| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
|
First published online August 7, 2003; 10.1104/pp.102.019240 Plant Physiology 133:63-72 (2003) © 2003 American Society of Plant Biologists CYP83A1 and CYP83B1, Two Nonredundant Cytochrome P450 Enzymes Metabolizing Oximes in the Biosynthesis of Glucosinolates in Arabidopsis1Plant Biochemistry Laboratory (P.N., B.L.P., M.D.M., S.B., B.A.H.) and Department of Chemistry (C.E.O.), Center for Molecular Plant Physiology, The Royal Veterinary and Agricultural University, Thorvaldsensvej 40, DK-1871 Frederiksberg C, Denmark; and IACR-Rothamsted, Harpenden AL5 2JQ, United Kingdom (H.R.)
In the glucosinolate pathway, the postoxime enzymes have been proposed to have low specificity for the side chain and high specificity for the functional group. Here, we provide biochemical evidence for the functional role of the two cytochromes P450, CYP83A1 and CYP83B1, from Arabidopsis in oxime metabolism in the biosynthesis of glucosinolates. In a detailed analysis of the substrate specificities of the recombinant enzymes heterologously expressed in yeast (Saccharomyces cerevisiae), we show that aliphatic oximes derived from chain-elongated homologs of methionine are efficiently metabolized by CYP83A1, whereas CYP83B1 metabolizes these substrates with very low efficiency. Aromatic oximes derived from phenylalanine, tryptophan, and tyrosine are metabolized by both enzymes, although CYP83B1 has higher affinity for these substrates than CYP83A1, particularly in the case of indole-3-acetaldoxime, where there is a 50-fold difference in Km value. The data show that CYP83A1 and CYP83B1 are nonredundant enzymes under physiologically normal conditions in the plant. The ability of CYP83A1 to metabolize aromatic oximes, albeit at small levels, explains the presence of indole glucosinolates at various levels in different developmental stages of the CYP83B1 knockout mutant, rnt1-1. Plants overexpressing CYP83B1 contain elevated levels of aliphatic glucosinolates derived from methionine homologs, whereas the level of indole glucosinolates is almost constant in the overexpressing lines. Together with the previous characterization of the members of the CYP79 family involved in oxime production, this work provides a framework for metabolic engineering of glucosinolates and for further dissection of the glucosinolate pathway.
Glucosinolates are amino acid-derived natural plant products, containing a thio-Glc moiety and a sulfonate moiety bound to an oxime function. They are implicated in plant-insect and plant-pathogen interactions, and for humans, they have attracted attention as cancer-preventive agents and flavor compounds (for review, see Halkier, 1999  ; Rask et al., 2000). In recent years, significant advances have been made in our understanding of the biosynthetic pathway of glucosinolates, which can be divided into the chain elongation pathway, the formation of the core structure, i.e. the conversion of precursor amino acid to parent glucosinolate, and secondary modifications of side chain and Glc moiety of the parent glucosinolate (Wittstock and Halkier, 2002). In the biosynthesis of the core structure, cytochromes P450 belonging to the CYP79 family catalyze the first committed step, i.e. the conversion of amino acids to oximes (for review, see Halkier et al., 2002). Cytochromes P450 belonging to the CYP83 family have been shown to catalyze the conversion of aromatic oximes (Bak and Feyereisen, 2001; Bak et al., 2001; Hansen et al., 2001b). The remaining pathway leading to the parent glucosinolate proceeds through a thiohydroximic acid that is first glucosylated to give a desulphoglucosinolate that is finally sulfonated.
Glucosinolates are related to another group of natural plant products, cyanogenic glucosides, because both are derived from amino acids that are converted to oximes by cytochromes P450 belonging to the CYP79 family. The oximes form the branching point between the two pathways. In the biosynthetic pathway of the Tyr-derived cyanogenic glucoside dhurrin in sorghum (Sorghum bicolor), the substrate specificity of the involved enzymes widens as the pathway proceeds (Jones et al., 1999
Recombinant CYP83B1 has been characterized in vitro and shown to metabolize aromatic oximes derived from Trp, Phe, and Tyr to the corresponding S-alkyl thiohydroximates (Bak and Feyereisen, 2001
Two tDNA mutants of the CYP83B1 gene have been identified, rnt1-1 (Winkler et al., 1998 In the present paper, we have made a kinetic analysis of the substrate specificity of CYP83A1 and CYP83B1 to determine the functional role of these enzymes in the biosynthetic pathway of glucosinolates. We demonstrate that aliphatic oximes derived from chain-elongated homologs of Met are metabolized very efficiently by CYP83A1 and that CYP83B1 does so with much lower efficiency. Both enzymes metabolize aromatic oximes, although CYP83B1 exhibits the highest affinity for these substrates. In addition, rnt1-1 and transgenic plants with ectopic overexpression of the CYP83A1 and CYP83B1 genes have been characterized with respect to their glucosinolate content.
