First published online June 12, 2003; 10.1104/pp.103.020560
Plant Physiology 132:1353-1361 (2003)
© 2003 American Society of Plant Biologists
CELL BIOLOGY AND SIGNAL TRANSDUCTION
Plants Do It Differently. A New Basis for Potassium/Sodium Selectivity in the Pore of an Ion Channel1
Bao-Guang Hua2,
Richard W. Mercier,
Qiang Leng3 and
Gerald A. Berkowitz*
Agricultural Biotechnology Laboratory, Department of Plant Science, 1390
Storrs Road U4163, University of Connecticut, Storrs, Connecticut
062694163
 |
ABSTRACT
|
|---|
Understanding of the molecular architecture necessary for selective
K+ permeation through the pore of ion channels is based primarily
on analysis of the crystal structure of the bacterial K+ channel
KcsA, and structure:function studies of cloned animal K+ channels.
Little is known about the conduction properties of a large family of plant
proteins with structural similarities to cloned animal cyclic nucleotide-gated
channels (CNGCs). Animal CNGCs are nonselective cation channels that do not
discriminate between Na+ and K+ permeation. These
channels all have the same triplet of amino acids in the channel pore ion
selectivity filter, and this sequence is different from that of the
selectivity filter found in K+-selective channels. Plant CNGCs have
unique pore selectivity filters; unlike those found in any other family of
channels. At present, the significance of the unique pore selectivity filters
of plant CNGCs, with regard to discrimination between Na+ and
K+ permeation is unresolved. Here, we present an
electrophysiological analysis of several members of this protein family;
identifying the first cloned plant channel (AtCNGC1) that conducts
Na+. Another member of this ion channel family (AtCNGC2) is shown
to have a selectivity filter that provides a heretofore unknown molecular
basis for discrimination between K+ and Na+ permeation.
Specific amino acids within the AtCNGC2 pore selectivity filter (Asn-416,
Asp-417) are demonstrated to facilitate K+ over Na+
conductance. The selectivity filter of AtCNGC2 represents an alternative
mechanism to the well-known GYG amino acid triplet of K+ channels
that has been identified as the critical basis for K+ over
Na+ permeation through the pore of ion channels.
Crop productivity on about one-third of the world's arable land is limited
by high soil salinity (Epstein et al.,
1980 ). Current cultural practices on irrigated cropland will only
add to this problem; up to 107 ha
year1 must be abandoned due to
irrigation-associated rhizo-sphere Na+ accumulation
(Flowers and Yeo, 1995 ). Our
ability to deal with this vexing problem is currently limited by our lack of
understanding, at the molecular level, of Na+ transport mechanisms
in plants, and Na+/K+ discrimination by the ion channels
that facilitate low affinity (i.e. at high soil Na+) uptake of
Na+ into plants.
Complete sequencing of the Arabidopsis genome has led to new insights into
the many families of cation transporters in plants
(Maser et al., 2001 ). However,
no Na+-selective channel has been identified to date in plants; the
plant (Arabidopsis) genome contains no nucleotide sequence with significant
homology to the (tetrodotoxin-sensitive) Na+ channel of animals
(Catterall, 2000 ) or to the
recently characterized dihydropyridine-sensitive Na+ channel
(Ren et al., 2001 ) of
prokaryotes. Current work suggests that Na+ influx (and toxicity)
in major crop plants such as corn (Zea mays), barley (Hordeum
vulgare), and wheat (Triticum aestivum) may be mediated, in
part, by uptake through (voltage-independent) nonselective cation channels
(Tyerman and Skerrett, 1999 ;
Davenport and Tester, 2000 ;
Demidchik et al., 2002 ).
However, no cloned plant channel has yet been demonstrated to mediate inward
Na+ currents. Molecular candidates for this ion uptake pathway
could be some members of the recently cloned family of plant proteins that are
homologous to animal cyclic nucleotide-gated channels (CNGCs).
Animal CNGCs are nonselective cation channels that are activated
(allosterically) by cyclic nucleotides (activation by cyclic nucleotides is
blocked by calmodulin; Molday,
1996 ). Animal CNGCs are only weakly voltage-gated (at saturating
cyclic nucleotide, the I/V relationship is nearly linear;
Zagotta and Siegelbaum, 1996 ).
Animal CNGCs have nearly identical permeability and conductance profiles for
Na+ and K+ (Gamel
and Torre, 2000 ). Twenty different nucleotide sequences encoding
putative CNGCs have been identified in Arabidopsis
(Maser et al., 2001 );
orthologs of some of these putative channels have been cloned from crop plants
(Schuurink et al., 1998 ;
Maser et al., 2001 ). Members
of this family of plant proteins bind to calmodulin
(Schuurink et al., 1998 ;
Arazi et al., 2000 ;
Köhler and Neuhaus,
2000 ). Plant CNGCs are expressed in roots, where they have been
demonstrated to affect cation uptake into plants
(Sunkar et al., 2000 ;
White et al., 2002 , and refs.
therein).
Not much is known about the ion selectivity profiles of plant CNGCs. We
have shown that upon expression in Xenopus laevis oocytes, the
Arabidopsis channels AtCNGC1 and -2, and the tobacco channel NtCBP4
demonstrate inwardly rectifying, noninactivating cAMP-dependent K+
currents (Leng et al., 1999 ,
2002 ). Interestingly, in
contrast to all animal CNGCs (Flynn et
al., 2001 ), AtCNGC2 was found not to appreciably conduct
Na+ (Leng et al.,
2002 ). In the work reported here, we extend this observation with
protein structural modeling and experimental evaluation of the molecular basis
for K+/Na+ discrimination by this plant channel.
