| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
|
First published online August 7, 2003; 10.1104/pp.102.018309 Plant Physiology 133:319-327 (2003) © 2003 American Society of Plant Biologists Heat Sensitivity in a Bentgrass Variant. Failure to Accumulate a Chloroplast Heat Shock Protein Isoform Implicated in Heat Tolerance1Department of Biochemistry and Molecular Biology, Mississippi State University, Mississippi State, Mississippi 39762
Two variants of creeping bentgrass (Agrostis stolonifera cv palustris), developed using tissue culture, have been used to determine the roles of chloroplast-localized small heat shock proteins (CP-sHSPs) in heat tolerance. Results from previous research indicate that the heat-tolerant variant expressed two additional CP-sHSP isoforms not expressed in the heat-sensitive variant, that accumulation of the additional CP-sHSP isoforms was genetically linked to thermotolerance, and that the presence of the additional isoforms in the heat-tolerant variant provided greater protection to photosystem II during heat stress. To determine the basis of the differential expression, we isolated the genes encoding the CP-sHSPs from both variants and characterized their structure and expression. Two genes, ApHsp26.2 and ApHsp26.7a, were isolated from the heat-tolerant variant, and three genes, ApHsp26.2m, ApHsp26.8, and ApHsp26.7b, were isolated from the heat-sensitive variant. The sequence of ApHsp26.2m from the heat-sensitive variant was identical to ApHsp26.2, except for a point mutation that generated a premature stop codon. Therefore, the protein product of ApHsp26.2m did not accumulate in the heat-sensitive line. Mass spectrometry analysis confirmed that ApHsp26.2 encoded for the CP-sHSP isoforms unique to the heat-tolerant variant. An identical mutation was detected in one of the three parental lines used to develop the creeping bentgrass variants. This suggests that ApHsp26.2m was inherited from this parent and did not arise from a mutation that occurred during tissue culture. The presence of two isoforms encoded by the same gene might be due to differential processing of the N-terminal amino acids during or after import into the chloroplast.
When plants are exposed to heat stress, they respond by synthesizing a set of protective proteins, the heat shock proteins (HSPs) (Howarth, 1991  ). Synthesis of HSPs results in acquired thermotolerance, which allows plants previously subjected to moderately high temperatures to survive subsequent exposure to lethal temperatures (Yarwood, 1961; Lin et al., 1984; Lindquist, 1986). HSPs generally act as molecular chaperones that prevent protein misfolding and aggregation (Vierling, 1991). There are two major groups of HSPs in plants: the high-molecular mass HSPs ranging from 60 to 100 kD and small HSPs (sHSPs) ranging from 15 to 30 kD (Vierling, 1991). The sHSPs are much more abundant in higher plants than in other organisms (Vierling, 1991). They are classified into five gene families based on sequence homology and intracellular localization. Classes I and II are localized to the cytosol, and the other three classes are localized to the chloroplast, endoplasmic reticulum, and mitochondria (Vierling, 1991; Waters et al., 1996).
Studies using transgenic plants have shown that enhanced heat tolerance in higher plants is correlated with HSP101 expression in Arabidopsis (Hong and Vierling, 2000
In tomato (Lycopersicon esculentum) cultivars (Preczewski et al., 2000
We have been using two variants of Penncross, a cultivar of creeping bentgrass (Agrostis stolonifera cv palustris Huds.; Hanson, 1959
In addition to expressing the additional CP-sHSP isoforms, SB recovered from heat stress faster and was able to resume normal levels of protein synthesis approximately 2 h earlier than NSB (Park et al., 1997 To further elucidate the mechanism of heat tolerance in these two variants and to determine why there is differential expression of the CP-sHSP isoforms, we isolated and sequenced the CP-sHSP gene family members in both NSB and SB and characterized their expression and probable inheritance.
Isolation of CP-sHSP Genes PCR-based genomic walking was used to isolate two genes (ApHsp26.2 and ApHsp26.7a) from SB and three genes (ApHsp26.2m, ApHsp26.7b, and ApHsp26.8) from NSB. The cDNA sequences of these ApHsp26 family members shared more than 88% similarity, whereas the 5'-untranslated region (UTR), 3'-UTR, and intron regions were less conserved. The deduced amino acid sequences of ApHsp26.7a and b differed by five nucleotides, two of which caused changes in amino acids. ApHsp26.7a has Ser instead of Arg at position 30 and Tyr instead of Ala at position 80. Because the sequence of the promoter regions and UTRs are highly conserved between ApHsp26.7a and ApHsp26.7b (data not shown), they are probably the same gene with single-nucleotide polymorphisms.