Metabolism of Aliphatic Oximes by CYP83A1 and CYP83B1
The substrate specificity of CYP83A1 and CYP83B1 in biosynthesis of aliphatic glucosinolates was investigated by testing aliphatic oximes derived from chain-elongated Met derivatives as substrates of the recombinant enzymes. CYP83A1 was incubated with 4-methylthiobutanaldoxime in the presence of Cys and NADPH, and the aqueous phase after extraction with organic solvents was analyzed by liquid chromatography (LC)-mass spectrometry (MS). A unique product accumulated in the reaction mixture as evidenced by a new peak in the LC profile (Fig. 1A). The peak was dependent on the presence of enzyme and NADPH. The product was proposed to be the S-alkylthiohydroximate designated S-(4-methylthiobutylhydroximoyl)-L-Cys, the conjugate between the oxidized aliphatic oxime and Cys, analogous to the conjugates produced when using aromatic oximes as substrates and other thiol-containing compounds as nucleophile (Bak and Feyereisen, 2001
The functional role of CYP83A1 and CYP83B1 in biosynthesis of aromatic glucosinolates was investigated in a detailed kinetic analysis. 14C-labeled oximes were used as substrates, Cys was included as nucleophile, and the apparent Km values were determined. Generally, CYP83B1 has a higher affinity for aromatic oximes than CYP83A1, as evidenced by lower apparent Km values (Table I). This is particularly true for indole-3-acetaldoxime, where there is a 50-fold difference in the Km value for the two enzymes (Bak and Feyereisen, 2001
For determination of Km values for aliphatic oximes, 35S-labeled glutathione was used instead of Cys. When CYP83A1 was incubated with 4-methylthiobutanaldoxime in the presence of [35S]-glutathione as the nucleophile, an NADPH-dependent product was formed as evidenced by a band on a TLC plate (Fig. 2). No product was detected in reconstitution experiments using CYP83B1. The product is most likely the S-alkylthiohydroximate designated S-(4-methylthiobutylhydroximoyl)-glutathione, analogous to the conjugates produced when using Cys as sulfur donor. The product comigrated with glutathione conjugates produced from radiolabeled aromatic oximes in the applied TLC system (data not shown). Another strong band appeared in the CYP83A1 lane. This band is dependent on NADPH, the oxime, and glutathione and may represent a breakdown product of S-(4-methylthiobutylhydroximoyl)-glutathione. The Km values of recombinant CYP83A1 for aliphatic oximes were estimated to be in the range of 20 to 150 µM. Because the product band could not be separated from a smear of radioactivity supposed to be oxidation products of glutathione, accurate estimation of Km values was not performed. Km could not be estimated for CYP83B1 due to the low metabolism of aliphatic oximes by CYP83B1.
The effect of ectopic overexpression of CYP83A1 and CYP83B1 under the control of the 35S promoter was analyzed with respect to glucosinolate profiles and morphological phenotypes. The 35S::CYP83A1 plants did not show any apparent visual phenotype in the wild-type background. The glucosinolate profile of the 35S::CYP83A1 plants in the wild-type background had similar levels of indole and aliphatic glucosinolates as wild-type plants, both at the seedling stage and with fully expanded rosette leaves (Fig. 3). Approximately one-half of the 35S::CYP83B1 lines displayed a characteristic visual phenotype, such as early flowering and faciated stems (Fig. 4). Typically, the 35S::CYP83B1 plants developed the first inflorescence 4 to 6 d before wild type. Individual 35S::CYP83B1 lines contained up to 2 times more aliphatic glucosinolates, whereas indole glucosinolate levels were comparable with wild type (Fig. 5). The lines with the highest levels of aliphatic glucosinolates also had the most severe phenotype.
