|
|
||||||||
|
First published online August 21, 2003; 10.1104/pp.103.026278 Plant Physiology 133:538-548 (2003) © 2003 American Society of Plant Biologists Altered Life Cycle in Arabidopsis Plants Expressing PsUGT1, a UDP-Glucuronosyltransferase-Encoding Gene from Pea1Division of Plant Pathology and Microbiology, Department of Plant Sciences, University of Arizona, Tucson, Arizona 85721 (H.-H.W., M.C.H.); and Department of Molecular, Cell and Developmental Biology (H.-H.W., A.M.H.), Department of Chemistry (K.F.F.), and Molecular Biology Institute (A.M.H.), University of California, Los Angeles, California 90095
Alfalfa (Medicago sativa) and Arabidopsis were used as model systems to examine molecular mechanisms underlying developmental effects of a microsomal UDP-glucuronosyltransferase-encoding gene from pea (Pisum sativum; PsUGT1). Alfalfa expressing PsUGT1 antisense mRNA under the control of the cauliflower mosaic virus (CaMV) 35S promoter exhibited delayed root emergence, reduced root growth, and increased lateral root development. The timing of root emergence in wild-type and antisense plants was correlated with the transient accumulation of auxin at the site of root emergence. Cell suspension cultures derived from the antisense alfalfa plants exhibited a delay in cell cycle from 24-h in the wild-type plants to 48-h in the antisense plants. PsUGT1::uidA was introduced into Arabidopsis to demonstrate that, as in alfalfa and pea, PsUGT1 expression occurs in regions of active cell division. This includes the root cap and root apical meristems, leaf primordia, tips of older leaves, and the transition zone between the hypocotyl and the root. Expression of PsUGT1::uidA colocalized with the expression of the auxin-responding reporter DR5::uidA. Co-expression of DR5::uidA in transgenic Arabidopsis lines expressing CaMV35S::PsUGT1 revealed that ectopic expression of CaMV35S::PsUGT1 is correlated with a change in endogenous auxin gradients in roots. Roots of ecotype Columbia expressing CaMV35S::PsUGT1 exhibited distinctive responses to exogenous naphthalene acetic acid. Completion of the life cycle occurred in 4 to 6 weeks compared with 6 to 7 weeks for wild-type Columbia. Inhibition of endogenous ethylene did not correct this early senescence phenotype.
The root cap meristem of higher plants, especially pea (Pisum sativum) and corn (Zea mays), has long been a favored model system to study the plant cell cycle because of its physical accessibility and ease of manipulation (Barlow, 2003
The cell cycle in the cap meristem was long presumed to be a constitutively active process that operates in tandem with the cell cycle in the apical meristem (Sievers and Braun, 1996
In previous studies, the inducible root cap system in pea was used to examine predictions of Barlow's (1975
Inhibition of a PsUGT1 homolog in alfalfa (Medicago sativa) by expression of PsUGT1 antisense mRNA under the control of its own promoter also is lethal, suggesting a general role for the enzyme in regulating development in legumes (Woo et al., 1999
Altered Adventitious Root Development in Response to Expression of CaMV35S::PsUGT1 Antisense mRNA
Alfalfa plants expressing CaMV35S::PsUGT1 antisense mRNA were sterile, so stem cuttings were propagated for further analysis of root development (as done by Woo et al. [1999
A 33% increase in endogenous free IAA levels occurred both in wild-type plants and in plants expressing CaMV35S::PsUGT1 antisense mRNA, at the point of adventitious root development (Fig. 1C). The increase in IAA occurred at d 7 in wild-type stem cuttings, but not until d 11 in plants expressing CaMV35S::PsUGT1 antisense mRNA. By d 9 in the wild-type stem cuttings and d 13 in the antisense stem cuttings, the free IAA levels decreased to background levels.