 |
RESULTS AND DISCUSSION
|
|---|
Structural Modeling of Plant CNGC Pore Regions
Sequence analysis suggests that animal
(Flynn et al., 2001 ) and plant
(Köhler et al., 1999 )
CNGC monomers retain many of the structural motifs common to the large
superfamily of "P-loop" channel proteins that also includes
voltage-gated K+-selective channels. K+-selective
channels and CNGCs have six membrane-spanning regions (S1S6) and a
P-loop region. The P-loop region of K+-selective and cyclic
nucleotide-gated nonselective cation channels is comprised of the S5 and S6
transmembrane segments and a pore region, or P-loop. We investigated the
structure of the plant CNGC pore region by generating a three-dimensional
computational model of the P-loop region of AtCNGC1 and AtCNGC2. Query
sequences corresponding to the deduced AtCNGC1 and AtCNGC2 P-loop regions were
submitted to a database of known protein crystal structures, identifying the
crystal structure of the Streptomyces lividans K+ channel
KcsA as the most appropriate modeling template. These three-dimensional models
of the plant CNGC pore regions are shown superimposed on the KcsA pore in
Figure 1, A and B. This
modeling indicates that the best prediction of the plant CNGC pore structure
has the P-loop dipping into the membrane from the extracellular surface as an
-helix (pore helix) and exiting back extracellularly as an uncoiled
strand. The region of the channel forming this P-loop then forms another
-helix that traverses the membrane (i.e. the S6 transmembrane region)
back toward the cell interior from the extracellular side of the membrane.
Within the pore region of K+ channels such as KcsA, the amino acids
in the uncoiled strand immediately C-terminal to the P-loop -helix and
upstream from the S6 transmembrane segment form the selectivity filter
(Heginbotham et al.,
1994 ).

View larger version (49K):
[in this window]
[in a new window]
|
Figure 1. Model of the P-loop region of the plant CNGCs AtCNGC1 and AtCNGC2. A,
Modeled AtCNGC1 P-loop region (corresponding to the sequence shown in
Fig. 2) superimposed on the
KcsA structure. KcsA is shown in green and AtCNGC1 in blue. B, Modeled AtCNGC2
P-loop region superimposed on the KcsA structure; color scheme is as in A.
Core amino acids of the selectivity filters are displayed in wireframe format,
colored in CPK, and annotated using single-letter abbreviations, the remaining
structures are shown as ribbons. The amino acids K354 and
K399 (identified in figure), are at the N terminus of the section
of P-loop regions of AtCNGC1 and AtCNGC2 shown in this figure, respectively,
and are positioned at the extracellular side of the pore helix as it dips into
the membrane. This model predicts that the AtCNGC1 and AtCNGC2 polypeptides
exit the membrane as uncoiled strands, and then traverse the membrane (S6
transmembrane domain) back toward the cell interior as -helices with
the amino acids L407 (AtCNGC1) or L452 (AtCNGC2)
positioned at the intracellular end of the S6 transmembrane domain. Models
shown in A and B are tertiary structures of single AtCNGC subunit
polypeptides. C, Persistence of vision ray tracer image of the modeled
quaternary structure of the P-loop regions of a tetrameric AtCNGC2 channel
protein. An AtCNGC2 tetrameric sequence was threaded through the quaternary
structure of the KcsA tetramer crystal structure to generate this model. This
model indicates that four AtCNGC2 monomers are capable of forming a channel
complex with the four subunits positioned such that the P-loop selectivity
filters of each subunit align perpendicular to the membrane, forming the ion
conduction pathway. This structure is presented with the top of the image
corresponding to the extracellular side of channel protein.
|
|

View larger version (86K):
[in this window]
[in a new window]
|
Figure 2. Clustal alignment of the putative P-loop region of plant CNGCs with the
corresponding region of the S. lividans K+
channel KcsA, the plant K+ channels AKT1 and KAT1, and the animal
CNGCs BOLF and BRET. Arabidopsis CNGC (AtCNGC120) sequences were
generated from the Munich Information Center for Protein Sequences Arabidopsis
Database; accession numbers can be found in Maser et al.
(2001 ). The putative rice
(Oryza sativa; OsC-NGC) and barley (HvCBT1) CNGC GenBank accession
numbers are AAK16188.1 and AJ002610, respectively. Accession numbers for the
bovine olfactory (BOLF) and retinal (BRET) CNGCs, the tobacco CNGC (NtCBP4)
and K+ channels can be found in Leng et al.
(1999 ). The amino acids at
positions corresponding to the selectivity filter of K+ channels
and animal CNGCs, and the putative selectivity filters of plant CNGCs, are
shaded. Horizontal bars denote portions of the P-loop region, which form the
pore helix and S6 transmembrane (M2 in the case of KcsA) domain of both
K+ channels (Doyle et al.,
1998 ) and CNGCs (Flynn et al.,
2001 ). The amino acid residue position numbers at each end of the
sequences shown for KcsA, AtCNGC1, and AtCNGC2 correspond to the N and C
termini of the corresponding sequences shown in
Figure 1.
|
|
It should be noted that native K+ channels such as KcsA are
formed from four membrane-spanning subunits
(Catterall, 1995 ), as is the
case with animal CNGCs (Kaupp and Seifert,
2002 ). We generated a model of the ion-conducting pathway of a
plant CNGC tetramer, as shown in Figure
1C. This computational modeling indicates that plant CNGCs are
capable of forming the "inverted T-pee" quaternary structure of
P-loop channels (Flynn et al.,
2001 ), with the ion selectivity filters of each of the four
subunits positioned perpendicular to the membrane and coalescing to form the
ion conduction pathway.
The elegant presentation of the first crystal structure of a K+
channel (KcsA) by MacKinnon and coworkers
(Doyle et al., 1998 ) has
provided a seminal elucidation of the molecular architecture of the pore ion
selectivity filter. In large part due to this analysis, the K+
channel selectivity filter represents one of the biological enzyme motifs of a
membrane protein for which our understanding of the molecular, and atomic
structure:function relationship is most advanced
(Miller, 2001 ). The
selectivity filter of P-loop channels can be considered the "signature
sequence" for subfamilies of these proteins
(Heginbotham et al., 1994 ).
MacKinnon and coworkers' analysis of the KcsA structure confirmed a large body
of prior work, which suggested that the amino acid triplet GYG in the uncoiled
strand within the pore is the selectivity filter of the K+ channel
(Fig. 1, A and B). This
selectivity filter is a remarkable structure. It facilitates ion conduction at
rates (108 ion s1) through the channel
approaching that of the free ion diffusion potential in an aqueous solution,
yet at the same time, it allows a high degree of discrimination (i.e.