We analyzed the glucosinolate content in the rnt1-1 mutant, which is a knockout of CYP83B1. Ten-dayold rnt1-1 seedlings contained reduced levels of both indole and aliphatic glucosinolates. In rnt1-1 seedlings, indole glucosinolate levels were reduced by 50%, whereas aliphatic glucosinolates levels were reduced by only 30% compared with wild-type levels. rnt1-1 seedlings are characterized by excessive proliferation of roots. In accordance, the reduced levels of indole glucosinolates observed may be underestimated because roots generally contain more indole and less aliphatic glucosinolates than the aerial parts of the wild-type plant (Petersen et al., 2002
Expression levels of CYP79 genes and CYP83A1 were monitored by semiquantitative RT-PCR performed on RNA isolated from, respectively, rosette leaves of 5-week-old plants and 10-day-old seedlings of wild type and rnt1-1. For each primer set, the optimal number of cycles was determined based upon 20 to 30 cycles for Actin1 and 32 to 38 cycles for the individual CYP79s (for details, see "Materials and Methods"). PCR with Actin1 primers was done to ensure that equal amounts of the RT reactions were used as well as equal loading. For CYP83A1, the expression levels in both wild-type and rnt1-1 seedlings and in rosette leaves from 5-week-old wild type were similar, whereas it was increased 1.5- ± 0.13-fold in rosette leaves from 5-week-old rnt1-1 (Fig. 6). For CYP79B2 and CYP79B3, expression levels were 1.3- ± 0.12-fold and 2.8- ± 0.32-fold higher in rnt1-1 seedlings than in wild type, respectively, and 2.1- ± 0.07-fold and 2.1- ± 0.20-fold higher for rosette leaves of 5-week-old rnt1-1 than for wild type, respectively. For CYP79F1, the only significant difference was a 1.5- ± 0.21-fold higher expression level in rnt1-1 seedlings than in wild-type seedlings, whereas the expression level of CYP79F2 was 2.3- ± 0.51-fold and 1.7- ± 0.28-fold higher in rnt1-1 seedlings and 5-week-old plants than similar wild type, respectively.
We have demonstrated that CYP83A1 efficiently metabolizes aliphatic oximes derived from chain-elongated homologs of Met, whereas CYP83B1 is very inefficient in metabolism of aliphatic oximes. Both CYP83A1 and CYP83B1 metabolize aromatic oximes, but CYP83B1 does it more efficiently. The ability of CYP83A1 and CYP83B1 to primarily metabolize aliphatic and aromatic oximes, respectively, is in agreement with the amplitude of the reverse type II difference spectra obtained with aliphatic and aromatic primary amines (Bak and Feyereisen, 2001 ). The ability of CYP83B1 to metabolize aliphatic oximes at low efficiency in vitro is unlikely to be of significance in vivo under normal physiological conditions because unphysiologically high concentrations of substrates were used in the assays. The situation is reversed for aromatic oximes because the low Km and high Kcat/Km values of recombinant CYP83B1 for aromatic oximes indicate that these oximes are preferentially metabolized by CYP83B1 in vivo. Although CYP83B1 is 17 times more efficient in metabolism of indole-3-acetaldoxime than CYP83A1 in terms of catalytic efficiency and 6-fold more efficient toward phenylacetaldoxime, the difference in catalytic efficiency toward p-hydroxyphenylacetaldoxime is negligible. This shows that CYP83B1 has the highest efficiency for indole-3-acetaldoxime, whereas the differences are less pronounced for the two other aromatic oximes. However, under abnormal condition such as in CYP83B1 knockout plants, CYP83A1 metabolizes aromatic oximes as evidenced by the presence of indole glucosinolates in these plants. The relatively higher Km values for Tyr- and Phe-derived oximes suggest that these compounds are not naturally occurring substrates for the CYP83 enzymes. This is supported by the observation that Arabidopsis does not contain Tyr- or Phe-derived glucosinolates. However, the ability of CYP83A1 and CYP83B1 to metabolize Tyr- and Phe-derived oximes suggests that Arabidopsis has the potential of making Tyr- and Phe-derived glucosinolates. In support of this is the accumulation of p-hydroxy-benzylglucosinolate in Arabidopsis by overexpression of sorghum CYP79A1 (Bak et al., 1999) and of benzylglucosinolates by overexpression of Arabidopsis CYP79A2 (Wittstock and Halkier, 2000). Sorghum CYP79A1 catalyzes the conversion of Tyr to p-hydroxyphenylacetaldoxime in the biosynthesis of the cyanogenic glucoside dhurrin (Koch et al., 1995). The in vivo function of CYP79A2 is not currently understood, but CYP79A2 has been shown in vitro to catalyze the conversion of Phe to phenylacetaldoxime and not the conversion of homo-Phe to its corresponding oxime, for which no CYP79 has yet been identified (Wittstock and Halkier, 2000).
