Plant Physiology 132:1892-1900 (2003)
© 2003 American Society of Plant Biologists
CELL BIOLOGY AND SIGNAL TRANSDUCTION
C-Terminal KDEL Sequence of A KDEL-Tailed Cysteine Proteinase (Sulfhydryl-Endopeptidase) Is Involved in Formation of KDEL Vesicle and in Efficient Vacuolar Transport of Sulfhydryl-Endopeptidase1
Takashi Okamoto2,*,
Tomoo Shimada,
Ikuko Hara-Nishimura,
Mikio Nishimura and
Takao Minamikawa
Department of Biological Sciences, Tokyo Metropolitan University,
Hachioji, Tokyo, 192–0397 Japan (T.O., T.M.); Department of Botany,
Graduate School of Science, Kyoto University, Kyoto, 606–8502 Japan
(T.S., I.H.-R.); and Department of Cell Biology, National Institute of Basic
Biology, Okazaki, 444–8585 Japan (M.N.)
 |
ABSTRACT
|
|---|
Sulfhydryl-endopeptidase (SH-EP) is a papain-type vacuolar proteinase
expressed in cotyledons of germinated Vigna mungo seeds, and the
enzyme possesses a C-terminal propeptide containing KDEL tail, an endoplasmic
reticulum retention signal for soluble proteins. SH-EP is transported to
vacuoles via a KDEL vesicle (KV) through a Golgi complex-independent route. To
see the function of the KDEL sequence of SH-EP, wild-type SH-EP and its KDEL
deletion mutant (SH-EP KDEL) were heterologously expressed in
Arabidopsis and in cultured tobacco Bright Yellow 2 cells, and their
intracellular transport pathways and localizations were analyzed. A
combination of the results from analyses for transformed Arabidopsis and
tobacco (Nicotiana tabacum) cells indicated that wild-type SH-EP is
packed into KV-like vesicles through the KDEL sequence and is transported to
vacuoles in the cells of transformants. In contrast, KV was not formed/induced
in the cells expressing SH-EPKDEL, and the mutant protein was mainly
secreted. Therefore, the C-terminal KDEL sequence of the KDEL-tailed cysteine
proteinase is thought to be involved in the formation of KV, and in the
efficient vacuolar transport of the proteins through KV.
Eukaryotic cells are divided into distinct subcellular compartments or
organelles enclosed by one or more membranes. Because protein synthesis occurs
mainly in the cytosol, proteins of subcellular compartments have intracellular
localization signals that determine their final destinations. A transient
signal peptide allows cotranslational entry into the lumen of the endoplasmic
reticulum (ER). The ER is the starting compartment for vesicular traffic along
the secretory pathway to the Golgi complex, vacuoles, and the cell surface.
Because secretion following a route mediated by the Golgi complex is a default
destination for proteins introduced into the ER, proteins localizing in the
ER, the Golgi complex, or vacuoles must have additional signals. Most soluble
ER residents have a permanent C-terminal KDEL or HDEL tetrapeptide sequence,
which constitutes an ER retention signal.
(Munro and Pelham, 1987 ;
Pelham, 1989). The
tetrapeptide is recognized by the ERD2-KDEL receptor on the Golgi complex,
resulting in retrieval of H/KDEL proteins from this compartment back into the
ER. The H/KDEL system is conserved through mammals, plants, and yeasts
(Denecke et al., 1992;
Napier et al., 1992;
Lee et al., 1993). Beside ER
residents found in other eukaryotes, higher plants also have unique
papain-type proteinases that possess KDEL tails at the C terminus
(Akasofu et al., 1989;
Tanaka et al., 1993;
Valpuesta et al., 1995;
Becker et al., 1997;
Lee et al., 1997;
Guerrero et al., 1998;
Schmid et al., 1998;
Cercos et al., 1999). One
protein of this family, Vigna mungo KDEL proteinase, designated
Sulfhydryl-endopeptidase (SH-EP), has been shown to localize in vacuoles
(Okamoto et al., 1994;
Toyooka et al., 2000);
possibly, other members also have this location. The existence of such
KDEL-tailed vacuolar proteinase suggests that plant cells use the C-terminal
KDEL sequence for an unidentified vacuolar sorting system in addition to the
ER retention of proteins.
In germinating cotyledons of V. mungo seedlings, a KDEL-tailed Cys
proteinase, termed SH-EP, is expressed de novo and is involved in degradation
of storage proteins accumulated in protein storage vacuoles
(Mitsuhashi et al., 1986;
Okamoto and Minamikawa, 1998).
SH-EP is synthesized in the ER as a proform of 43 kD through cleavage of the
signal sequence, and proSH-EP is further processed to the enzymatically active
33-kD mature enzyme via 39- and 36-kD intermediates
(Mitsuhashi and Minamikawa,
1989); possibly in vacuoles (Okamoto et al.,
1999b,
2001). As for the C-terminal
KDEL sequence of SH-EP, analysis of heterologous expression of SH-EP and its
KDEL-deleted mutant in insect Sf-9 cells showed that the KDEL-tail of SH-EP
promotes the storage of SH-EP in the ER as a transient zymogen
(Okamoto et al., 1999a).
Recently, immunocytochemical analysis of cotyledon cells of V. mungo
seedlings using anti-SH-EP antibody revealed that proSH-EP was accumulated at
the edge or middle region of the ER, and that the accumulated proSH-EP
molecules were packed in specific vesicles with a diameter of 200 to 500 nm,
termed the KDEL vesicle (KV). KVs bud off from the ER and are fused with
vacuoles through a Golgi complex-independent pathway
(Toyooka et al., 2000).
It has been reported that the addition of KDEL to the C terminus of
vacuolar proteins, such as storage proteins, changes the intracellular
localization of these fusion proteins to the ER
(Herman et al., 1990;
Wandelt et al., 1992;
Herman and Larkins, 1999).
This is consistent with the well-known ER retrieval mechanism of KDEL-tailed
proteins using the ERD2-receptor system. In contrast, KDEL-tailed Cys
proteinases such as SH-EP are not artificially KDEL-fused proteins, but are
instead naturally used as vacuolar hydrolases by plant cells in vivo.