When the nucleotide sequence for ApHsp26.2 isolated from SB was compared with the corresponding gene in NSB (ApHsp26.2m), two mutations in ApHsp26.2m were identified. A T was substituted for a C at codon 68, which converts the codon (CAG) for Gln to a stop codon (TAG). There also was an insertion 43 nucleotides downstream of the first mutation. However, this should have no effect on protein expression because it was downstream from the premature stop codon. The promoter regions of ApHsp26.2, ApHsp26.2m, and ApHsp26.8 contain a homopurine stretch, which may be a nuclear matrix attachment site, near -450, but ApHsp26.7 did not (Nover, 1989 The deduced amino acid sequences indicated that all of the putative ApHsp26 proteins contained a chloroplast transit peptide, the Met-rich region, and consensus regions I and II (Fig. 1). Among these genes, the deduced amino acid sequences of ApHsp26.2 and ApHsp26.8 shared the highest sequence similarity (97.9%). The major difference between ApHsp26.2 and the other proteins is the absence of a seven-amino acid block (DGAEGQG) between consensus regions I and II that is present in the others (Fig. 1). The deduced molecular masses and isoelectric points of the ApHsp26 isoforms after removal of the chloroplast transit sequence are shown in Table I. The protein encoded by ApHsp26.2 was smaller and more basic than the other isoforms.
Because the DNA sequence similarity among ApHsp26 family members was higher than 88%, RTPCR analysis was used to determine the transcriptional level of each gene. One common upstream primer was designed from the 5'-UTR, and three downstream gene-specific primers were designed from the 3'-UTRs, the most variable region of each gene. Results from RT-PCR indicate that transcripts of the correct size (795, 815, and 863 bp for ApHsp26.2, ApHsp26.8, and ApHsp26.7, respectively) accumulated during heat shock and not at the control temperature (Fig. 2). The transcript corresponding to ApHsp26.2 appeared to be less abundant in NSB than SB. ApHsp26.8 could not be amplified from SB genome, and this probably accounts for the absence of its transcript in SB. Heat shock resulted in the nearly equal accumulation of transcripts for ApHsp26.7 and ApHsp16 (GenBank accession no. AF007762) in both variants, which indicated that the amount or quality of RNA used for RT-PCR did not account for the difference in ApHsp26.2 expression between SB and NSB. Primers for actin were used as a positive control, and its transcript was present in all samples, but it appeared to be less abundant in the heat-shocked plants. When RT-PCR was conducted in the absence of avian myeloblastosis virus-RT, there was no product verifying that there was no genomic DNA contamination of the RNA samples (Fig. 2).
Seeds of the cultivar Penncross are produced by random crossing of three bentgrass parental lines: 9(38)5, 10(37)4, and 11(38)4 (Hanson, 1959
Results from immunoblot analysis showed that the smaller and more basic isoforms absent in NSB also were absent in 9(38)5 (Fig. 4). This provides additional evidence that suggests that ApHsp26.2 encodes at least one of the unique isoforms present only in SB.