The glucosinolate profiles of transgenic plants overexpressing either CYP83A1 or CYP83B1 exhibited wild-type levels of indole glucosinolates. This suggests that CYP83B1 is not rate limiting and that the level of indole glucosinolates is controlled at the level of indole-3-acetaldoxime. Alternatively, the pool of indole glucosinolates may be controlled by breakdown, e.g. by myrosinase. The levels of aliphatic glucosinolates fluctuated to a high extent between the various lines and at different developmental stages. This was unexpected because the aliphatic glucosinolates are primarily developmentally regulated, whereas the indole glucosinolates are stress inducible (Mikkelsen et al., 2003
Similarly, it is surprising that the level of aliphatic glucosinolates was increased in fully expanded rosette leaves of 35S::CYP83B1 lines because the kinetic analysis showed that CYP83B1 is unlikely to be involved in biosynthesis of aliphatic glucosinolates in vivo. Generally, it would not be expected that upregulation of an enzyme in the middle of a channeled biosynthetic pathway would influence the levels of the end product. The increased level of aliphatic glucosinolates in the 35S::CYP83B1 lines suggests that the plants are stressed, possibly due to channeling of indole-3-acetaldoxime away from the indole-3-acetaldoxime
During the review of this paper, Hemm and coworkers reported four CYP83A1 ethyl methanesulfonate mutants (called ref2 mutants) with decreased levels of aliphatic glucosinolates and increased levels of indole glucosinolates (Hemm et al., 2003
The observation that IAA accumulates in sur2 (Delarue et al., 1998
Several biosynthetic pathways for indole-3-acetaldoxime have been described. The cytochromes P450 CYP79B2 and CYP79B3 both have been shown to produce indole-3-acetaldoxime from Trp (Hull et al., 2000 In summary, we have demonstrated that the oximemetabolizing enzymes CYP83A1 and CYP83B1 are nonredundant under normal physiological conditions and that the two enzymes are responsible for the metabolism of oximes giving rise to glucosinolates in Arabidopsis. Characterization of the substrate specificities of the two oxime-metabolizing enzymes provides important information to understand the fluxes of intermediates in the biosynthesis of the core structure of glucosinolates in Arabidopsis. Together with the previous characterization of the substrate specificity of the members of the CYP79 family involved in oxime production, this work provides a framework for metabolic engineering of glucosinolates and for further dissection of the glucosinolate pathway (Fig. 7).
Oxime Substrates
14C-labeled oxime substrates were produced from 14C-labeled amino acids using the appropriate recombinant CYP79s, i.e. p-hydroxyphenylacetaldoxime from [14C]Tyr by CYP79A1 (Halkier et al., 1995
Microsomes of yeast (Saccharomyces cerevisiae) cells expressing recombinant CYP83A1 and CYP83B1 in the yeast strain WAT11 co-expressing the Arabidopsis NADPH:cytochrome P450 reductase ATR1 were made as previously described (Bak and Feyereisen, 2001 For kinetic analysis, reaction mixtures were set up in a total volume of 50 µL with 5.2 nM CYP83A1 or 9.6 nM CYP83B1, and 5 mM Cys, 0.5 to 5 times the Km value of the oxime substrate (except for phenylacetaldoxime where the highest concentration used was 800 µM due to low solubility of this compound), plus 10 to 50 nCi 14C-labeled oxime and 50 mM Tricine (pH 8.1). Reactions were started by the addition of NADPH to 3 mM, incubated at 29°C for 1 min, and stopped by the addition of 50 µL of 96% (w/v) ethanol. Aliquots of reaction mixtures were applied to TLC plates and eluted in isopropanol:EtOAc:water (7:1:2 [v/v]). Radiolabeled bands were visualized on a STORM PhosphorImager (Molecular Dynamics, Sunnyvale, CA) and quantified using the ImageQuant software. Kinetic parameters were calculated using the SigmaPlot software (SPSS, Inc., Chicago). Assays using [35S]glutathione as nucleophile were done essentially as described above, except that radiolabeled oximes were excluded, and Cys was exchanged for 50 nCi [35S]glutathione.