Lateral root growth in wild-type root clones (Fig. 2A) was not as extensive as in clones expressing CaMV35S::PsUGT1 antisense mRNA (Fig. 2B). The number of lateral roots also was increased slightly in plants expressing CaMV35S::PsUGT1 antisense mRNA (5.9 per cm) compared with wild-type roots (4.5 per cm). Differences in cell shape and organization between wild-type (Fig. 2A, inset) and antisense plants (Fig. 2B, inset) were also evident. In roots of plants expressing antisense mRNA, the cells were rounded rather than elongated as in wild type.
The cell division cycle was measured by checking DNA contents in nuclei isolated from alfalfa cell suspension culture using flow cytometry. Alfalfa cell suspension cultures were treated by 5-aminouracil (5-AU) to synchronize DNA synthesis during cell division. Flow cytometry revealed that the duration of cell cycle between the first and second S phases was about 24 h in wild-type cell cultures and 48 h in cell suspension cultures derived from transgenic alfalfa expressing CaMV35S::PsUGT1 antisense mRNA (Fig. 3).
The uidA gene was used as a reporter to compare PsUGT1 expression patterns in Arabidopsis with those in pea and alfalfa. Recovery of transgenic plants expressing PsUGT1::uidA was very low (data not shown). An Arabidopsis seedling expressing the PsUGT1::uidA reporter gene demonstrated that, as in alfalfa, expression was localized to regions undergoing active cell division including the root apical meristem, the root cap meristem, and root primordia (Fig. 4). The highest activity occurred in the root apical meristem, with strong expression also occurring in the root cap meristem. Expression based on
Fertile transgenic Arabidopsis ecotype Columbia plants that constitutively express PsUGT1 under the control of the CaMV35S promoter were developed. Among 19 independent lines expressing CaMV35S:: PsUGT1, several exhibited high levels of PsUGT1 transcript expression in leaves (not shown) and were used to examine the impact of PsUGT1 expression on development.
Columbia expressing CaMV35S::PsUGT1 required 6 to 7 d of cold treatment before germination compared with 2 to 3 d of cold treatment for wild-type seedlings. Under controlled environmental conditions, wild-type Columbia produced flowers 4 to 5 weeks after germination, and most plants were dead within 6 to 7 weeks (data not shown). In contrast, plants expressing CaMV35S::PsUGT1 produced flowers 3 to 4 weeks after germination and most plants were dead within 5 weeks (not shown). The differences in the onset of senescence between plants expressing CaMV35S::PsUGT1 and wild-type Columbia were quantified by measuring loss of chlorophyll from leaves (Fig. 5). Wild-type leaves started to lose chlorophyll by 5 weeks after germination, and loss was complete by 8 weeks (Fig. 5, dotted line). In contrast, leaves of plants expressing CaMV35S::PsUGT1 began to lose chlorophyll by 3 weeks after germination, and loss was complete by 6 weeks (Fig. 5, solid line).
To examine the possibility that the early senescence phenotype in plants expressing CaMV35S::PsUGT1 was related to ethylene accumulation, plants were treated with silver nitrate, which prevents ethylene action (Reid, 1987
The auxin-responsive reporter DR5::uidA was transformed into wild-type plants and lines expressing CaMV35S::PsUGT1 and was stained for GUS activity 3 and 7 d after seed germination. In 3-d-old wild-type seedlings, histochemical staining was localized to the emerging leaf primordia, the transition zone between the hypocotyl and the root, and the root apex, as reported by Hinmanen et al. (2002
In 7-d-old wild-type seedlings, the expression of the DR5::uidA reporter also was localized to leaf primordia, the tips of the older leaves where auxin is synthesized (Fig. 6A), the transition zone between the hypocotyl and the root (not shown), lateral root initiation sites, and the root apex (Fig. 6A). Little or no expression occurred in the vascular system or elsewhere within root tissue. In 3-d-old seedlings expressing CaMV35S::PsUGT1, histochemical staining in response to the DR5::uidA reporter was enhanced at all sites of localized expression, especially in the root apex and lateral root primordia (not shown). Similarly, in roots of 7-d-old seedlings expressing CaMV35S::PsUGT1, histochemical staining as measured by the DR5::uidA reporter was increased in tissue surrounding sites of lateral root initiation, and enhanced staining was observed in the root apex and adjacent cells (Fig. 6B).