Therefore, SH-EP should be a good candidate for studies aimed at additional
and/or different role(s) for the KDEL-tail in plant cells, apart from its role
in the ER retention system. In the present study, wild-type SH-EP and its KDEL
deletion mutant (SH-EPKDEL) were heterologously expressed in
Arabidopsis and in cultured tobacco (Nicotiana tabacum) Bright Yellow
(BY)-2 cells, and the effects of the deletion of the KDEL-tail from the SH-EP
polypeptide on intracellular localization of the enzyme were monitored by
immunogold electron microscopic observation for transgenic Arabidopsis plants,
and by biochemical analyses and subcellular fractionation of the tobacco
cells. In addition, green fluorescent protein (GFP)-fused SH-EP or
SH-EPKDEL was expressed in tobacco BY-2 cells to observe localization
of the fusion proteins in the cells. Functions of the KDEL-tail of SH-EP in
the formation of KV and its subsequent intracellular localization are
discussed.
|
RESULTS
|
|---|
Formation of KV in Transformed Arabidopsis Expressing Wild-Type
SH-EP
ProSH-EP of 43 kD, SH-EP intermediates of 39- and 36-kD, and mature SH-EP
of 33 kD were detected in the extracts from cotyledons of germinated V.
mungo seeds (Fig. 1;
Mitsuhashi and Minamikawa,
1989). When crude extracts were prepared from rosette leaves of
transgenic Arabidopsis expressing wild-type SH-EP and were analyzed by
SDS/PAGE-immunoblotting with anti-SH-EP antibody, two major polypeptides of
proform and mature SH-EPs were detected
(Fig. 1). Detection of the
intense signal from proSH-EP in the extracts suggests that wild-type SH-EP
accumulated in the ER and packed into KV-like vesicles in cells of the plants,
as in cotyledon cells of V. mungo seedlings
(Toyooka et al., 2000).
Immunocytochemical analyses using anti-SH-EP antibodies were conducted for
cells of rosette leaves, stems, sepals, and cotyledons of the plants in which
SH-EP accumulated in the vesicles with diameters between 200 and 700 nm
(Fig. 2, A–C, and E). These vesicles possibly correspond to KV-like vesicles because the size of the
vesicles and the accumulation of KDEL-proteinase are characteristics identical
to those of KVs in cotyledons of V. mungo seedlings. In cells from
rosette leaves, some KV-like vesicles enlarged and were oblong shaped
(Fig. 2D). KV-like vesicles in
transgenic plants appeared to fuse with vacuoles
(Fig. 2A), and the localization
of SH-EP in vacuoles was also observed
(Fig. 2, F and G). These
observations suggest that SH-EP was transported to vacuoles via a KV-dependent
pathway. However, it cannot be ruled out that part of SH-EP remains in KV-like
vesicles, and part follows an independent Golgi-mediated route to
vacuoles.
View larger version (89K):
[in this window]
[in a new window]
|
Figure 2. Electron micrographs showing development of KV-like vesicles in cells of
several tissues from transgenic Arabidopsis expressing wild-type SH-EP. A,
SH-EP accumulated in ER and KV-like vesicles in stem cells. A KV-like vesicle
fused with a vacuole (arrowheads). B, SH-EP was accumulated in KV-like
vesicles in cotyledon cells. C, SH-EP was accumulated in KV-like vesicles in
rosette leaf cells. D, Enlarged and oblong-shaped KV-like vesicles were
observed in rosette leaf cells. E, SH-EP accumulated in KV-like vesicles in
sepal cells. F, A KV-like vesicle was fused with vacuoles in sepal cells.
Arrowheads indicate possible fusion sites. G, SH-EP was also localized in
vacuoles of cells of rosette leaves. Ch, Chloroplast; CW, cell wall; KV,
KV-like vesicle; Mt, Mitochondrion; V, vacuole; An asterisk indicates an
unidentified cell compartment. Bars = 200 nm.
|
|
Secretion of KDEL-Deleted SH-EP in Transgenic Arabidopsis
KDEL tail was deleted from wild-type SH-EP, and the mutant protein
(SH-EPKDEL) was expressed in Arabidopsis to investigate the effects of
removal of KDEL on localization of SH-EP. In SDS/PAGE-immunoblotting of crude
extracts from the rosette leaves of transformed Arabidopsis expressing the
mutant SH-EP, only 33-kD SH-EP was detected
(Fig. 1). The failure to detect
43-kD proSH-EP in the extracts would have been due to the deletion of the KDEL
tail from SH-EP, suggesting the loss of accumulation of proSH-EP in ER and/or
KV-like vesicles in cells of the transformants. The localization of mutant
SH-EP was observed with immunogold electron microscopy. Gold particles from
the anti-SH-EP antibodies existed at the extracellular spaces and at possible
air spaces (Fig. 3, A–C).
This suggests that SH-EPKDEL was mainly secreted from the cells.
View larger version (61K):
[in this window]
[in a new window]
|
Figure 3. Electron photographs showing secretion of SH-EPKDEL from the cells
of rosette leaves of transgenic Arabidopsis (A–C). The gold particles
from anti-SH-EP antibody were found at extracellular spaces, and possible air
spaces. CW, Cell wall; V, vacuole. Bars = 200 nm.
|
|
Growth Defect of Transgenic Arabidopsis Expressing
SH-EPKDEL
SH-EP belongs to the papain family and has strong proteolytic activity with
broad substrate specificities (Okamoto and
Minamikawa, 1998). The transformant expressing wild-type SH-EP
(Fig. 4A) showed no phenotype
and grew normally (Fig. 4B). In
contrast, secretion of SH-EPKDEL into the extracellular space damaged
the growth of transformants. Plants expressing mutant SH-EP at a low level
grew normally (Fig. 5, A and
B). However, plants with high expressions of the protein died
after developing several small rosette leaves. In the case of plants
expressing SH-EPKDEL at a mid-level, the size of the plant became
small. This suggests that secreted SH-EP degrades the cell wall and/or
apoplastic proteins, and that the difference of phenotype depends on the
expression level of SH-EPKDEL. To verify this possibility, the active
site Cys of mutant SH-EP was replaced with Gly, and SH-EPKDEL(C152G)
was expressed in Arabidopsis. The transgenic plants developed normally even if
SH-EPKDEL(C152G) was expressed at a high level
(Fig. 5, C and D). This
indicates that the proteolytic activity of secreted SH-EP affects the growth
of transformants. Protein components, existing in extracellular spaces, which
are essential for cell-cell interaction and/or communication, may be degraded
by the secreted SH-EP.
View larger version (69K):
[in this window]
[in a new window]
|
Figure 4. Transgenic Arabidopsis expressing wild-type SH-EP. A, Crude extracts (20
µg of protein) were prepared from rosette leaves of transformants and
nontransformants and were analyzed by SDS/PAGE-immunoblotting with anti-SH-EP
antibody. B, The transformants expressing wild-type SH-EP grew normally even
when the mutant protein was expressed at a high level as in A. Columbia and
SH-EP in B indicates nontransformant and transformant plants, respectively.