10,000-fold) for K+ over Na+ conduction
(Doyle et al., 1998 ). Doyle et
al. (1998 ) presented this GYG
triplet within the pore of channels as "absolutely required for
K+ selectivity." In line with this assertion, a broad range
of K+-selective channel subfamilies from bacteria, plants, and
animals retain this signature pore sequence. Morais-Cabral et al.
(2001 ) extended this assertion
in concluding that "The selectivity filter is the central structural
element that defines a K+ channel, it's amino acid sequence is
conserved in all K+ channels," as did Jiang et al.
(2002 ): "On the basis of
the KcsA K+ channel structure, it seems that cation selectivity is
an intrinsic property of the pore architecture". Cyclic nucleotidegated
nonselective cation channels cloned from animals do not retain this GYG motif
(Zagotta and Siegelbaum,
1996 ). Animal CNGCs have the sequence GET
(Zagotta and Siegelbaum,
1996 ), or G_ET (Doyle et al.,
1998 ; Flynn et al.,
2001 ) in this region of the pore
(Fig. 2). This difference has
been experimentally demonstrated to be the basis for the nonselective
conduction of Na+ as well as K+ by these channel
proteins (Zagotta and Siegelbaum,
1996 ; Flynn et al.,
2001 ).
Plant CNGCs do not contain GYG or GET in this region of the pore. Our
computational modeling (Fig. 1)
indicates that the corresponding position in the P-loop regions of AtCNGC1 and
AtCNGC2 is predicted to contain a GQN triplet or a AND triplet, respectively.
It should be noted that the predicted selectivity filter of AtCNGC1 is present
in the pore regions of many plant CNGCs, whereas the chemically distinct
selectivity filter AND of AtCNGC2 (the most phylogenetically divergent of the
AtCNGCs; Maser et al., 2001 )
is unique among this plant channel family
(Fig. 2).
Protein modeling allows for a prediction of whether a polypeptide can fold
into a specific tertiary structure within such constraints as (a) energy
minimization predictions of the relative placement of amino acid side chains
within the three-dimensional space occupied by the protein, (b) the presence
of secondary structure motifs such as -helices, -strands, etc.,
and (c) possible amino acid residue interactions (hydrogen and ionic bonding,
Van der Wall's and stacking forces, etc.). Models (such as those presented in
Fig. 1) developed from
threading primary peptide structures (sequences) through the known structures
of crystallized proteins are by definition, therefore, only predictive of what
a query protein's three-dimensional structure could be. However, they do
provide insights that can focus experimental strategies. Within this context,
the results of our modeling studies indicate that the AtCNGC1 and AtCNGC2
polypeptides (Fig. 1, A and B,
respectively) are both capable of forming an uncoiled strand with a
selectivity filter positioned near the outer mouth of the pore, but we note
that this modeling highlights an intriguing difference between the two
structures. The AtCNGC1 pore selectivity filter can assume a position relative
to the pore helix similar to that of the selectivity filter of KcsA (i.e. the
GQN and GYG triplets overlap for the most part;
Fig. 1A). Conversely, our model
of the AtCNGC2 P-loop region (Fig.
1B) suggests that the AtCNGC2 selectivity filter (AND) can be
oriented within the ion-conducting pathway in a different position from the
selectivity filter GYG triplet of KcsA. As indicated below from our
experimental studies of the AtCNGC2 selectivity filter, it may represent a
molecular paradigm significantly different from the selectivity filter of
known P-loop channels. Nonetheless, our quaternary structure modeling
(Fig. 1C) indicates that the
P-loop regions of AtCNGC2 polypeptide subunits can still assemble into the
"classical" ion conduction pathway of the tetrameric channel
complex. The quaternary structural model of the AtCNGC2 tertramer
ion-conducting pathway (Fig.
1C) suggests some other features consistent with P-loop channel
tetramers. Within the ion-conducting pathway of the KcsA tetramer, the
backbone amino acids of the pore helix are positioned such that the
amide-carbonyl dipoles are oriented with the partial negative charges facing
inward, along the ion-conducting pathway of the pore
(Doyle et al., 1998 ). It is
thought that these partial negative charges contribute to the stabilization of
the dehydrated cation as it passes through the channel. Our model of the
AtCNGC2 tetramer indicates a similar alignment of the amide-carbonyl dipoles
of the pore helix amino acids; this orientation is symbolized by the negative
charges shown within the ion-conducting pathway of the AtCNGC2 tetramer shown
in Figure 1C.
Following the presently accepted convention regarding the selectivity
filter of ion channels, neither of these AtCNGC pore region amino acid triplet
sequences should be sufficient to confer selectivity for K+ over
Na+ conduction to an ion channel protein. We continued our
examination of the plant CNGC pore selectivity filter by expression of
nucleotide sequences encoding CNGCs in X. laevis oocytes and human
embryonic kidney (HEK) 293 cells and evaluating the electrophysiological
characteristics of the channels using voltage clamp analysis.
Na+ Conductance of AtCNGC1
HEK cells transfected with a cDNA encoding the Arabidopsis CNGC AtCNGC1
displayed cyclic nucleotide-activated currents with either K+ or
Na+ in the perfusion bath that were not evident in control
(non-transfected) cells (Fig.
3). AtCNGC1 currents are inward rectified and noninactivating
(Fig. 3, inset), channel
properties likely associated with cation uptake pathways in plants
(Schroeder et al., 1994 ). Our
three-dimensional modeling as shown in
Figure 1A, in agreement with
primary sequence alignments (Köhler
et al., 1999 ; Leng et al.,
2002 ), indicates that AtCNGC1 has the amino acid triplet GQN in
the selectivity filter (as is the case with many plant CNGCs;
Fig. 2). It is not surprising,
therefore, that the results presented in
Figure 3 are consistent with
the conclusion that AtCNGC1 is an inward-rectified plant channel that conducts
Na+ equally as well as K+. These data are the first
demonstration of inward Na+ currents through a cloned plant ion
channel. In conjunction with recent studies that document expression of
AtCNGC1 in plant roots and demonstration that this protein provides an ion
uptake pathway into plants for ions in the soil solution
(Sunkar et al., 2000 ), the
results presented here suggest the possibility that plant CNGCs such as
AtCNGC1 may provide a physiologically significant Na+ uptake
pathway for plants.