Two CP-sHSPs genes (ApHsp26.2 and ApHsp26.7a) are expressed in SB. Although these two genes share 89.8% similarity in their deduced amino acid sequences, the predicted tryptic peptide fingerprints are different and, only six of 15 peptides have the same masses (Table II). In NSB, the predicted tryptic peptide fingerprints of ApHSP26.8 and ApHSP26.7b also are different (Table II). These differences allowed us to use MALDI-TOF MS to predict the gene that encoded each CP-sHSP isoform. Heat-shocked and control samples of SB and NSB were separated by two-dimensional gel electrophoresis and stained with Coomassie Brilliant Blue (Fig. 5). The stained two-dimensional gels, immunoblots (Fig. 4), and in vivo labeling analysis (Park et al., 1996
When the spectra of the SB isoforms (Regions 1 and 2) were compared with the predicted tryptic peptide fingerprints of ApHsp26.2 and ApHSP26.7a (Table II), six peptides from Region 1 matched ApHsp26.2, and five peptides from Region 2 matched ApHsp26.7a (Table III). The key difference between ApHsp26.2 and ApHsp26.7a was the presence of the peptide (EAGEGQGDWWK) with a mass of 1,319.75. As predicted from the derived amino acid sequences (Fig. 1), this peptide is missing the seven-amino acid sequence (DGAEGQG) that is present in the corresponding tryptic peptide (EVSEGQGDGAEGQG- DGWWK) present in the other isoforms. This larger tryptic fragment with a mass of 1,991.80 was present in ApHsp26.7a. This indicated that the smaller isoform, unique to SB and the parental lines 10(37)4 and 11(38)4, probably is encoded by ApHsp26.2 and the larger isoform in Region 2 by ApHsp26.7a. When spectra of the isoforms in NSB (Region 3) were compared with the predicted tryptic peptide fingerprints of ApHsp26.8 and ApHsp26.7b, four trypsin-digested peptides matched ApHsp26.8, and five peptides matched ApHsp26.7b (Table III). The peptide (EAGEGQGDWWK) with a mass of 1,319.75 that distinguishes ApHsp26.2 from the other isoforms was not present in the spectra of the peptides from NSB. Therefore, the major isoform in NSB appeared to contain a mixture of proteins encoded by ApHsp26.8 and ApHsp26.7b.
N-terminal sequencing of the CP-sHSPs was conducted to further characterize the CP-sHSP isoforms, especially the doublets within each region (Fig. 5) because they generated the same peptide mass fingerprints. However, only the lower spots from Regions 1 and 3 gave reliable N-terminal sequences. The N-terminal sequence obtained for the lower doublet band in Region 1 was ASQENR, which was identical to the deduced amino acid sequence beginning at position 47 of ApHsp26.2 (Fig. 1). The N-terminal sequence obtained for the lower spot in Region 3 was ASQ(D/E)NRD, which appears to be a mixture of N-terminal sequences from ApHSP26.8 (ASQENRD) and ApHSP26.7b (ASQDNRD). The observed transit peptide cleavage site differs by two amino acids from the predicted site (Fig. 1). Because the upper and lower spots from each region gave the same peptide mass fingerprint, the upper spots may have been cleaved at the predicted site. The amino acids at the predicted cleavage site are not charged, so the cleavage variants would have the same pI but slightly different masses, as observed on two-dimensional gels.
Heat tolerance in the bentgrass variant SB is genetically linked to the ability to synthesize additional CP-sHSP isoforms that do not accumulate in NSB (Park et al., 1996 ; Luthe et al., 2000). Results from physiological studies suggest that PSII activity is more robust during heat stress in SB than in NSB (Heckathorn et al., 2002). This appears to be due to protection of proteins in the oxygen evolving complex by either a direct or indirect association of the CP-sHSPs with thylakoids (Heckathorn et al., 2002). This study focused on determining why the additional CP-sHSP isoforms accumulate in SB but not NSB. It is possible that the gene encoding the additional isoforms is present in genome of SB but not NSB or that mutations in the promoter region prevent its expression in NSB or enhance its expression SB. Alternatively, expression could be regulated transcriptionally or posttranscriptionally. Translational or posttranslational factors also may regulate its accumulation (Zimmerman et al., 1989). To determine why there was differential expression, five CP-sHSP genes were isolated from SB and NSB. We cannot be certain that all CP-sHSP genes were isolated. Primers from the conserved Met-rich and consensus regions I and II were used to amplify the CP-sHSP genes. It is possible, but unlikely, that there are CP-sHSP genes with reduced homology in these regions that were not amplified. ApHsp26.2 and ApHsp26.7a were isolated from SB and ApHsp26.2m, ApHsp26.8, and ApHsp26.7b were isolated from NSB. The nucleotide sequence of ApHsp26.2 and ApHsp26.2m are the same except for two point mutations. The first mutation resulted in a premature stop codon at position 68, which results in a truncated protein. If the encoded protein was expressed and imported into the chloroplast, it would have an apparent molecular mass of only 2 kD. Because the antibody used in this study specifically recognized the Met-rich region in the middle of the CP-sHSP, the truncated protein, even if it accumulated, would not have been detected on the immunoblots. These data provided indirect evidence that ApHsp26.2 coded for the CP-sHSP isoform in SB and indicate that its failure to accumulate in NSB was due to the mutations in the corresponding gene. By sequencing the bentgrass CP-sHSP genes, we were able to compare the deduced amino acid sequences and properties of their products. Identity among the deduced amino acid sequences was 89.8% or greater. The major difference among the proteins was the absence of a seven-amino acid block (DGAEGQG) in ApHsp26.2 (Fig. 1). Deletion of this block of amino acids and removal of the transit sequence results in a protein with a predicted molecular mass of 21.60 kD and pI of 5.00 (Table I). Hence, the protein encoded by ApHsp26.2 is predicted to be smaller and more basic than the processed forms of ApHsp26.8, ApHsp26.7a, and ApHsp26.7b (Table I).