Col, Nontransformed Arabidopsis; SH, Arabidopsis expressing wild-type SH-EP;
V.m., crude extract from cotyledons of 3-d dark-grown V. mungo
seedlings.
|
|
View larger version (56K):
[in this window]
[in a new window]
|
Figure 5. Growth defect of transgenic Arabidopsis expressing SH-EPKDEL (A and
B), and expression of active site-mutated SH-EPKDEL (SH-EPKDEL,
C152G) in Arabidopsis (C and D). A, Crude extracts (20 µg of protein) were
prepared from three independent transgenic lines and were analyzed by
SDS/PAGE-immunoblotting with anti-SH-EP antibody. 2-2, 2-6, and 2-16 are
independent transgenic lines. B, Phenotypes of the same plants used in A.
Severe phenotype appeared according to increase of expression level of
SH-EPKDEL as shown in A. Columbia, nontransformant. C, Crude extracts
(20 µg of protein) were prepared from the transgenic Arabidopsis expressing
SH-EPKDEL(C152G) and were analyzed by SDS/PAGE-immunoblotting with
anti-SH-EP antibody. D, The transformants expressing SH-EPKDEL(C152G)
grow normally even when the mutant protein is expressed at a high level as in
A. CG, Arabidopsis expressing SH-EPKDEL(C152G); Col, nontransformed
Arabidopsis; V.m., crude extract from cotyledons of 3-d dark-grown V.
mungo seedlings.
|
|
Vacuolar Transport and Posttranslational Processing of Wild-Type
SH-EP in Tobacco BY-2 Cells
When the cell and medium fractions from transformed tobacco cell cultures
expressing wild-type SH-EP were analyzed by SDS/PAGE-immunoblotting with
anti-SH-EP antibody, 43-, 39-, and 33-kD SH-EPs were detected in the cell
fraction, but no SH-EP-related polypeptide was observed in the medium fraction
(Fig. 6A, KDEL+ lanes). No
polypeptide immunoreactive with anti-SH-EP antibody was detected in cells or
medium fractions prepared from nontransformed tobacco BY2 cell cultures (data
not shown). The pattern of the molecular masses of SH-EP-related polypeptides
in the transformed tobacco cells was almost the same as that in extracts from
cotyledons. The proteinase activity of SH-EP in the cell culture expressing
wild-type SH-EP was visualized using a gel-based gelatin plate method
(Fig. 6B, KDEL+ lanes). These
results suggest that the correct folding and processing of wild-type SH-EP,
essential for enzymatic activation, occurred in the tobacco cells.
View larger version (46K):
[in this window]
[in a new window]
|
Figure 6. Distributions of SH-EP-related polypeptides (A) and proteinase activities
(B) in transformed tobacco cell cultures expressing wild-type SH-EP (KDEL+) or
SH-EPKDEL (KDEL–), and subcellular localization of wild-type
SH-EP in tobacco cells (C). A, Cell and medium fractions from tobacco cell
cultures expressing wild-type SH-EP or SH-EPKDEL were prepared as
described in "Materials and Methods" and were analyzed by
SDS/PAGE-immunoblotting with anti-SH-EP antibody. B, Cell and medium fractions
from tobacco cell cultures expressing wild-type SH-EP or SH-EPKDEL were
prepared as described in "Materials and Methods" except for
extraction buffer (50 mM sodium acetate, pH 5.4, and 10
mM 2-mercaptoethanol). Both fractions were separated by 12.5% (w/v)
nondenaturing PAGE, and proteinase activities in the gel were visualized with
a gel-based gelatin plate method
(Mitsuhashi and Minamikawa
1989). Arrow indicates proteinase activity derived from SH-EP
(Mitsuhashi and Minamikawa
1989). C, Vacuoplasts and miniplasts were prepared from the
transformed tobacco cells expressing wild-type SH-EP as described in
"Materials and Methods." Both fractions were analyzed by
SDS/PAGE-immunoblotting with anti-SH-EP antibody. V.m., Crude extracts from
cotyledons of 3-d dark-grown V. mungo seedlings; C, cell fraction; M,
medium fraction.
|
|
To observe the subcellular localization of 43- or 33-kD SH-EP in tobacco
cells, cells expressing wild-type SH-EP were separated into vacuoplasts and
miniplasts. A vacuoplast is mostly composed of a vacuole that is surrounded
with a plasma membrane, and a miniplast is composed of intracellular
compartments other than vacuoles (Sonobe,
1990). That is, vacuoles and the other organelle, including ER and
KV-like vesicles, are separated into vacuoplast and miniplast fractions,
respectively. Both fractions were analyzed by SDS/PAGE-immunoblotting with
anti-SH-EP antibody (Fig. 6C).
In the vacuoplast fraction, 33-kD mature SH-EP and 43-kD proSH-EP were
observed, but only 43-kD SH-EP was detected in the miniplast fraction. The
band of 33-kD SH-EP was detected only in the vacuoplast fraction, indicating
that 33-kD SH-EP exists in vacuoles and that conversion of proSH-EP to the
mature form accompanies the transport of proSH-EP to the vacuoles. In
addition, 43-kD SH-EP was enriched in the miniplast fraction, possibly
suggesting that wild-type SH-EP was transiently accumulated in the ER and/or
KV-like vesicles, as has been shown in cotyledon cells
(Toyooka et al., 2000) and
insect Sf-9 cells expressing wild-type SH-EP
(Okamoto et al., 1999a). These
suggest that the intracellular transport and posttranslational processing of
wild-type SH-EP progressed in the tobacco cells in a manner similar to that in
the cotyledon cells.
In vivo labeling of the transformed cells expressing wild-type SH-EP with
35S-labeled amino acids and the subsequent immunoprecipitation with
anti-SH-EP antibody was carried out to monitor the traffic of SH-EP in tobacco
cells. Cell and medium fractions were prepared from the in vivo-labeled cells
at the indicated chase times to follow the changes with time in the molecular
masses of the SH-EP-related polypeptides. The 43-kD SH-EP band was detected in
cells at the end of the pulse (Fig.
7A). The band around 30 kD detected at 0-h chase is a nonspecific
signal. After a 4-h chase, the 33-kD SH-EP band appeared, and its intensity
gradually increased during a 12-h chase. As shown by the subcellular
fractionation of the cells and the subsequent analysis with
SDS/PAGE-immunoblotting (Fig.