High-affinity cation cotransporters such as the Arabidopsis protein AtHKT1
have been shown to transport Na+ upon expression in heterologous
systems (Rubio et al., 1995 )
and likely contribute to Na+ uptake into plants from saline soils
(Rus et al., 2001 ). However,
other proteins present in the root provide additional pathways for
Na+ influx into plants
(Maathuis and Amtmann, 1999 ;
Demidchik et al., 2002 ). The
many plant K+ channels cloned to date (inward-rectified Shaker
homologs such as KAT-, and AKT-type channels; outward-rectified Shaker
homologs such as SKOR-type; and two-pore outward rectifiers such as KCO-type
channels) appear to discriminate against Na+ conduction to an
extent equal to that of cloned animal K+-selective channels
(Schroeder et al., 1994 ;
Davenport and Tester, 2000 ;
Demidchik et al., 2002 ). Thus,
at present, plant CNGCs such as AtCNGC1 and other members of this channel
family (Fig. 2) with similar
selectivity filter amino acid triplets (i.e. GQN) appear to be candidates for
nonselective channels that contribute to the ion-conducting pathway allowing
toxic levels of Na+ to be taken up by plants from saline soils
(Maathuis and Sanders, 2001 ;
Demidchik et al., 2002 ). In
preliminary studies (i.e. recordings obtained from a single patch),
Belagué et al. (2003 )
recently noted a weak K+ over Na+ selectivity of another
member of this channel family (AtCNGC4) upon expression in oocytes.
K+/Na+ Selectivity of AtCNGC2
In this report, we present an electrophysiological analysis of another
plant CNGC (AtCNGC2), which has a putative pore selectivity filter unlike that
found in AtCNGC1, animal CNGCs, or (plant, animal, or bacterial)
K+-selective channels. AtCNGC2 has the amino acid triplet AND in
the presumed pore selectivity filter where GYG is positioned in
K+-selective channels (Fig.
1B). As noted previously in work from this lab using oocytes as a
heterologous expression system (Leng et
al., 1999 ), AtCNGC2 displays inward cAMP-dependent K+
currents (Fig. 4A) similar to
those recorded for AtCNGC1 (Fig.
3). However, despite the fact that AtCNGC2 does not have the GYG
motif in the pore selectivity filter, this plant channel does not conduct
Na+; hyperpolarization-activated inward Na+ currents
recorded from cells expressing AtCNGC2 were no greater than those recorded
from control HEK cells (Fig.
4A).
Although the AtCNGC2 pore selectivity filter triplet (AND;
Fig. 1B) is not similar to the
signature pore sequence (GYG) of K+ channels, it is also dissimilar
to the triplet GET known to be the basis for Na+ permeation (equal
to that of K+) by animal CNGCs
(Flynn et al., 2001 ). Results
shown in Figure 4 suggest the
possibility that the pore selectivity filter of AtCNGC2 may represent an
as-yet-unidentified basis for K+/Na+ discrimination by
ion channels. Clearly, other functional domains of CNGC proteins physically
interact with the pore to facilitate conduction
(Flynn et al., 2001 ), and
other parts of the P-loop region of CNGCs have been shown to affect
K+/Na+ discrimination
(Zagotta and Siegelbaum,
1996 ), so it would not necessarily follow that the triplet AND in
the presumed pore of AtCNGC2 provides the basis for selective K+
(over Na+) conduction. The rest of the work in this report
addresses this hypothesis.
Because the Ala in the pore of AtCNGC2 is chemically similar to the Gly of
animal CNGCs, we reasoned that the N and D residues in the pore of AtCNGC2
could confer different permeation selectivity properties to the channel than
the E and T at the corresponding positions in the pore of animal CNGCs. The
conduction properties of AtCNGC2, with the ND in the pore mutated to the ET
residues found in the selectivity filter of animal CNGCs is shown in
Figure 4B. Mutation of these
AtCNGC2 selectivity filter residues abolished selective K+
permeation; cAMP-activated Na+ currents recorded in the whole-cell
configuration are as large as the K+ currents recorded from HEK
cells expressing AtCNGC2N416D417 ET.
Further studies (not shown) indicated that mutating the N of the AtCNGC2 pore
to E, and the D to a T individually resulted in the formation of nonfunctional
channels and that the YG selectivity filter residues of
K+-selective channels cannot replace the ND.
Recent work (Gamel and Torre,
2000 ) has identified the first of three Pro residues immediately
C-terminal to the selectivity filter triplet of animal CNGCs (all animal CNGC
-subunits have the sequence GETPPP within the pore) as contributing to
the structure of the cation conduction pathway of these channels. It should be
noted that these results (Fig.
4B) indicate that the ET of the animal CNGC selectivity filter
(which has been shown to be the basis for nonselective conduction of
K+ and Na+; Flynn et
al., 2001 ) can allow for such nonselective conduction in the
absence of the pore Pro triplet.
We used a second heterologous expression system to evaluate our contention
that ND within the filter of AtCNGC2 provides a critical basis for
K+/Na+ selectivity. The wild-type and mutant
(AtCNGC2N416D417 ET) channels were
expressed in X. laevis oocytes, and ramp currents were recorded from
membrane patches (Fig. 5).
Application of cAMP to wild-type AtCNGC2 activated K+ currents
(compare tracing 2 with tracing 1 in the left panel of
Fig. 5A). The current tracing 1
represents the background or "leak" currents across these membrane
patches and could be due to (a) current through AtCNGC2 that occurs in the
absence of cAMP, (b) AtCNGC2 current evoked by endogenous cyclic nucleotide
present in the oocyte and still associated with the membrane patch even after
removal from the cell, or (c) current through endogenous oocyte channels (but
see Fig. 5C; background or leak
current in water injected oocytes is less than 1 µA at either 70 or
+70 mV). No matter what caused the background leak current in these membrane
patches, cAMP application resulted in a greater magnitude of K+
current (tracing 2) than was measured in the absence of cAMP (tracing 1). As
was the case with measurements recorded in the whole-cell configuration from
transfected HEK cells (Fig. 4),
the AtCNGC2 current recorded from these membrane patches appears to be
inwardly rectified; the channel(s) appears to be open for longer time periods
at negative voltages (corresponding to current passing to the cytoplasm) than
at positive voltages. Activation of AtCNGC2 current by exogenously added cAMP
was reversible; upon washing of the membrane patch in bath solution with no
added cAMP, the current (tracing 3) returns to background levels (tracing 1).