Transcriptional analysis of ApHsp26.2, ApHsp26.8 and ApHsp26.7 using RT-PCR with gene-specific primers indicated that accumulation of ApHsp26.2 mRNA was greater in SB than NSB during heat shock. We believe that these results accurately reflect the relative difference in ApHsp26.2 mRNA abundance because ApHsp26.7 and ApHsp16 were transcribed in equal amounts in both variants. In addition, actin mRNA was detected in all samples. A comparison of approximately 800 bp in the 5' promoter regions of ApHsp26.2 and ApHsp26.2m revealed only two nucleotide differences at positions -621 and -655 that were upstream from the homopurine stretch (data not shown). Because there were no differences in the region containing the heat shock elements, it is unlikely that differences in the promoter sequences accounted for the lower amount of ApHsp26.2m mRNA. The premature stop codon in ApHsp26.2m could result in transcript destabilization due to incomplete translation of the mRNA. It has been reported in yeast (Saccharomyces cerevisiae) and mammalian systems that a premature stop codon can trigger nonsense-mediated mRNA decay (Leeds et al., 1991 Differential accumulation of ApHsp26.2 mRNA in SB and NSB suggests that ApHsp26.2 codes for the unique isoforms found in SB. In addition, protein properties extrapolated from the deduced amino acid sequence suggest that ApHsp26.2 encodes these unique isoforms. To determine if this was the case, MALDI-TOF MS was used to assign each of the ApHsp26 gene products to the isoform spots on two-dimensional gels. Among the CP-sHSPs isolated from creeping bentgrass, only ApHSP26.8 has a similar peptide mass fingerprint to ApHSP26.2 (Table II), but we could not amplify ApHSP26.8 from the SB genome. In addition, only AsHps26.2 has the peptide (EAGEGQGDWWK) that lacks the seven-amino acid sequence (DGAEGQG) predicted to be in the corresponding tryptic peptide present in the other CP-sHSP isoforms. These data suggest that the spectrum from region 1 was generated from the trypsin digestion of the ApHSP26.2 mature protein product. Results from MALDI-TOF MS also suggested that ApHsp26.7a encodes the other CP-sHSP isoforms in SB. In NSB, the CP-sHSPs appeared to be a mixture of proteins encoded by ApHsp26.8 and ApHsp26.7b. "Comigration" of the CP-sHSPs encoded by these two genes is feasible because they have similar molecular masses and isoelectric points (Table I).