6C), in vivo conversion of 43-kD SH-EP into 33-kD SH-EP
(Fig. 7A) is due to the
transport of the SH-EP to the vacuoles. Detection of the 33-kD SH-EP after a
4-h chase suggests that vacuolar sorting of wild-type SH-EP from the ER takes
at least 4 h. In the medium fraction of the cell culture, no radioactive
SH-EP-related polypeptide was observed
(Fig. 7A). This is consistent
with the finding that there was no polypeptide immunoreactive with anti-SH-EP
antibody in the medium fraction of the tobacco cell cultures
(Fig. 6A, KDEL+ lanes).
View larger version (69K):
[in this window]
[in a new window]
|
Figure 7. Pulse-chase analysis of SH-EP in transformed tobacco cells expressing
wild-type SH-EP (A) or SH-EPKDEL (B). Transformed cell cultures were
pulse-labeled with 35S-amino acids for 15 min and were chased with
unlabeled Met and Cys for the indicated periods of time. SH-EP-related
polypeptides in the cell or medium fraction from the cell cultures were
immunoprecipitated with anti-SH-EP antibody. The immunoprecipitated samples
were separated by SDS/PAGE and were detected by an imaging analyzer (BAS 2000;
Fuji Film, Tokyo).
|
|
Secretion and Vacuolar Transport of SH-EPKDEL in Tobacco BY-2
Cells
When the cell and medium fractions from the transformed tobacco cell
cultures expressing SH-EPKDEL were analyzed by SDS/PAGE-immunoblotting
with anti-SH-EP antibody, the 33-kD SH-EP band was detected in the medium
fraction, along with another weak signal in the cell fraction
(Fig. 6A, KDEL–lanes).
These results indicate that deletion of the KDEL tail from SH-EP resulted in
secretion of the enzyme and in a marked decrease of the efficiency of the
vacuolar transport of SH-EP. Next, pulse-chase experiments of the transformed
tobacco cell cultures were conducted. In the cell fraction, most of the 43-kD
SH-EP detected at 0-h chase disappeared during the 12-h chase, and a weak
signal from mature SH-EP was detected after 8-h of chase
(Fig. 7B). In the medium
fraction, the 43-kD SH-EP band, with a weak signal, was detected after a 1-h
chase, and thereafter, secreted proSH-EP was converted to mature 33-kD SH-EP
(Fig. 7B). This indicates that
SH-EPKDEL was secreted as proenzyme, and that the proSH-EPKDEL
was processed to a mature form in the medium. Because our earlier study of in
vitro processing of the recombinant proSH-EP revealed that the proenzyme has
the potential to be activated in an autocatalytic fashion at an acidic pH (pH
5.4–5.8; Okamoto et al.,
1999b), which corresponds to the pH of the culture medium of
tobacco cells, proSH-EP in the medium presumably was autocatalytically
activated. However, it cannot be ruled out that maturation of SH-EPKDEL
occurs en route to secretion rather than after secretion, because mature
protein was detected in cell fractions
(Fig. 7B). The mature SH-EP in
the medium fraction from the cell culture expressing SH-EPKDEL showed
proteinase activity (Fig. 6B,
KDEL–lanes), indicating that the KDEL tail of SH-EP is not needed for
the correct folding of the enzyme. This is consistent with the results from
detection of enzymatically active SH-EPKDEL that was heterologously
expressed in insect Sf9 cells (Okamoto et
al., 1999a). In contrast to the detection of enzymatic activity of
33-kD SH-EPKDEL in the medium fraction, that of mature SH-EPKDEL
in the cell fraction was not detected (Fig.
6B, KDEL–lanes). Although we have not addressed the reason,
SH-EPKDEL may be unstable in vacuoles or secretion route, and
therefore, the level of accumulation of the protein might remain low.
Intracellular Localization of GFP-Fused SH-EP or SH-EPKDEL in
Tobacco BY-2 Cells
Signal peptide (SP)-GFP-SHEP or SP-GFP-SHEP KDEL was expressed in
tobacco BY-2 cells to visualize their localizations in the cells. When
SP-GFP-SHEP was expressed, strong fluorescence was detected in small vesicles
(Fig. 8, A and B). The diameter
of the GFP-labeled small vesicles appeared to be similar to that of KV-like
vesicles, which were detected under immunogold microscopic observation of
cells of transformed Arabidopsis expressing wild-type SH-EP
(Fig. 2, A–E). These
results suggest that the GFP-labeled small vesicles correspond to KV-like
vesicles. In case of expression of SP-GFP-SHEPKDEL in tobacco cells,
such small vesicles were not detected (Fig.
8C). This suggests that KV-like vesicles are not induced in the
transformed cells expressing SP-GFP-SHEPKDEL, but in cells expressing
SP-GFP-SHEP.
|
DISCUSSION
|
|---|
The present study of the heterologous expression of wild-type SH-EP in
Arabidopsis and in tobacco BY2 cells showed that protein accumulated in
KV-like vesicles and was transported to vacuoles of cells. With expression of
KDEL-truncated SH-EP in Arabidopsis, an intense signal from the anti-SH-EP
antibody was detected at apoplastic spaces by immunocytochemical analyses
(Fig. 3), strongly suggesting
that SH-EPKDEL was secreted. However, the possibility that some portion
of SH-EPKDEL is transported to vacuoles cannot be excluded because the
volume of apoplast is much smaller than that of vacuoles, and
immunocytochemistry has a better chance of detecting signals in apoplasts than
in vacuoles, in which protein concentrations including SH-EPKDEL will
be at low levels. In fact, immunoblot and pulse-chase analyses with tobacco
cell culture expressing SH-EPKDEL revealed that mature SH-EPKDEL
(possible vacuolar form of SH-EP) existed in cell fractions in addition to
medium fractions (Figs. 6A and
7B), suggesting that the mutant
SH-EP appeared to be transported to vacuoles as well as secreted.
Alternatively, the possibility that maturation of the mutant protein occurs en
route to secretion cannot be excluded.
Putative vacuolar sorting receptor, termed VmVSR, has been isolated from
microsomes of cotyledons of V. mungo seedlings, and the receptor was
revealed to bind to the N-terminal propeptide of SH-EP
(Tsuru-Furuno et al., 2001).
This suggests that the N-terminal propeptide of SH-EP may possesses a vacuolar
targeting signal for SH-EP, and that SH-EPKDEL can be sorted to
vacuoles via the unidentified signal on the N-terminal prosequence. However,
deletion of KDEL from SH-EP resulted in the loss of formation/development of
KVs (Fig. 8), secretion of the
mutant protein, and in accumulation of SH-EPKDEL in cells at a low
level. This suggests that the putative vacuolar sorting signal on the
N-terminal propeptide of SH-EP is not enough for the formation of KVs, which
effectively transport wild-type SH-EP to vacuoles. The KDEL sequence of SH-EP
will be needed for formation of KVs and the subsequent mass transport of SH-EP
to vacuoles via KVs. Secretion of SH-EP resulted in growth defects of
transformed Arabidopsis through possible degradation of apoplastic proteins
(Fig. 5, A and B), indicating
that the efficient and mass transport of KDEL-proteinase via KV will be a
biologically important transport system in cells in which KDEL-proteinase is
highly expressed.