In contrast to the cAMP-activated K+ current recorded from membrane
patches pulled from oocytes injected with wild-type AtCNGC2 cRNA, no
cAMP-dependent AtCNGC2 current was noted when pipette and bath solutions
contained Na+ in place of K+
(Fig. 5A, right panel). In this
case, no differences were noted in current tracings 1, 2, and 3. In contrast
to the results obtained from the wild-type AtCNGC2 channel
(Fig. 5A), application of cAMP
evoked both K+ and Na+ current in membrane patches
pulled from oocytes injected with
AtCNGC2N416D417 ET cRNA
(Fig. 5B). As was the case with
K+ currents through the wild-type channel
(Fig. 5A), cAMP-activated
K+ and Na+ currents through the mutant channel were
inwardly rectified and reversible (Fig.
5B). In the patch configuration, the mutant channel, containing
the ET found in the pore selectivity filter of animal CNGCs, displayed similar
levels of cAMP-dependent K+ and cAMP-dependent Na+
currents (Fig. 5B).

View larger version (38K):
[in this window]
[in a new window]
|
Figure 5. Ramp recordings of wild-type and mutant AtCNGC2 currents. X.
laevis oocytes were injected with AtCNGC2 (wild type; A), or
AtCNGC2N416D417 ET cRNA (B). Inside-out
membrane patches were pulled from oocytes, and ramp recordings were obtained
using pipette and bath solutions containing 90 mM KCl or NaCl (as
noted), 0.2 mM K2EDTA (or Na2EDTA as
appropriate), and 2 mM HEPES-KOH (NaOH as appropriate), pH 7.2, a
holding potential of 0 mV, and a ramp (70 mV to +70 mV) protocol.
During recordings, membrane patches were constantly perfused, first with bath
medium containing no cAMP (tracing 1), then with bath medium containing 100
µM cAMP (tracing 2), and then again with bath medium lacking
cAMP (tracing 3). Data are presented with downward current corresponding to a
positive charge passing from the extracellular side of the membrane (i.e. from
the pipette) to the intracellular side of the membrane. Note the difference in
amplitude between the current scales for the Na+ and K+
recordings in A. C, Using a similar protocol, recordings from water-injected
oocytes displayed maximal inward K+ current of <1 pA at
70 mV and outward current of <1 pA at +70 mV, and no difference in
current was observed in the absence (tracing 1) or presence (tracing 2) of 100
µM cAMP added to the bath perfusion medium.
|
|
A similar experiment was undertaken with a different set of oocytes. In
this case, recordings were also made using the inside-out patch configuration,
and with K+ or Na+ (as noted) on both sides of the
membrane, except recordings were made over longer time periods at one constant
command voltage (Fig. 6). Similar results were obtained in this experiment. Application of ligand (cAMP)
resulted in the occurrence of K+ current with the wild-type AtCNGC2
channel, whereas ligand evoked K+ and Na+ currents with
AtCNGC2N416D417 ET. The results
presented in Figures 5 and
6, using a second heterologous
expression system, provide confirmation of the work with HEK cells
(Fig. 4) in demonstrating a
high degree of selectivity for conduction of K+ and exclusion of
Na+ by wild-type AtCNGC2 (in contrast to AtCNGC1;
Fig. 3) and no
K+/Na+ discrimination by the mutant AtCNGC2 channel. The
results presented here are consistent with the contention that the triplet AND
is positioned within the ion-conducting pore of the plant CNGC AtCNGC2 as a
selectivity filter in a fashion corresponding to the GYG of K+
channels and that this pore selectivity filter provides the atomic
architecture to the AtCNGC2 ion conduction pathway that allows for
discrimination between K+ and Na+.

View larger version (57K):
[in this window]
[in a new window]
|
Figure 6. Patch recordings from oocyte membranes in the presence of either
K+ or Na+. Recordings were made in the presence of 90
mM KCl or NaCl (as noted) from oocytes injected with water, AtCNGC2
cRNA, or AtCNGC2N416D417 ET cRNA.
Pipette and bath solutions were the same as used in the experiment shown in
Figure 5, except that 100
µM cAMP was present throughout recording during a 60 mV
command voltage that was maintained throughout the recordings shown in this
figure. The current and time bars in the lower left refer to all the
recordings except the one at the bottom right. In this case, the K+
current recordings from a patch pulled from an oocyte injected with AtCNGC2
cRNA are reproduced with a time scale expanded by 10-fold to visualize
individual channel opening events. The convention for showing channel opening
is the same as used for Figure
5; for each recording, downward deflections show channel opening
events.
|
|
Conclusion
Results in this report present the first electrophysiological analysis of
an Na+-conducting ion channel cloned from plants (i.e. AtCNGC1). In
addition, this work identifies the unique pore selectivity filter of AtCNGC2
as facilitating the permeation of K+ and exclusion of
Na+ through the pore of a channel protein, in a fashion similar to
the GYG triplet of Shaker-like channels. Unraveling how the AtCNGC2
selectivity filter facilitates selective K+ conduction could
provide unique insights into our currently developing understanding of how ion
channels undertake their elegant and fundamentally important function.
 |
MATERIALS AND METHODS
|
|---|
Computational Analysis and Structural Modeling
A list of peptide sequences corresponding to characterized and putative
Arabidopsis CNGCs was generated from the Munich Information Center for Protein
Sequences Arabidopsis Database
(http://mips.gsf.de/proj/thal/).
In addition, peptide sequences corresponding to animal CNGCs and plant
K+ channel and CNGCs (other then Arabidopsis) were retrieved via
BLAST screens of the nonredundant database at GenBank through the National
Center for Biotechnology Information. Multiple amino acid sequence alignments
were performed using ClustalX software
(Thompson et al., 1997 ) with
the default parameters.