When this study was initiated, we postulated that mutations generated in SB or NSB either during tissue culture and/or heat selection altered their heat tolerance. To determine the source of the mutation, genomic PCR was used to amplify ApHsp26.2, ApHsp26.8, and ApHsp26.7 from each of the parental lines. Mutations in ApHsp26.2m from the parental line 9(38)5 were identical to those in NSB, and parental lines 11(38)4 and 10(37)4 had functional ApHsp26.2. In a preliminary experiment, we noticed that dry matter accumulation in 9(38)5 after high temperature stress was lower than that of the other two parental lines. It is possible that heat selection of callus initiated from Penncross seeds eliminated the callus derived from the most heat-sensitive parent. Three other heat-tolerant variants, derived from Penncross in a different series of selections, also synthesized the additional ApHsp26 isoforms, which supported this hypothesis (Luthe et al., 2000
It still is not clear how the ApHsp26.2 isoforms increase the heat tolerance of SB. It seems unlikely that the seven-amino acid block (DGAEGQG) missing in this isoform could significantly alter its function. However, the results from limited phylogenetic analysis indicate that this sequence or a modified version was present in the monocot but not the dicot species examined (D.S. Luthe, unpublished data). If there are no qualitative differences between the ApHsp26 isoforms, perhaps quantitative differences in total CP-sHSP levels are more important in conferring increased heat tolerance. Densitometry of immunoblots (data not shown) indicated that the relative amount of CP-sHSP per milligram of protein applied to the gel was approximately 2-fold higher in SB than in NSB. Because it has been shown that differences in CP-sHSP levels are positively correlated with thermotolerance (Downs et al., 1998
Plant Growth Conditions Two variants of creeping bentgrass (Agrostis stolonifera cv palustris), SB and NSB, along with three parental lines of Penncross [designated 9(38)5, 10(37)4, and 11(38)4] were grown in a lighted growth chamber (approximately 150 µmol s -1 m-2) on a 22°C/18°C 14-h day/night cycle. The Penncross parental lines were obtained from Dr. David Huff (Pennsylvania State University, State College). Heat shock treatments were carried out at 40°C in a growth chamber. Alternatively, excised leaf segments were incubated in a water bath at 40°C in sterilized incubation buffer (1% [w/v] Suc, 1 mM K-PO4 [pH 6.0], and 0.02% [v/v] Tween 20).
Samples for two-dimensional gel electrophoresis were prepared using the phenol extraction method as previously described (Park et al., 1996
Proteins were blotted from two-dimensional gels onto a nitrocellulose membrane using a semidry electroblotter (Owl Separation Systems, Portsmouth, NH). The CP-sHSPs were detected by chemiluminescence using the ECL system (Amersham, Piscataway, NJ) according to the manufacturer's instructions. The primary antibody, Abmet (generously provided by Dr. Scott Heckathorn, Syracuse University, Syracuse, NY), which specifically recognizes the Met-rich region of CP-sHSPs (Downs et al., 1998
An adaptor-ligated genomic library was constructed by ligating DraI- or EcoRV-digested genomic DNA with adaptors from the Marathon cDNA amplification kit (CLONTECH Laboratories, Palo Alto, CA). DNA (200 ng) from the adaptor-ligated genomic library was used as template for a 25-µL PCR reaction. Primers designed to amplify possible CP-sHSP gene family members were based on the sequence of gene ApHsp26 (GenBank accession no. AF019144) previously isolated in our laboratory. Primer GSP5-1 (5'GTCGTCGAACAGCCGGTCCATCGTG) and the nested primer GSP5-2 (5'CAGCCGGTCCATCGTGTCCAGCATC) were designed from the Met-rich region to amplify the 5'-flanking regions. The 3'-flanking regions were amplified using primer GSP3-1 (5'GAACGCCCCCTTCGCTCTCGTAA), designed from the transit peptide region, and the nested primer GSP3-2 (5' GACGGGTGGTGGAAG), designed from a region between consensus regions I and II. For the first round of the PCR, primer AP1 (Marathon cDNA amplification kit) was used with GSP5-1 or GSP3-1. The second round of the PCR was conducted on the undiluted product from the first PCR with primer AP2 (Marathon cDNA amplification kit) and GSP5-2 or GSP3-2. The PCR products were purified using the Gene Clean Kit (BIO101, Vista, CA) and cloned into the pGEM-T Easy vector (Promega, Madison, WI). All sequencing was done using an ABI PRISM 310 autosequencer (PE Applied Biosystems, Warrington, UK). The GenBank accession numbers are AY153758 (ApHsp26.2), AY153759 (ApHsp26.2m), AY153760 (ApHsp26.8), AY153761 (ApHsp26.7a), and AY153762 (ApHsp26.7b).
Sequence editing and alignment were conducted using the DNASTAR package (DNASTAR Inc., Madison, WI). The transit peptide was predicted using ChloroP (Emanuelsson et al., 1999
Intact plants were heat shocked at 40°C in a growth chamber for 4 h. Total RNA was isolated (Bowden and Lord, 1979
The SB and NSB plants were subjected to heat shock at 37°C in a lighted growth chamber for 12 h to maximize the synthesis and accumulation of HSPs. Total protein fraction was isolated from heat-shocked and control leaves as previously described (Park et al., 1996 Received November 25, 2002; returned for revision February 5, 2003; accepted May 15, 2003.