Recently, Frigerio et al.
(2001) reported a
KDEL-dependent vacuolar transport using transgenic tobacco expressing
KDEL-tagged phaseolin, a French bean (Phaseolus vulgaris) storage
protein. Interestingly, the phaseolin-KDEL was transported to vacuoles in a
Golgi complex-independent manner, as judged from the lack of modifications in
the sugar chain of the protein. This indicates that the Golgi
complex-independent vacuolar sorting is not specific to the KDEL-tailed Cys
proteinases, but is an alternative transport mechanism for KDEL-tailed
proteins. Other than Cys proteinases, three RNases are known to have a
putative ER retention sequence, RDEL or HDEF, at the C terminus; these enzymes
are expressed during xylogenesis (Ye and
Droste, 1996) or stress treatment
(Kaletta et al., 1998). These
enzymes may be sorted to vacuoles via KV-like vesicles, because an efficient
transport system via KV-like vesicles permits cells to deliver mass proteins
to vacuoles, while cells should also be able to quickly differentiate or
respond to the environment.
In cotyledon cells of transgenic Arabidopsis expressing signal peptide
(SP)-GFP-HDEL, spindle-shaped structures have been observed
(Haseloff et al., 1997;
Gunning, 1998;
Kohler, 1998). Hayashi et al.
(2001) indicated that the
spindle-shaped structures, termed ER bodies, fuse with vacuoles when the cells
are stressed with a 0.1 M salt solution. It was also revealed that
two stress-inducible vacuolar protease, non-KDEL-tailed proteases, are
sequestered into ER bodies, suggesting that ER bodies are sorting
vesicles/organelles for stress-inducible vacuolar proteins to vacuoles. In
addition, it has recently been indicated that ER bodies are induced in rosette
leaves of Arabidopsis by the application of methyl jasmonate, a plant hormone
involved in the defense against wounding and chewing by insects
(Matsushima et al., 2002). ER
bodies have some different characteristics from KVs, and are specifically
observed in epidermal cells of Arabidopsis seedlings even if the SP-GFP-HDEL
was driven under cauliflower mosaic virus 35S promoter. In contrast, KVs were
formed/induced in cells of most tissues by expression of SH-EP under the same
promoter in Arabidopsis (Fig.
2). The shape and size of KVs are also different from ER bodies.
In the case of KVs, it has been reported that approximately 90% of luminal
proteins of ricinosome, a KV-like vesicle detected in endosperm cells of
castor bean (Ricinus communis) seedlings, are occupied with the
proform of a KDEL-tailed Cys proteinase (pro-Cys-EP), suggesting that the KV
is a specific vesicle for the enzyme
(Schmid et al., 2001).
However, KV and ER bodies may be formed at the ER and fuse with vacuoles using
similar or identical molecular machineries because both vesicles emerge from
ER and directly fuse with vacuoles.
KDEL-tailed Cys proteinases such as SH-EP are present exclusively in the
plant kingdom, and are expressed in senescing organs in which rapid and
massive protein mobilization occurs
(Tanaka et al., 1993;
Yamauchi et al., 1992;
Valpuesta et al., 1995;
Becker et al., 1997;
Guerrero et al., 1998;
Cercos et al., 1999). It seems
likely that higher plants use the KDEL tail as an enhancer for vacuolar
transport of KDEL-proteinases to massively and rapidly degrade proteins in
senescing organs. The ER of plant cells has enormous plasticity (for review,
see Chrispeels and Herman,
2000). In fact, KV-like vesicles were induced/developed in cells
of most transgenic plant tissues by heterologous expression of wild-type
SH-EP, providing an example of the plasticity.
|
MATERIALS AND METHODS
|
|---|
Antibody, SDS/PAGE, Immunoblotting, and Gel-Based Proteinase
Assay
Antibody against SH-EP was purified from anti-SH-EP antiserum by a
recombinant SH-EP-conjugated affinity column as described by Toyooka et al.
(2000). SDS/PAGE was conducted
on 12.5% (w/v) gels, and immunoblotting and gel-based proteinase assays were
performed as described elsewhere
(Mitsuhashi et al., 1986;
Mitsuhashi and Minamikawa,
1989).
Preparations of Transgenic Arabidopsis and Tobacco (Nicotiana
tabacum) BY-2 Cells Expressing Wild-Type SH-EP or Its KDEL Deletion
Mutant (SH-EPKDEL)
pUC119 vector harboring full-length SH-EP cDNA was digested with
XbaI and SacI to excise SH-EP cDNA, and the cDNA was
subcloned into the binary vector pBI121 cut with the same enzymes. cDNA
encoding KDEL-deleted mutant SH-EP, in which Lys codon (AAA) in C-terminal
KDEL sequence was changed to a stop codon (TAA)
(Okamoto et al., 1999a), was
cut out of pVL1393 vector (BD PharMingen, San Diego) containing the cDNA using
XbaI and PstI. The cDNA was blunted using a DNA blunting kit
(Takara, Otsu, Japan) and was subsequently subcloned into pUC119 vector
cleaved with SmaI. The resultant vector harboring KDEL-deleted SH-EP
cDNA was cleaved by XbaI and SacI to excise the cDNA insert,
and the insert was then subcloned into a pBI121 vector cut with the same
enzymes. pBI121 vector harboring SH-EP or KDEL-deleted SH-EP cDNA at
downstream of the cauliflower mosaic virus 35S promoter was used for
Agrobacterium tumefaciens-mediated transformation of
suspension-cultured BY-2 tobacco cells and BY-2 cells were cultured according
to Matsuoka and Nakamura
(1991). Arabidopsis (ecotype
Columbia) was transformed by the in planta method
(Bechtold and Pelletier, 1998)
with the transformed A. tumefaciens as described above. Arabidopsis
plants were grown at 22°C under a 16-h light/8-h dark cycle.