To examine whether the capacity to respond to exogenous auxin changes in parallel with the observed changes in endogenous auxin distribution, wild-type and CaMV35S::PsUGT1 plants were treated with IAA, 2,4-dichlorophenoxyacetic acid (2,4-D), and NAA at 106 to 1010 M (Fig. 7). Responses were identical, with two notable exceptions: NAA at a concentration of 108 M caused mild inhibition of root growth (Fig. 7A) and at 107 M strongly inhibited root growth (Fig. 7, C and E) of wild-type roots. In contrast, roots of plants expressing CaMV35S::PsUGT1 exhibited dramatic changes in morphology including root "waving" and "curling" (Fig. 7B) with treatments of 108 M NAA and enhanced root hair development (Fig. 7, D and F) in response to 107 M NAA.
A wide variety of products in plants are reversibly conjugated by sugars including GlcUA, by the action of dozens of individual glycosyltransferase (GT)-encoding genes, many of which exhibit activity on a range of substrates (Vogt and Jones, 2000
In the current study, an effect on duration of the cell cycle in cell suspension cultures from clonal alfalfa expressing CaMV35S::PsUGT1 antisense mRNA paralleled its effect on the cell cycle in roots. This result also is consistent with the hypothesis that FCC activity influences cell division resulting in a 24-h delay in the time required to complete a cell cycle in cultured cells as well as in organized tissue. Additional effects that occurred in alfalfa expressing CaMV35S::PsUGT1 antisense mRNA included delayed adventitious root initiation and development, altered lateral root initiation and development, and a loss of the normal elongated shape of cells in the root. Each of these phenotypes is characteristic of changes that can occur in response to changes in endogenous or exogenous auxin levels (Okada et al., 1991
If FCC acts to directly or indirectly influence auxin activities resulting in altered cell division, then plants with altered PsUGT1 expression would be predicted to exhibit altered auxin levels and/or distribution during development. Unfortunately, detailed studies of PsUGT1 effects in alfalfa are hampered because overexpression yields no obvious phenotypes. Expression of PsUGT1 antisense mRNA under the control of its own promoter is lethal, and alfalfa expressing CaMV35S::PsUGT1 antisense mRNA are infertile (Woo et al., 1999
Whereas reduced PsUGT1 expression in alfalfa caused a delay in development, ectopic expression of PsUGT1 in Arabidopsis caused the reverse effect. The rate of development was increased, resulting in a faster life cycle than normal. Wild-type plants exhibited senescence after 6 to 8 weeks, but plants expressing CaMV35S::PsUGT1 were completely senescent within 5 weeks. Increased ethylene, whose concentrations can increase in response to a variety of stimuli including stress, can cause a similar induction of early senescence (Bleecker and Kende, 2000
When CaMV35S::PsUGT1 was co-expressed with the auxin-responsive promoter DR5::uidA reporter in Arabidopsis, an increased GUS staining consistent with a change in distribution of auxin was observed, especially in root systems. Instead of a tight localization of GUS staining only within actively dividing cells, staining was enhanced throughout tissues surrounding sites of lateral root initiation, with particularly intense staining in the root apex and adjacent cells. Wild-type and transgenic roots also exhibited divergent responses to specific concentrations of exogenous NAA. An effect of PsUGT1 on auxin synthesis, stability, uptake, localization, and/or transport would account for all of the observed changes in cell division, growth, and development in alfalfa and Arabidopsis. Given the myriad roles played by auxin in plant development, a direct role in regulating cellular auxin levels would also account for the fact that suppression of its inducible, meristem-localized activity by antisense mRNA expression under control of its own promoter is lethal (Woo et al., 1999