For LC-MS analysis, reaction mixtures were set up in a total volume of 500 µL with 5 nM CYP83A1 or CYP83B1, 5 mM Cys, 800 µM aliphatic oxime, and 50 mM Tricine (pH 8.1). Reactions were started by addition of NADPH to 3 mM and incubated for 30 min at 29°C. Reactions were stopped by the addition of 500 µL of CH2Cl2 and extracted twice. The aqueous phase was dried in vacuo, resuspended in 25 µL of water, and used for LC-MS analysis.
Electrospray ionization LC-MS analysis of CYP83 reaction products was done on an HP1100 LC coupled to a Bruker Esquire-LC ion trap mass spectrometer (Bruker Instruments, Billerica, MA) as described previously (Hansen et al., 2001b
The rnt1-1 mutant functionally complemented by ectopic expression of the CYP83A1 cDNA under control of the cauliflower mosaic virus 35S promoter was line 2.9.5 (Bak and Feyereisen, 2001
Seeds of Arabidopsis (ecotype Wassilewskija) were sown in humid peat (Enhets K-jord, Weibulls, Sweden), supplemented with 1 g L-1 soil of Bactimos (Wettable Products, Abbott Laboratories, Chicago) in 12- x 15-cm polystyrene trays, allowing water uptake from the bottom. Seeds were sown at densities of 400 or 4 seeds per 100 cm2 when destined for 10-d-old and mature plants, respectively, and kept in a controlled-environment Arabidopsis Chamber (Percival AR-60L, Boone, IA), with a photosynthetic flux of 100 to 120 µmol photons m-2 s-1, 70% relative humidity, and a photoperiod of 12/12 h, 20°C. The plants were watered at intervals of 4 d.
The content and composition of glucosinolates were determined by HPLC analysis of the desulphoglucosinolates as previously described (Petersen et al., 2001
RNA was extracted from Arabidopsis rosette leaves and seedlings using the TRIzol reagent (Invitrogen, Carlsbad, CA). cDNA was synthesized from 2 µg of total RNA by using the Thermoscript RT system (Invitrogen) according to the manufacturer's instructions. PCR was performed in a total volume of 50 µL in PCR buffer (Invitrogen) containing 200 µM dNTPs, 1.5 mM MgCl2, 50 pmol of the forward and reverse primers, and 2.5 units of TaqDNA polymerase (Roche, Basel). The PCR programs were as follows: 2 min at 94°C, 26 cycles (Actin1; U39449), 27 cycles (CYP83A1; At4g13770), 35 cycles (CYP79B2; At4g39950), (CYP79B3; At2g22330), CYP79F1; At1g16410), or 38 cycles (CYP79F2; At1g16400) of: 94°C for 10 s, 57°C (Actin1), or 54°C (all other primers) for 10 s and 72°C for 45 s. The following primers were used (all listed 5' to 3'): Actin1 forward, TGGAACTGGAATGGTTAAGGCTGG; Actin1 reverse, TCTCCAGAGTCGAGCACAATACCG; CYP83A1 forward, CGAGAGATAAGGAAGATGG; CYP83A1 reverse, CCACTACAATATCCAAGATG; CYP79B2 forward, AACCCACCATTAAGGAGC; CYP79B2 reverse, TCATAAAATATATACGGCGTCG; CYP79B3 forward, AAACCAACCATTAAGGAACT; CYP79B3 reverse, TCCTCGCCGTACGTCACCG; CYP79F1 forward, TTTTTAGACACCATCTTGTTTTCTTCTTC; CYP79F1 reverse, AAAGCTCAATGGGTAGAAT; CYP79F2 forward, AAAGCTCAATGCGTCGAAT; and CYP79F2 reverse, GCGTCGAAACACATCACAGAG. Most primer sets were designed to be intron spanning and with these primers, no PCR products from genomic DNA were detected. All primers successfully amplified a band of the correct size when cDNA clones were used as template. Loading buffer (6x) was added to the PCR reactions, and 10 µL was analyzed by gel electrophoresis on a 1% (w/v) agarose gel. Bands were visualized by ethidium bromide staining and quantified on a Gel Doc 2000 Transilluminator (Bio-Rad, Hercules, CA). PCR with Actin1 specific primers was used to ensure that an equal amount of RNA was used for all samples and to ensure that RT reactions were equally effective. RT-PCR analysis was performed in triplicate.