Preparations and Microscopic Observations of Transgenic Tobacco BY-2
Cells Expressing SP-GFP-SHEP or Its KDEL Deletion Mutant
(SP-GFP-SHEPKDEL)
SP of SH-EP was amplified by PCR using TCTATGAAGAAGCTCTTGTGGGT and
CCATGGCTTGGCCACTCCAAGAAC as primers and SH-EP cDNA as template. The amplified
fragment was subcloned to pGEM-T Easy vector (Promega, Madison, WI), and the
vector was cut by XbaI and NcoI. The insert was subcloned
into XbaI-NcoI site of 35S promoter-GFP(S65T) plasmid
(Chiu et al., 1996) to produce
pSP-GFP. The chimeric gene encodes 26-amino acid signal peptide followed by
GFP. For chimeric gene encoding SP-GFP-SHEP, the DNA region encoding proSH-EP
was amplified by PCR with using TGTACAAGTTTGATTTTCATGAGAAGGA and
GAGCTCTCAAAGTTCATCTTTGGGAG as primers and SH-EP cDNA as template. After
subcloning the amplified fragment to pGEM-T Easy vector, the vector was cut by
BsrGI and NotI, and the excised fragment encoding proSH-EP
was inserted into BsrGI-NotI site of pSP-SHEP to produce
pSP-GFP-SHEP. pSP-GFP-SHEPKDEL was produced with the same procedures as
those for pSP-GFP-SHEP except for using cDNA encoding KDEL-deleted SH-EP as
PCR template. pSP-GFP-SHEP or pSP-GFP-SHEPKDEL was digested with
XbaI and SacI to excise DNA region for SP-GFP-SHEP or
SP-GFP-SHEPKDEL, and the insert was subcloned into the binary vector
pBI121 cut with the same enzymes. A. tumefaciens-mediated
transformation of tobacco BY-2 cells was conducted as above. DNA sequences of
all PCR products were verified by DNA sequencing.
Transformed tobacco cells were cultured as described
(Matsuoka and Nakamura, 1991).
At 3 d after inoculation of the cells, cells were observed with a fluorescent
microscope (IX70; Olympus, Melville, NY) with U-MNIB filter set, or with a
confocal laser scanning microscopy (LSM 410; Zeiss, Jena, Germany) with 488 nm
excitation and 510 to 520 nm emission wavelengths.
Immunogold Electron Microscopy
Stems, rosette leaves, and flowers were harvested from fully grown
transgenic Arabidopsis. Cotyledons were collected from 3-d-old dark-grown
Arabidopsis seedlings. Each tissue was fixed with 4% (w/v) paraformaldehyde
and 2% (w/v) glutaraldehyde in 0.1 M potassium phosphate buffer (pH
7.2) for 4 h at 4°C. After fixation of the tissues, they were dehydrated
in a graded methanol series and the dehydrated pieces were embedded in a hard
formulation of LR White resin. Ultrathin sections mounted on nickel grids (600
mesh; Electron Microscopy Sciences, Fort Washington, PA) were blocked with 10%
(w/v) fetal bovine serum in Tris-buffered saline (TBS; 25 mM
Tris-Cl, pH 7.4, and 150 mM NaCl) for 20 min at room temperature.
The sections were then labeled with affinity-purified antibody to SH-EP (1:10)
in TBS. After being washed with TBS, the sections were indirectly labeled with
colloidal gold particles coupled to goat anti-rabbit immunoglobulin G. The
gold-labeled sections were then washed with TBS, rinsed in water, and stained
with 4% (w/v) aqueous uranyl acetate. The grids were examined and photographed
with a transmission electron microscope (model 1010EX; JEOL, Tokyo, Japan) at
80 kV.
Fractionation of Tobacco Cell Cultures
Cell, medium, vacuoplast, and miniplast fractions were prepared from
5-d-old cultures. A 1-mL aliquot of the cell culture was centrifuged at
2,000g for 3 min, and the precipitate and supernatant were used for
further preparations of the cell and medium fractions, respectively. The
supernatant was again centrifuged at 5,000g for 10 min, and the
supernatant used as the medium fraction. The cells precipitated by
centrifugation at 2,000g were resuspended in fresh BY-2 culture
medium and then centrifuged again at 2,000g for 3 min. This procedure
was carried out again and the precipitated cells were resuspended in 0.5 mL of
TBS (20 mM Tris-Cl, pH 7.5, and 150 mM NaCl) containing
0.05% (w/v) SDS, 0.05% (w/v) Triton X-100, 1 mM EDTA, 1
mM phenylmethane sulfonyl fluoride, and 1 mM
N-ethylmaleimide. The suspension was sonicated (3 x 1 min, 30W,
UR-20P; Tomy Seiko, Tokyo), and the sample was centrifuged at 15,000g
for 10 min. The volume of the supernatant was then adjusted to that of the
medium fraction and was used as the cell fraction.
Protoplasts were prepared from tobacco-cultured cells as described
(Matsuoka and Nakamura, 1991),
and miniplasts and vacuoplasts were isolated from the protoplasts according to
Sonobe (1990). In brief,
protoplasts prepared from 2 mL of tobacco cells were resuspended in 30 mL of
0.7 M mannitol, pH 7.0, containing 30% (v/v) Percoll (Pharmacia,
Piscataway, NJ) and 20 mM MgCl2, and the resuspension
was centrifuged at 10,000g for 60 min. Two layers were generated by
the centrifugation of the protoplasts. The upper and lower layers in the
centrifuge tube were isolated and used as vacuoplasts and miniplast fractions,
respectively. Both fractions were checked by observation with light
microscopy.
Pulse-Chase Experiments
Pulse-chase experiments with the transformed cells were conducted
essentially as described (Matsuoka et al.,
1990; Matsuoka and Nakamura,
1991). Cells from 5-d-old cultures were centrifuged at
2,000g for 3 min, and the precipitated cells were resuspended in an
equal volume of fresh BY-2 medium. A 0.5-mL aliquot of the resuspended cells
was incubated with 2.1 MBq of Tran35S-label (ICN Pharmaceuticals,
Cost Mesa, CA) at 28°C for 15 min, and then 50 µL of 50 mM
Met-Cys was added. The cell and medium fractions were prepared from the chased
cells as described above, and SH-EP-related polypeptides were
immunoprecipitated with anti-SH-EP antibody. The immunoprecipitated proteins
were separated by SDS/PAGE and were detected by photophorimaging with an image
analyzer (BAS 2000; Fuji Film).
|
ACKNOWLEDGMENTS
|
|---|
We thank Dr. Yasuo Niwa (University of Shizuoka, Shizuoka) for providing
the 35S-GFP(S65T) plasmid, and Dr. Masaki Ito (University of Tokyo, Tokyo) for
providing tobacco BY-2 cells.
