CELL,
January 1, 2008;
20(1):
88 - 100.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Smyczynski, F. Roudier, L. Gissot, E. Vaillant, O. Grandjean, H. Morin, T. Masson, Y. Bellec, D. Geelen, and J.-D. Faure
The C Terminus of the Immunophilin PASTICCINO1 Is Required for Plant Development and for Interaction with a NAC-like Transcription Factor
J. Biol. Chem.,
September 1, 2006;
281(35):
25475 - 25484.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Da Costa, L. Bach, I. Landrieu, Y. Bellec, O. Catrice, S. Brown, L. De Veylder, G. Lippens, D. Inze, and J.-D. Faure
Arabidopsis PASTICCINO2 Is an Antiphosphatase Involved in Regulation of Cyclin-Dependent Kinase A
PLANT CELL,
June 1, 2006;
18(6):
1426 - 1437.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Tantikanjana, M. D. Mikkelsen, M. Hussain, B. A. Halkier, and V. Sundaresan
Functional Analysis of the Tandem-Duplicated P450 Genes SPS/BUS/CYP79F1 and CYP79F2 in Glucosinolate Biosynthesis and Plant Development by Ds Transposition-Generated Double Mutants
Plant Physiology,
June 1, 2004;
135(2):
840 - 848.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
RESULTS