Dr. Kirsten Jørgensen is thanked for helpful discussion on phenotypes of transgenic plants. Christina Mattson is thanked for technical assistance. Received December 17, 2002; returned for revision January 29, 2003; accepted May 12, 2003.
1 This work was supported by grants from the Danish National Research Foundation and the Director Ib Henriksens Foundation. 
2 Present address: Department of Medicinal Chemistry, The Danish University of Pharmaceutical Sciences, Universitetsparken 2, DK-2100 Copenhagen Ø, Denmark.
3 Present address: Danish Institute of Agricultural Sciences, Biotechnology Group, The Royal Veterinary and Agricultural University, Thorvaldsensvej 40, DK-1871 Frederiksberg C, Denmark. * Corresponding author; e-mail bah{at}kvl.dk; fax 45-35283333.
Bak S, Feyereisen R (2001) The involvement of two P450 enzymes, CYP83B1 and CYP83A1, in auxin homeostasis and glucosinolate biosynthesis. Plant Physiol 127: 108-118 Bak S, Olsen CE, Petersen BL, Møller BL, Halkier BA (1999) Metabolic engineering of p-hydroxybenzylglucosinolate in Arabidopsis by expression of the cyanogenic CYP79A1 from Sorghum bicolor. Plant J 20: 663-671[CrossRef][ISI][Medline]
Bak S, Tax FE, Feldmann KA, Galbraith DW, Feyereisen R (2001) CYP83B1, a cytochrome P450 at the metabolic branch point in auxin and indole glucosinolate biosynthesis in Arabidopsis. Plant Cell 13: 101-111 Barlier I, Kowalczyk M, Marchant A, Ljung K, Bhalerao R, Bennett M, Sandberg G, Bellini C (2000) The SUR2 gene of Arabidopsis thaliana encodes the cytochrome P450 CYP83B1, a modulator of auxin homeostasis. Proc Natl Acad Sci USA 19: 14819-14824 Chen S-X, Glawischnig E, Jørgensen K, Naur P, Jørgensen B, Olsen CE, Hansen CH, Rasmussen H, Pickett JA, Halkier BA (2003) Cytochrome P450 CYP79F1 and CYP79F2 genes catalyze the first step in the biosynthesis of short-chain and long-chain aliphatic glucosinolates in Arabidopsis. Plant J 33: 923-937[CrossRef][ISI][Medline]
Dawson GW, Hick AJ, Bennett RN, Donald A, Pickett JA, Wallsgrove RM (1993) Synthesis of glucosinolate precursors and investigations into the biosynthesis of phenylalkyl- and methylthioalkylglucosinolates. J Biol Chem 268: 27154-27159 Delarue M, Prinsen E, Van Onckelen H, Caboche M, Bellini C (1998) Sur2 Mutations of Arabidopsis thaliana define a new locus involved in the control of auxin homeostasis. Plant J 14: 603-611[CrossRef][ISI][Medline] Halkier BA (1999) Glucosinolates. In R Ikan, ed, Naturally Occurring Glucosides. John Wiley & Sons Ltd., New York, pp 193-223 Halkier BA, Hansen CH, Mikkelsen MD, Naur P, Wittstock U (2002) The role of cytochromes P450 in biosynthesis and evolution of glucosinolates. In JT Romeo, ed, Recent Advances in Phytochemistry, Vol 36. Pergamon, Amsterdam, pp 223-248 Halkier BA, Nielsen HL, Koch B, Møller BL (1995) Purification and characterization of recombinant cytochrome P450TYR expressed at high levels in Escherichia coli. Arch Biochem Biophys 322: 369-377[CrossRef][Medline]
Hansen CH, Du L, Naur P, Olsen CE, Axelsen KB, Hick AJ, Pickett JA, Halkier BA (2001b) CYP83B1 is the oxime-metabolizing enzyme in the glucosinolate pathway in Arabidopsis. J Biol Chem 276: 24790-24796