Received January 28, 2003;
returned for revision February 26, 2003;
accepted April 29, 2003.
|
FOOTNOTES
|
|---|
Article, publication date, and citation information can be found at
www.plantphysiol.org/cgi/doi/10.1104/pp.103.021147.
1 This work was supported in part by the Ministry of Education, Science and
Culture of Japan (Grant-in-Aid for Scientific Research no. 12740441) and by
the Japan Science Society (Sasakawa Scientific Research grant no.
12–246). 
2 Present address: Universität Hamburg, Institut für Allgemeine
Botanik, AMP 2, Ohnhorststrasse 18, 22609 Hamburg, Germany.
*
Corresponding author; e-mail
okamoto-takashi{at}c.metro-u.ac.jp;
fax 49–40–428–16–229.
|
LITERATURE CITED
|
|---|
Akasofu H, Yamauchi D, Mitsuhashi W, Minamikawa T
(1989) Nucleotide sequence of cDNA for sulfhydryl-endopeptidase
(SH-EP) from cotyledons of germinating Vigna mungo seeds.
Nucleic Acids Res 17:
6733[Free Full Text]
Bechtold N, Pelletier G (1998) In planta
Agrobacterium-mediated transformation of adult Arabidopsis
thaliana plants by vacuum infiltration. Methods Mol Biol
82:
259–266[Medline]
Becker C, Senyuk VI, Shutov AD, Nong VH, Fischer J, Horstmann
C, Muntz K (1997) Proteinase A, a
storage-globulin-degrading endopeptidase of vetch (Vicia sativa L.)
seeds, is not involved in early steps of storage-protein mobilization.
Eur J Biochem 248:
304–312[Web of Science][Medline]
Cercos M, Santamaria S, Carbonell J (1999)
Cloning and characterization of TPE4A, a thiol-protease gene induced during
ovary senescing and seed germination in pea. Plant Physiol
119:
1341–1348[Abstract/Free Full Text]
Chiu W-I, Niwa Y, Zeng W, Hirano T, Kobayashi H, Sheen J
(1996) Engineered GFP as a vital reporter in plants. Curr
Biol 6:
325–330[CrossRef][Web of Science][Medline]
Chrispeels MJ, Herman EM (2000) ER-derived
compartments function in storage and as mediators of vacuolar remodeling via a
new type of organelle, precursor protease vesicle (PPV). Plant
Physiol 123:
1227–1234[Free Full Text]
Denecke J, De Rycke R, Botterman J (1992) Plant
and mammalian sorting signals for protein retention in the endoplasmic
reticulum contain a conserved epitope. EMBO J
11:
2345–2355[Web of Science][Medline]
Frigerio L, Pastres A, Prada A, Vitale A (2001)
Influence of KDEL on the fate of trimeric or assembly-defective phaseolin:
selective use of an alternative route to vacuoles. Plant Cell
13:
1109–1126[Abstract/Free Full Text]
Guerrero C, Calle M, Reid MS, Valpuesta V
(1998) Analysis of the expression of two thiolprotease genes from
daylily (Hemerocallis spp.) during flower senescence. Plant
Mol Biol 36:
565–571[CrossRef][Web of Science][Medline]
Gunning BES (1998) The mystery organelles in
Arabidopsis expressing GFP. Trends Plant Sci
3: 417[CrossRef][Web of Science]
Haseloff J, Siemering KR, Prasher DC, Hodge S
(1997) Removal of a cryptic intron and subcellular localization
of green fluorescent protein are required to mark transgenic Arabidopsis
plants brightly. Proc Natl Acad Sci USA
94:
2122–2127[Abstract/Free Full Text]
Hayashi Y, Yamada K, Shimada T, Matsushima R, Nishizawa NK,
Nishimura M, Hara-Nishimura I (2001) A proteinase-sorting
body that prepares for cell death or stress in the epidermal cells of
Arabidopsis. Plant Cel Physiol
42:
894–899
Herman EM, Larkins BA (1999) Protein storage
vacuoles. Plant Cell 11:
601–613[Free Full Text]
Herman EM, Tague BW, Hoffman LM, Kjemtrup SE, Chrispeels MJ
(1990) Retention of phytohaemagglutinin with carboxy terminal
tetrapeptide KDEL in the nuclear envelope and the endoplasmic reticulum.
Planta 182:
305–312
Kaletta K, Kunze I, Kunze G, Kock M (1998) The
peptide HDEF as a new retention signal is necessary and sufficient to direct
proteins to the endoplasmic reticulum. FEBS Lett
434:
377–381[CrossRef][Web of Science][Medline]
Kohler RH (1998) GFP for in vivo
imaging of subcellular structures in plant cells. Trends Plant
Sci 3:
317–320[CrossRef][Web of Science]
Lee HI, Gal S, Newman TC, Raikhel NV (1993) The
Arabidopsis endoplasmic reticulum retention receptor functions in yeast.
Proc Natl Acad Sci USA 90:
11433–11437[Abstract/Free Full Text]
Lee KM, Liu ZW, Tan-Wilson AL, Wilson WA (1997)
Transcript levels for a mung bean cysteine protease during early seedling
growth. Seed Sci Res 7:
359–372
Matsuoka K, Matsumoto S, Hattori T, Nakamura K
(1990) Vacuolar targeting and posttranslational processing of the
precursor to the sweet potato tuberous root storage protein in heterologous
plant cells. J Biol Chem 265:
19750–19757[Abstract/Free Full Text]
Matsuoka K, Nakamura K (1991) Propeptide of a
precursor to a plant vacuolar protein required for vacuolar targeting.