Three-dimensional computational models of the P-loop region corresponding
to both AtCNGC1 (amino acids Lys-354 to Leu-407) and AtCNGC2 (amino acids
Lys-399 to Leu-452) were generated by threading these sequences (as separate
projects), through the crystal structure of the Streptomyces lividans
KcsA K+ channel (protein database [PDB] record 1BL8A) and generating homology
models for the two plant channels. Initially, the corresponding amino acid
sequences were submitted to the Swiss-model Blast Protein Modeling Server
(Guex and Peitsch, 1997 ),
which searches the ExNRL-3D database. The query identified PDB record 1BL8A
for both AtCNGC1 and AtCNGC2 as an appropriate modeling template. The PDB
record was downloaded for subsequent analysis, and the experimental sequences
were then submitted back through the Swiss-model Blast Protein Modeling Server
using the 1BL8A record as a template to generate three-dimensional structural
models of the AtCNGC1 and AtCNGC2 pore regions. Using the SwissModel
"First Approach" mode with a lower BLAST P (N) limit of 0.00001,
positive structures were rendered and analyzed locally through the
Swiss-PdbViewer version 3.5 (Glaxo Wellcome Experimental Research).
Reproductions of the modeled structures were loaded into Microsoft PowerPoint
as bitmap files and annotated. In addition, a proposed three-dimensional
computational model representing the AtCNGC2 homotetramer was generated using
the quaternary structure of KcsA (1BL8) as a modeling template. The model was
generated precisely as described in the Swiss-model Protein Modeling Server
oligomer modeling strategy
(http://www.expasy.org/swissmod/SWISS-MODEL.html).
The AtCNGC2 P-loop region (amino acids Lys-399 to Leu-452) was constructed
into four repeats as a text file with appropriate annotations and submitted to
the Swiss-model Protein Modeling Server. Using the "optimize project
mode," a quaternary structure was generated and subsequently rendered as
a persistence of vision ray tracer image. The image was then annotated
locally.
Channel Expression and Electrophysiological Analysis in HEK
Cells
Construction of an AtCNGC1 expression plasmid for HEK cell (HEK
cell line HEK 293, American Type Culture Collection, Rockville, MD) transient
transfection was performed by restriction digestion of a pBluescript II
SK+ (Stratagene, La Jolla, CA) plasmid containing the
AtCNGC1 coding sequence (Leng et
al., 2002 ) with EcoRI and NotI; the resultant
AtCNGC1 encoding cDNA was ligated into EcoRI- and
NotI-digested pcDNA3.1 (Invitrogen, Carlsbad, CA). Construction of an
AtCNGC2 expression plasmid for transient transfection of HEK cells
was performed as previously described
(Leng et al., 2002 ). Mutations
were incorporated into the AtCNGC2 coding sequence using the
QuickChange Site-Directed Mutagenesis Kit (Stratagene) following the
procedures described in the instructional manual (revision no. 108005h). The
following sense and antisense oligonucleotide primers, respectively,
containing the appropriate mutations were generated to construct
AtCNGC2N416D417 ET:
GACTCTCAGCACATTTGCGGAGACTCTTGAGCCCACAAGC and
GCTTGTGGGCTCAAGAGTCTCCGCAAATGTGCTGAGAGTC. Unless otherwise noted, all DNA
manipulations were performed using standard methods
(Ausubel et al., 1987 ).
Heterologous expression of AtCNGC1 and AtCNGC2 in HEK cells and subsequent
voltage clamp measurements were performed as previously described
(Leng et al., 2002 ). Any
modifications are presented in figure legends. Solutions used for all HEK cell
recordings contained: 10 mM HEPES-K(Na) OH, pH 7.4, 10
mM Glc, and 0.1 mM MgCl2 (bath solution); or
145 mM N-methyl-D-glucamine, 10 mM
HEPES-K(Na) OH, pH 7.4, and 0.5 mM MgCl2 (pipette
solution). Additions of NaCl or KCl, and dibutyryl-cAMP are noted in figure
legends.
On the day of recording, cells were washed with maintenance medium and
incubated with M450 Dynabeads conjugated with anti-CD8 antibody at 1 µL 2
mL1 (Dynal, Oslo). Successful transfection was
ascertained by the adherence of Dynabeads to a cell
(Jurman et al., 1994 ). These
cells were used for electrophysiological recordings in the whole-cell
configuration at room temperature. It should be noted that whereas
approximately 40% of beaded cells cotransfected with an animal CNGC
(used as a control) yielded cyclic nucleotide-dependent currents, only
approximately 5% of beaded cells cotransfected with AtCNGC2 yielded
cyclic nucleotide-dependent currents (data not shown); we do not know the
basis for this difference in successful expression of plant versus animal
CNGCs in HEK cells. Also germane to the work presented in this report is our
observation of several different inwardly conducting K+ channels in
control (i.e. non-transfected) HEK cells. We have observed inward
K+ channels in these control HEK cells with conductances of 4, 13,
8, and 29 pS (data not shown). Due to these background inward K+
currents in control HEK cells, we focused on using oocytes for patch
recordings of AtCNGC2 single-channel events in the work reported here.
Channel Expression and Electrophysiological Analysis in X.
laevis Oocytes
The AtCNGC2 coding sequence in a pZL plasmid (described by Leng et
al. [1999 ]) was used to
generate a mutant construct
(AtCNGC2N416D417 ET) using the
site-directed mutagenesis protocol described above. Full-length sense RNA
encoding methylated, capped runoff transcripts were generated from
pZL-AtCNGC2 and
pZL-AtCNGC2N416D417 ET using the
Epicentre AmpliScribe T7 High Yield Transcription Kit (Epicentre Technologies,
Madison, WI). Oocytes were harvested from Xenopus laevis frogs,
microinjected with AtCNGC2 and
AtCNGC2N416D417 ET cRNA, and used (after
removal of the vitelline layer) for patch recordings (inside-out
configuration; cytoplasmic portion of the channel exposed to the perfusion
bath) as described previously (Leng et
al., 2002 ). In some experiments, a ramp command protocol was used
(+70 to 70 mV over 4 s) during measurement of currents. During patch
recordings, cAMP was delivered to the cytoplasmic portion of the channel from
a gravity-driven multibarrel perfusion system. Time between individual ramp
recordings taken on the same membrane patch was dependent on our perfusion
system, and was a minimum of several seconds. Recording and bath solutions
contained 90 mM KCl or NaCl (as noted in figure legends), 0.2
mM EDTA, and 2 mM HEPES-K(Na) OH, pH 7.2.