Hansen CH, Wittstock U, Olsen CE, Hick AJ, Pickett JA, Halkier BA (2001a) Cytochrome P450 CYP79F1 from Arabidopsis catalyzes the conversion of dihomomethionine and trihomomethionine to the corresponding aldoximes in the biosynthesis of glucosinolates. J Biol Chem 276: 11078-11085
Hemm MR, Ruegger MO, Chapple C (2003) The Arabidopsis ref2 mutant is defective in the gene encoding CYP83A1 and shows both phenylpropanoid and glucosinolate phenotypes. Plant Cell 15: 179-194
Hull AK, Vij R, Celenza JL (2000) Arabidopsis cytochrome P450s that catalyze the first step of tryptophan-dependent indole-3-acetic acid biosynthesis. Proc Natl Acad Sci USA 97: 2379-2384 Jones P, Vogt T (2001) Glycosyltransferases in secondary plant metabolism: tranquilizers and stimulant controllers. Planta 213: 164-174[CrossRef][ISI][Medline]
Jones PR, Møller BL, Høj PB (1999) The UDP-glucose:p-hydroxymandelonitrile-O-glucosyltransferase that catalyzes the last step in synthesis of the cyanogenic glucoside dhurrin in Sorghum bicolor: isolation, cloning, heterologous expression and substrate specificity. J Biol Chem 274: 35483-35491 Kahn RA, Fahrendorf T, Halkier BA, Møller BL (1999) Substrate specificity of the cytochrome P450 enzymes CYP79A1 and CYP71E1 involved in the biosynthesis of the cyanogenic glucoside dhurrin in Sorghum bicolor (L.) Moench. Arch Biochem Biophys 363: 9-18[CrossRef][ISI][Medline] Koch BM, Sibbesen O, Halkier BA, Svendsen I, Moller BL (1995) The primary sequence of cytochrome P450tyr, the multifunctional N-hydroxylase catalyzing the conversion of L-tyrosine to p-hydroxyphenylacetaldehyde oxime in the biosynthesis of the cyanogenic glucoside dhurrin in Sorghum bicolor (L.). Moench Arch Biochem Biophys 323: 177-186
Ludwig-Müller J, Hilgenberg W (1992) Tryptophan oxidizing enzyme and basic peroxidase isoenzymes in Arabidopsis thaliana (L.) Heynh: are they identical? Plant Cell Physiol 33: 1115-11125
Mikkelsen MD, Halkier BA (2003) Metabolic engineering of valine- and isoleucine-derived glucosinolates in Arabidopsis expressing CYP79D2 from cassava. Plant Physiol 131: 773-779
Mikkelsen MD, Hansen CH, Wittstock U, Halkier BA (2000) Cytochrome P450 CYP79B2 from Arabidopsis catalyzes the conversion of tryptophan to indole-3-acetaldoxime, a precursor of indole glucosinolates and indole-3-acetic acid. J Biol Chem 275: 33712-33717
Mikkelsen MD, Petersen BL, Glawischnig E, Jensen AB, Andreasson E, Halkier BA (2003) Modulation of CYP79 genes and glucosinolate profiles in Arabidopsis by defense signaling pathways. Plant Physiol 131: 298-308 Naur P, Hansen CH, Bak S, Hansen BG, Jensen NB, Nielsen HL, Halkier BA (2003) CYP79B1 from Sinapis alba converts tryptophan to indole-3-acetaldoxime. Arch Biochem Biophys 409: 235-241[Medline]
Omura T, Sato R (1964) The carbon monoxide-binding of liver proteins: II. Solubilization, purification and properties J Biol Chem 239: 2379-2385 Paquette SM, Bak S, Feyereisen R (2000) Intron-exon organization and phylogeny in a large superfamily, the paralogous cytochrome P450 genes of Arabidopsis thaliana. DNA Cell Biol 19: 307-317[CrossRef][ISI][Medline] Pedras MSC, Montaut S, Xu YM, Khan AQ, Loukaci A (2001) Assembling the biosynthetic puzzle of crucifer metabolites: indole-3-Acetaldoxime is incorporated efficiently into phytoalexins but glucobrassicin is not. Chem Commun 17: 1572-1573[CrossRef] Petersen BL, Andreasson E, Bak S, Agerbirk N, Halkier BA (2001) Characterization of transgenic Arabidopsis thaliana with metabolically engineered high levels of p-hydroxybenzylglucosinolate. Planta 212: 612-618[Medline] Petersen BL, Chen S, Hansen CH, Olsen CE, Halkier BA (2002) Composition and content of glucosinolates in developing Arabidopsis thaliana. Planta 214: 562-571[CrossRef][ISI][Medline] Rask L, Andréasson E, Ekbom B, Eriksson S, Pontoppidan B, Meijer J (2000) Myrosinase: gene family evolution and herbivore defense in Brassicaceae. Plant Mol Biol 42: 93-113[CrossRef][ISI][Medline]
Reintanz B, Lehnen M, Reichelt M, Gershenzon J, Kowalczyk M, Sand-berg G, Godde M, Uhl R, Palme K (2001) bus, a bushy Arabidopsis cyp79f1 knockout mutant with abolished synthesis of short-chain aliphatic glucosinolates. Plant Cell 13: 351-367
Ruegger M, Chapple C (2001) Mutations that reduce sinapoylmalate accumulation in Arabidopsis thaliana define loci with diverse roles in phenylpropanoid metabolism. Genetics 159: 1741-1749
Smolen G, Bender J (2002) Arabidopsis cytochrome P450 cyp83B1 mutations activate the tryptophan biosynthetic pathway. Genetics 160: 323-332
Tantikanjana T, Yong JW, Letham DS, Griffith M, Hussain M, Ljung K, Sandberg G, Sundaresan V (2001) Control of axillary bud initiation and shoot architecture in Arabidopsis through the SUPERSHOOT gene. Genes Dev 15: 1577-1588
Tobena-Santamaria R, Bliek M, Ljung K, Sandberg G, Mol JN, Souer E, Koes R (2002) FLOOZY of petunia is a flavin mono-oxygenase-like protein required for the specification of leaf and flower architecture. Genes Dev 16: 753-763 Vorwerk S, Biernacki S, Hillebrand H, Janzik I, Muller A, Weiler EW, Piotrowski M (2001) Enzymatic characterization of the recombinant Arabidopsis thaliana nitrilase subfamily encoded by the NIT2/NIT1/NIT3-gene cluster. Planta 212: 508-516[CrossRef][Medline]
Winkler RG, Frank MR, Galbraith DW, Feyereisen R, Feldmann KA (1998) Systematic reverse genetics of transfer-DNA-Tagged lines of Arabidopsis: isolation of mutations in the cytochrome P450 gene superfamily. Plant Physiol 118: 743-750
Wittstock U, Halkier BA (2000) Cytochrome P450 CYP79A2 from Arabidopsis thaliana L. catalyzes the conversion of L-phenylalanine to phenylacetaldoxime in the biosynthesis of benzylglucosinolate. J Biol Chem 275: 14659-14666 Wittstock U, Halkier BA (2002) Glucosinolate research in the Arabidopsis era. Trends Plant Sci 7: 263-270[CrossRef][ISI][Medline]
Zhao Y, Christensen SK, Fankhauser C, Cashman JR, Cohen JD, Weigel D, Chory J (2001) A role for flavin monooxygenase-like enzymes in auxin biosynthesis. Science 291: 306-309
Zhao Y, Hull AK, Gupta NR, Goss KA, Alonso J, Ecker JR, Normanly J, Chory J, Celenza JL (2002) Trp-dependent auxin biosynthesis in Arabidopsis: involvement of cytochrome P450s CYP79B2 and CYP79B3. Genes Dev 16: 3100-3112 This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
TOP
ABSTRACT
RESULTS
-hydroxynitrile, respectively, but are more promiscuous as to the nature of the side chain of the parent amino acid (Jones et al., 1999
IAA pathway. Because IAA is produced in the micromolar range, whereas glucosinolates have concentrations in the millimolar range, a small increased flux of indole-3-acetaldoxime into indole glucosinolates is not expected to be detectable in the levels of indole glucosinolates. 