1 This work was supported by the Mississippi Agricultural and Forestry Experiment Station and by the National Science Foundation (Award no. IBN-0114632 to D.S.L.). This article was approved for publication as No. 10242 of the Mississippi Agricultural and Forestry Experiment Station.  * Corresponding author; e-mail dsluthe{at}ra.msstate.edu; fax 662-325-8664.
Belgrader P, Cheng J, Maquat LE (1993) Evidence to implicate translation by ribosomes in the mechanism by which nonsense codons reduce the nuclear level of human triosephosphate isomerase mRNA. Proc Natl Acad Sci USA 90: 482-486
Bowden L, Lord JM (1979) Isolation and cell-free translation of total messenger RNA from germinating castor bean endosperm. Plant Physiol 63: 769-7733 Downs CA, Heckathorn SA, Bryan JK, Coleman JS (1998) The methionine-rich low-molecular-weight chloroplast heat-shock protein: evolutionary conservation and accumulation in relation to thermotolerance. Am J Bot 85: 175-183[Abstract] Downs CA, Ryan SL, Heckathorn SA (1999) The chloroplast small heat-shock protein: evidence for a general role in protecting photosystem II against oxidative stress and photoinhibition. J Plant Physiol 155: 488-496 Emanuelsson O, Nielsen H, von Heijne G (1999) ChloroP, a neural network-based method for predicting chloroplast transit peptides and their cleavage sites. Protein Sci 8: 978-984[Abstract] Ghosh S, Gepstein S, Heikkila JJ, Dumbroff EB (1988) Use of a scanning densitometer or an ELISA plate reader for measurement of nanogram amounts of protein in crude extracts from biological tissues. Anal Biochem 169: 227-233[CrossRef][ISI][Medline] Gustavsson N, Harndahl U, Emanuelsson A, Roepstorff P, Sundby C (1999) Methionine sulfoxidation of the chloroplast small heat shock protein and conformational changes in the oligomer. Protein Sci 8: 2506-2512[Abstract] Hanson AA (1959) Grass Varieties in the United States. U.S. Department of Agriculture, Washington, DC Hanson AA, Juska FV (1969) Turfgrass Science. American Society of Agronomy, Inc., Madison, WI Harndahl U, Hall RB, Osteryoung KW, Vierling E, Bornman JF, Sundby C (1999) The chloroplast small heat shock protein undergoes oxidation-dependent conformational changes and may protect plants from oxidative stress. Cell Stress Chap 4: 129-138[CrossRef][ISI][Medline]
Heckathorn SA, Downs CA, Sharkey TD, Coleman JS (1998) The small, methionine-rich chloroplast heat-shock protein protects photosystem II electron transport during heat stress. Plant Physiol 116: 439-444 Heckathorn SA, Ryan SL, Baylis JA, Wang D, Hamilton EW, 3rd, Cundiff L, Luthe DS (2002) In vivo evidence from an Agrostis stolonifera selection genotype that chloroplast small heat-shock proteins can protect photo-system II during heat stress. Funct Plant Biol 29: 933-944
Hong SW, Vierling E (2000) Mutants of Arabidopsis thaliana defective in the acquisition of tolerance to high temperature stress. Proc Natl Acad Sci USA 97: 4392-4397 Howarth CJ (1991) Molecular responses of plants to an increased incidence of heat shock. Plant Cell Environ 14: 831-841[CrossRef] Kaeppler SM, Kaeppler HF, Rhee Y (2000) Epigenetic aspects of somaclonal variation in plants. Plant Mol Biol 43: 179-188[CrossRef][ISI][Medline]
Knight CA, Ackerly DD (2001) Correlated evolution of chloroplast heat shock protein expression in closely related plant species. Am J Bot 88: 411-418 Lee BH, Tanaka Y, Iwasaki T, Yamamoto N, Kayano T, Miyao M (1998) Evolutionary origin of two genes for chloroplast small heat shock protein of tobacco. Plant Mol Biol 37: 1035-1043[Medline]