Distribution of Materials
In all cases, reagents and chemicals were purchased from Sigma-Aldrich (St.
Louis), unless otherwise noted. Upon request, all novel materials described in
this publication will be made available in a timely manner for noncommercial
research purposes, subject to the requisite permission from any third-party
owners of all or parts of the material. Obtaining any permissions will be the
responsibility of the requestor.
Received January 20, 2003;
returned for revision February 12, 2003;
accepted April 2, 2003.
 |
FOOTNOTES
|
|---|
Article, publication date, and citation information can be found at
www.plantphysiol.org/cgi/doi/10.1104/pp.103.020560.
1 This work was supported by the National Science Foundation (grant no.
MCB0090675 to G.A.B.). This is a publication from the Storrs
Agricultural Experiment Station. 
2 Present address: Department of Molecular Biotechnology, Beijing
Agricultural College, No. 7 Beinong Rd, Shahe, Changping, Beijing City, China
102206. 
3 Present address: Yale School of Medicine, Department of Cellular and
Molecular Physiology, 333 Cedar Street, B121SHM, New Haven, CT
06520. 
*
Corresponding author; e-mail
gerald.berkowitz{at}uconn.edu;
fax 8604860534.
 |
LITERATURE CITED
|
|---|
Arazi T, Kaplan B, Fromm H (2000) A
high-affinity calmodulin-binding site in a tobacco plasma-membrane channel
protein coincides with a characteristic element of cyclic nucleotide-binding
domains. Plant Mol Biol 42:
591601[CrossRef][Web of Science][Medline]
Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith
JA, Struhl K (1987) Current Protocols in
Molecular Biology. John Wiley and Sons, New York
Belagué C, Lin B, Alcon C, Flottes G, Malmström,
Köhler C, Neuhaus G, Pelletier G, Gaymard F, Roby D
(2003) HLM1, and essential signaling component in the
hypersensitive response, is a member of the cyclic nucleotide-gated channel
ion channel family. Plant Cell
15:
365379[Abstract/Free Full Text]
Catterall WA (1995) Structure and function of
voltage-gated ion channels. Annu Rev Biochem
64:
493531[CrossRef][Web of Science][Medline]
Catterall WA (2000) From ionic currents to
molecular mechanisms: the structure and function of voltage-gated sodium
channels. Neuron 26:
1325[CrossRef][Web of Science][Medline]
Davenport RJ, Tester M (2000) A weakly
voltage-dependent, nonselective cation channel mediates toxic sodium influx.
Plant Physiol 122:
823834[Abstract/Free Full Text]
Demidchik V, Davenport RJ, Tester M (2002)
Nonselective cation channels in plants. Annu Rev Plant Biol
53:
67107[CrossRef][Medline]
Doyle DA, Cabral JM, Pfuetzner RA, Kuo A, Gulbis JM, Cohen SL,
Chait BT, MacKinnon R (1998) The structure of the
potassium channel: molecular basis of K conduction and selectivity.
Science 280:
6976[Abstract/Free Full Text]
Epstein E, Norlyn JD, Rush DW, Kingsbury RW, Kelly DB,
Cunningham GA, Wrona AF (1980) Saline culture of
crops: a genetic approach. Science
210:
399404[Abstract/Free Full Text]
Flowers TJ, Yeo AR (1995) Breeding for salinity
resistance in crop plants: Where next? Aust J Plant Physiol
22:
875884[Web of Science]
Flynn GE, Johnson JP, Zagotta WN (2001) Cyclic
nucleotide-gated channels: shedding light on the opening of a channel pore.
Nat Rev Neurosci 2:
643652[CrossRef][Web of Science][Medline]
Gamel K, Torre V (2000) The interaction of
Na(+) and K(+) in the pore of cyclic nucleotide-gated channels. Biophys
J 79:
24752493[Web of Science][Medline]
Guex N, Peitsch MC (1997) SWISS-MODEL and the
Swiss-PdbViewer: and environment for comparative protein modeling.
Electrophoresis 18:
27142723[CrossRef][Web of Science][Medline]
Heginbotham L, Lu Z, Abramson T, MacKinnon R
(1994) Mutations in the K+ channel signature sequence.
Biophys J 66:
10611067[Web of Science][Medline]
Jiang Y, Lee A, Chen J, Cadene M, Chait BT, MacKinnon R
(2002) Crystal structure and mechanism of a calcium-gated
potassium channel. Nature 417:
515522[CrossRef][Medline]
Jurman ME, Boland LM, Liu Y, Yellen G (1994)
Visual identification of individual transfected cells for electrophysiology
using antibody-coated beads. Biotechniques
17:
876881[Web of Science][Medline]
Kaupp UB, Seifert R (2002) Cyclic
nucleotide-gated ion channels. Physiol Rev
82:
769824[Abstract/Free Full Text]
Köhler C, Merkle T, Neuhaus G (1999)
Characterization of a novel gene family of putative cyclic nucleotide- and
calmodulin-regulated ion channels in Arabidopsis thaliana.
Plant J 18:
97104[CrossRef][Web of Science][Medline]
Köhler C, Neuhaus G (2000)
Characterization of calmodulin binding to cyclic nucleotide-gated ion channels
from Arabidopsis thaliana. FEBS Lett
471:
133136[CrossRef][Web of Science][Medline]
Leng Q, Mercier RW, Hua B-G, Fromm H, Berkowitz GA
(2002) Electrophysiological analysis of cloned cyclic
nucleotide-gated ion channels. Plant Physiol
128:
400410[Abstract/Free Full Text]
Leng Q, Mercier RW, Yao W, Berkowitz GA (1999)
Cloning and first functional characterization of a plant cyclic
nucleotide-gated cation channel. Plant Physiol
121:
753761[Abstract/Free Full Text]
Maathuis FJM, Amtmann A (1999) K+
nutrition and Na+ toxicity: the basis of cellular
K+/Na+ ratios. Ann Bot
84:
123133[Abstract/Free Full Text]
Maathuis FJM, Sanders D (2001) Sodium uptake in
Arabidopsis thaliana roots is regulated by cyclic nucleotides.