Proc Natl Acad Sci USA 88:
834–838[Abstract/Free Full Text]
Matsushima R, Hayashi Y, Kondo M, Shimada T, Nishimura M,
Hara-Nishimura I (2002) An endoplasmic
reticulum-derived structure that is induced under stress conditions in
Arabidopsis. Plant Physiol 130:
1807–1814[Abstract/Free Full Text]
Mitsuhashi W, Koshiba T, Minamikawa T (1986)
Separation and characterization of two endopeptidases from cotyledons of
germinating Vigna mungo seeds. Plant Physiol
80:
628–634[Abstract/Free Full Text]
Mitsuhashi W, Minamikawa T (1989) Synthesis and
posttranslational activation of sulfhydryl-endopeptidase in cotyledons of
germinating Vigna mungo seeds. Plant Physiol
89:
274–279[Abstract/Free Full Text]
Munro S, Pelham HBR (1987) A C-terminal signal
prevents secretion of luminal ER proteins. Cell
48:
899–907[CrossRef][Web of Science][Medline]
Napier RM, Fowke LC, Hawes CR, Lewis M, Pelham HBR
(1992) Immunological evidence that plants use both HDEL and KDEL
for targeting proteins to the endoplasmic reticulum. J Cell Sci
102:
261–271[Abstract/Free Full Text]
Okamoto T, Minamikawa T (1998) A vacuolar
cysteine endopeptidase (SH-EP) that digests seed storage globulin:
characterization, regulation of gene expression, and posttranslational
processing. J Plant Physiol 152:
675–682[Web of Science]
Okamoto T, Minamikawa T, Edward C, Vakharia V, Herman E
(1999a) Posttranslational removal of the carboxy-terminal KDEL of
the cysteine protease SH-EP occurs prior to maturation of the enzyme. J
Biol Chem 274:
11390–11398[Abstract/Free Full Text]
Okamoto T, Nakayama H, Seta K, Isobe T, Minamikawa T
(1994) Posttranslational processing of a carboxy-terminal
propeptide containing a KDEL sequence of plant vacuolar cysteine endopeptidase
(SH-EP). FEBS Lett 351:
31–34[CrossRef][Web of Science][Medline]
Okamoto T, Toyooka K, Minamikawa T (2001)
Identification of a membrane-associated cysteine protease (MCP) with possible
dual roles in the endoplasmic reticulum and protein storage vacuole. J
Biol Chem 276:
742–751[Abstract/Free Full Text]
Okamoto T, Yuki A, Mitsuhashi N, Minamikawa T
(1999b) Asparaginyl endopeptidase (VmPE-1) and autocatalytic
processing synergistically activate the vacuolar cysteine proteinase (SH-EP).
Eur J Biochem 264:
223–232[Web of Science][Medline]
Pelham HBR (1989) Control of protein exit from
the endoplasmic reticulum. Annu Rev Cell Biol
5:
1–23[CrossRef][Web of Science][Medline]
Schmid M, Simpson D, Kalousek F, Gietl C (1998)
A cysteine endopeptidase with a C-terminal KDEL motif isolated from castor
bean endosperm is a marker enzyme for the ricinosome, a putative lytic
compartment. Planta 206:
466–475[CrossRef][Web of Science][Medline]
Schmid M, Simpson DJ, Sarioglu H, Lottspeich F, Gietl C
(2001) The ricinosomes of senescing plant tissue bud from the
endoplasmic reticulum. Proc Natl Acad Sci USA
98:
5353–8535[Abstract/Free Full Text]
Sonobe S (1990) Cytocharasin B enhances
cytokinetic cleavage in miniplasts isolated from cultured tobacco cells.
Protoplasma 155:
239–242[CrossRef][Web of Science]
Tanaka T, Minamikawa T, Yamauchi D, Ogushi Y
(1993) Expression of an endopeptidase (EP-C1) in Phaseolus
vulgaris plants. Plant Physiol
101:
421–428[Abstract]
Toyooka K, Okamoto T, Minamikawa T (2000) Mass
transport of a proform of a KDEL-tailed cysteine proteinase (SH-EP) to protein
storage vacuoles by endoplasmic reticulum-derived vesicle is involved in
protein mobilization in germinating seeds. J Cell Biol
148:
453–563[Abstract/Free Full Text]
Tsuru-Furuno A, Okamoto T, Minamikawa T (2001)
Isolation of a putative receptor for KDEL-tailed cysteine proteinase (SH-EP)
from cotyledons of Vigna mungo seedlings. Plant Cell
Physiol 42:
1062–1070[Abstract/Free Full Text]
Valpuesta V, Lange NE, Guerrero C, Reid MS
(1995) Up-regulation of a cysteine protease accompanies the
ethylene-insensitive senescence of daylily (Hemerocallis spp.)
flowers. Plant Mol Biol 28:
575–582[CrossRef][Web of Science][Medline]
Wandelt CI, Khan MRI, Craig S, Schroeder HE, Spencer D, Higgins
TJV (1992) Vicilin with carboxy-terminal KDEL is retained in
the endoplasmic reticulum and accumulates to high levels in the leaves of
transgenic plants. Plant J 2:
181–192[Web of Science][Medline]
Yamauchi D, Akasofu H, Minamikawa T (1992)
Cysteine endopeptidase from Vigna mungo: gene structure and
expression. Plant Cell Physiol
33:
789–797[Abstract/Free Full Text]
Ye Z-H, Droste DL (1996) Isolation and
characterization of cDNAs encoding xylogenesis-associated and wounding-induced
ribonucleases in Zinnia elegance. Plant Mol Biol
30:
697–709[CrossRef][Web of Science][Medline]
This article has been cited by other articles:
|
|
|
|
 
T. Motoyama, N. Maruyama, Y. Amari, K. Kobayashi, H. Washida, T. Higasa, F. Takaiwa, and S. Utsumi
{alpha}' Subunit of soybean {beta}-conglycinin forms complex with rice glutelin via a disulphide bond in transgenic rice seeds
J. Exp. Bot.,
October 1, 2009;
60(14):
4015 - 4027.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Yamada, A. J. Nagano, M. Nishina, I. Hara-Nishimura, and M. Nishimura
NAI2 Is an Endoplasmic Reticulum Body Component That Enables ER Body Formation in Arabidopsis thaliana
PLANT CELL,
September 1, 2008;
20(9):
2529 - 2540.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Prins, P. D.R. van Heerden, E. Olmos, K. J. Kunert, and C. H. Foyer
Cysteine proteinases regulate chloroplast protein content and composition in tobacco leaves: a model for dynamic interactions with ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) vesicular bodies
J. Exp. Bot.,
May 1, 2008;
59(7):
1935 - 1950.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Nakaminami, D. T. Karlson, and R. Imai
Functional conservation of cold shock domains in bacteria and higher plants
PNAS,
June 27, 2006;
103(26):
10122 - 10127.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. Beyene, C. H. Foyer, and K. J. Kunert
Two new cysteine proteinases with specific expression patterns in mature and senescent tobacco (Nicotiana tabacum L.) leaves
J. Exp. Bot.,
March 1, 2006;
57(6):
1431 - 1443.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. Galili
ER-Derived Compartments Are Formed by Highly Regulated Processes and Have Special Functions in Plants
Plant Physiology,
November 1, 2004;
136(3):
3411 - 3413.
[Full Text]
[PDF]
|
|
|
|
|
|
|
I. Hara-Nishimura, R. Matsushima, T. Shimada, and M. Nishimura
Diversity and Formation of Endoplasmic Reticulum-Derived Compartments in Plants. Are These Compartments Specific to Plant Cells?
Plant Physiology,
November 1, 2004;
136(3):
3435 - 3439.
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
RESULTS