Leeds P, Peltz SW, Jacobson A, Culbertson MR (1991) The product of the yeast UPF1 gene is required for rapid turnover of mRNAs containing a premature translational termination codon. Genes Dev 5: 2303-2314 Li G, Waltham M, Anderson NL, Unsworth E, Treston A, Weinstein JN (1997) Rapid mass spectrometric identification of proteins from two-dimension polyacrylamide gels after in gel proteolytic digestion. Electrophoresis 18: 391-402[CrossRef][Medline]
Lin CY, Roberts JK, Key JL (1984) Acquisition of thermotolerance in soybean seedlings. Plant Physiol 74: 152-160 Lindquist S (1986) The heat-shock response. Annu Rev Biochem 55: 1151-1191[CrossRef][ISI][Medline] Luthe DS, Krans JV, Park S-Y, Wang D (2000) The presence and role of heat shock proteins in creeping bentgrass. In RE Wilkinson, ed, Plant Environment Interactions, Ed 2. Marcel Dekker, Inc., New York, pp 283-319 Malik MK, Slovin JP, Hwang CH, Zimmerman JL (1999) Modified expression of a carrot small heat shock protein gene hsp17.7 results in increased or decreased thermotolerance. Plant J 20: 89-99[CrossRef][ISI][Medline] Maquat LE, Carmichael GG (2001) Quality control of mRNA function. Cell 104: 173-176[CrossRef][ISI][Medline] Miyao-Tokutomi M, Lee BH, Mizusawa N, Yamamoto N (1998) Active oxygen and photoinhibition of photosystem II. In G Garab, ed, Photosynthesis Mechanisms and Effects, Vol 3. Kluwer Academic Press, Dordrecht, The Netherlands, pp 2097-2102 Nover L (1989) Control of gene expression. In L Nover, D Neumann, K-D Scharf, eds, Heat Shock and Other Stress Response Systems of Plants, Vol 16. Springer-Verlag, Berlin, pp 30-42 Park S-Y, Chang K-C, Shivaji R, Luthe DS (1997) Recovery from heat shock in heat tolerant and nontolerant variants of creeping bentgrass. Plant Physiol 115: 229-240[Abstract] Park S-Y, Shivaji R, Krans JV, Luthe DS (1996) Heat shock response in heat tolerant and non-tolerant variants of Agrostis palustris Huds. Plant Physiol 111: 515-524[Abstract] Preczewski P, Heckathorn SA, Downs CA, Coleman JS (2000) Photosynthetic thermotolerance is positively and quantitatively correlated with production of specific heat-shock proteins among nine genotypes of tomato. Photosynthetica 38: 127-134
Queitsch C, Hong SW, Vierling E, Lindquist S (2000) Heat shock protein 101 plays a crucial role in thermotolerance in Arabidopsis. Plant Cell 12: 479-492 Vierling E (1991) The roles of heat shock proteins in plants. Annu Rev Plant Physiol Plant Mol Biol 42: 579-620[CrossRef][ISI] Waters ER, Lee GJ, Vierling E (1996) Evolution, structure and function of the small heat shock proteins in plants. J Exp Bot 47: 325-338
Yarwood CE (1961) Acquired tolerance of leaves to heat. Science 134: 941-942 Zhang S, Welch EM, Hogan K, Brown AH, Peltz SW, Jacobson A (1997) Polysome-associated mRNAs are substrates for the nonsense-mediated mRNA decay pathway in Saccharomyces cerevisiae. RNA 3: 234-244[Abstract]
Zimmerman JL, Apuya N, Darwish K, O'Carroll C (1989) Novel regulation of heat shock genes during carrot somatic embryo development. Plant Cell 1: 1137-1146 This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY | THE PLANT CELL | |
|---|---|---|---|
TOP
ABSTRACT
RESULTS
-cyano-4-hydroxycinnamic acid in 50% [v/v] acetonitrile and 0.3% [v/v] trifluoroacetic acid). A Voyager-Elite MALDI-TOF mass spectrometer with a nitrogen laser (337 nm; PerSeptive Biosystems, Foster City, CA) was used in the linear, delay extraction, and positive ion mode. The spectrometer was calibrated externally with calibration mixture 1 (PerSeptive Biosystems). N-terminal amino acid sequences were determined in the Department of Biochemistry at the University of Mississippi, Mississippi Medical Center (Jackson). 