Plant Physiol 127:
16171625[Abstract/Free Full Text]
Maser P, Thomine S, Schroeder JI, Ward JM, Hirschi K, Sze H,
Talke IN, Amtmann A, Maathuis FJ, Sanders D et al.
(2001) Phylogenetic relationships within cation transporter
families of Arabidopsis. Plant Physiol
126:
16461667[Abstract/Free Full Text]
Miller C (2001) See potassium run.
Nature 414:
2324[CrossRef][Medline]
Molday RS (1996) Calmodulin regulation of
cyclic nucleotide-gated channels. Curr Opin Neurobiol
8:
445452
Morais-Cabral JH, Zhou Y, MacKinnon (2001)
Energetic optimization of ion conduction rate by the K+ selectivity
filter. Nature 414:
3742[CrossRef][Medline]
Ren D, Navarro B, Xu H, Yue L, Shi Q, Clapham DE
(2001) A prokaryotic voltage-gated sodium channel.
Science 294:
23722375[Abstract/Free Full Text]
Rubio F, Gassmann W, Schroeder JI (1995)
Sodium-driven potassium uptake by the plant potassium transporter HKT1 and
mutations conferring salt tolerance. Science
270:
16601663[Abstract/Free Full Text]
Rus A, Yokoi S, Sharkhuu A, Reddy M, Lee B-H, Matsumoto TK,
Koiwa H, Zhu J-K, Bressan RA, Hasegawa PM (2001)
AtHKT1 is a salt tolerance determinant that controls Na+ entry into
plant roots. Proc Natl Acad Sci USA
98:
1415014155[Abstract/Free Full Text]
Schroeder JI, Ward JM, Gassmann W (1994)
Perspectives on the physiology and structure of inward-rectifying K+ channels
in higher plants: biophysical implications for K+ uptake. Annu Rev
Biophys Biomol Struct 23:
441471[Web of Science][Medline]
Schuurink RC, Shartzer SF, Fath A, Jones RL
(1998) Characterization of a calmodulin-binding transporter from
the plasma membrane of barley aleurone. Proc Natl Acad Sci USA
95:
19441949[Abstract/Free Full Text]
Sunkar R, Kaplan B, Bouche N, Arazi T, Dolev D, Talke IN,
Maathuis FJM, Sanders D, Bouchez D, Fromm H (2000)
Expression of a truncated tobacco NtCBP4 channel in transgenic plants
and disruption of the homologous Arabidopsis CNGC1 gene confer
PB2+ tolerance. Plant J
24:
533542[CrossRef][Web of Science][Medline]
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG
(1997) The ClustalX windows interface: flexible strategies for
multiple sequence alignment aided by quality analysis tools. Nucleic
Acids Res 24:
48764882
Tyerman SD, Skerrett IM (1999) Root ion
channels and salinity. Sci Hort
78:
175235
White PJ, Bowen HC, Demidchik V, Nichols C, Davies JM
(2002) Genes for calcium-permeable channels in the plasma
membrane of plant root cells. Biochim Biophys Acta
1564:
299309[Medline]
Zagotta WN, Siegelbaum SA (1996) Structure and
function of cyclic nucleotide-gated channels. Annu Rev Neurosci
19:
235263[CrossRef][Web of Science][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
P. Malagoli, D. T. Britto, L. M. Schulze, and H. J. Kronzucker
Futile Na+ cycling at the root plasma membrane in rice (Oryza sativa L.): kinetics, energetics, and relationship to salinity tolerance
J. Exp. Bot.,
November 1, 2008;
59(15):
4109 - 4117.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Ma, A. Smigel, Y.-C. Tsai, J. Braam, and G. A. Berkowitz
Innate Immunity Signaling: Cytosolic Ca2+ Elevation Is Linked to Downstream Nitric Oxide Generation through the Action of Calmodulin or a Calmodulin-Like Protein
Plant Physiology,
October 1, 2008;
148(2):
818 - 828.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. J. Kronzucker, M. W. Szczerba, L. M. Schulze, and D. T. Britto
Non-reciprocal interactions between K+ and Na+ ions in barley (Hordeum vulgare L.)
J. Exp. Bot.,
July 1, 2008;
59(10):
2793 - 2801.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Ali, W. Ma, F. Lemtiri-Chlieh, D. Tsaltas, Q. Leng, S. von Bodman, and G. A. Berkowitz
Death Don't Have No Mercy and Neither Does Calcium: Arabidopsis CYCLIC NUCLEOTIDE GATED CHANNEL2 and Innate Immunity
PLANT CELL,
March 1, 2007;
19(3):
1081 - 1095.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Gobert, G. Park, A. Amtmann, D. Sanders, and F. J. M. Maathuis
Arabidopsis thaliana Cyclic Nucleotide Gated Channel 3 forms a non-selective ion transporter involved in germination and cation transport
J. Exp. Bot.,
March 1, 2006;
57(4):
791 - 800.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Koiwa, R. A. Bressan, and P. M. Hasegawa
Identification of plant stress-responsive determinants in arabidopsis by large-scale forward genetic screens
J. Exp. Bot.,
March 1, 2006;
57(5):
1119 - 1128.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Pardo, B. Cubero, E. O. Leidi, and F. J. Quintero
Alkali cation exchangers: roles in cellular homeostasis and stress tolerance
J. Exp. Bot.,
March 1, 2006;
57(5):
1181 - 1199.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Ali, R. E. Zielinski, and G. A. Berkowitz
Expression of plant cyclic nucleotide-gated cation channels in yeast
J. Exp. Bot.,
January 1, 2006;
57(1):
125 - 138.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. K. Ashley, M. Grant, and A. Grabov
Plant responses to potassium deficiencies: a role for potassium transport proteins
J. Exp. Bot.,
January 1, 2006;
57(2):
425 - 436.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Lemtiri-Chlieh and G. A. Berkowitz
Cyclic Adenosine Monophosphate Regulates Calcium Channels in the Plasma Membrane of Arabidopsis Leaf Guard and Mesophyll Cells
J. Biol. Chem.,
August 20, 2004;
279(34):
35306 - 35312.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|