Several factors argue against the possibility that auxin is FCC, the unknown substrate that is reversibly conjugated by PsUGT1 in meristematic cells during mitosis. First, to our knowledge, auxin conjugation with GlcUA has not been reported to occur in plant tissues (Ljung et al., 2002
An alternative model is that FCC might play a role in regulated uptake of auxin into specific cells. Interestingly, flavonoids have been implicated in regulating endogenous auxin levels by effects on polar auxin transport (Jacobs and Rubery, 1988
The results of this study demonstrate a critical role for a specific GT in growth and development in diverse plant species. Such genes potentially provide an attractive target for improved crop production (Vogt and Jones, 2000
Plasmid and Bacterial Strains
For development of alfalfa (Medicago sativa) plants expressing PsUGT1 antisense mRNA, the Escherichia coli uidA gene encoding GUS was removed from the pBI121 vector using SstI and BamHI. The cDNA (+730 to +1,510) from PsUGT1 was ligated into the SstI and BamHI sites of pBI121 without the uidA gene, which resulted in the insertion of the PsUGT1 sequence into pBI121, in the opposite orientation, as presented by Woo et al. (1999 For ectopic expression of PsUGT1 in Arabidopsis, the pBI121 vector was linearized using EcoRI, and the EcoRI site was filled by Klenow fragment. The E. coli uidA gene encoding GUS was removed from pBI121 using BamHI. PsUGT1 DNA (+1 to +1,578) was generated by PCR using PsUGT-2 (BamHI) primer (ACTACGGATCCTTTCTTGTGGTAATTAGTTCTGC) and PsUGT-3 primer (TACTAAGATACAACAAAAGCTAG). After BamHI digestion, PsUGT1 DNA was ligated into pBI121 (BamHI and blunt end). The resulting construct was transformed into E. coli HB101 and then into A. tumefaciens ASE by triparental conjugation. For localization of PsUGT1 expression, the PsUGT1 promoter (867 to +450) was cloned into HindIII and BamHI sites of pBI121. The resulting vector was transformed into E. coli HB101 and then into A. tumefaciens ASE by triparental conjugation.
Free IAA was isolated and pentafluorobenzyl-derivatized according to Prisnsen et al. (2000
Fifty microliters of the partially purified IAA-containing sample in acetone was treated with 1 µL of 1-ethylpiperidine and 5 µL of
Transgenic alfalfa plants expressing the CaMV35S::PsUGT1 antisense mRNA were developed as described previously (Fang and Hirsch, 1998
Both wild-type Columbia and Arabidopsis cv Columbia (DR5::uidA; kindly provided by Tom J. Guilfoyle, University of Missouri, Columbia) were transformed with CaMV 35S::PsUGT1. Four-week-old seedlings were transformed by vacuum infiltration with A. tumefaciens ASE (CaMV 35S::PsUGT1) as described previously (Clough and Bent, 1998 Seeds from regenerated plants were germinated on Murashige and Skoog medium containing kanamycin. For selection of transgenic plants, kanamycin-resistant primary plants were analyzed for the presence of the transgene by PCR using Taq polymerase. Template DNA was obtained from leaves. PsUGT-2 primer and PsUGT-3 primer, which amplify 1,578-bp PsUGT1 DNA present only in transgenic plants, were used for PCR analysis (Fig. 5). Transgenic plants were under maintained in a controlled environmental chamber with 16 h of light (mixed fluorescent bulbs) at 21°C and 8 h of dark at 19°C and were carried through five generations before analysis of phenotype. Because transgenic plants required a 7-d cold treatment for germination, both wild-type and transgenic seeds were cold-treated at 4°C for 7 d. For RT-PCR analysis, total RNA was isolated from leaves of wild-type and transgenic plants. First-strand cDNA was synthesized using PsUGT-3 as primer. The PsUGT-2 primer and PsUGT-3 primer were used for RT-PCR. The PCR product was fractionated on 1% (w/v) agarose gel and blotted onto nylon membrane. 32P-labeled probes were generated by random priming using PsUGT1 DNA. Blot hybridization was followed as in standard protocols.
The life cycles of transgenic plants were measured by observing leaf senescence up to 9 weeks after germination. Chlorophyll content was measured according to Lichtenthaler (1987
To inhibit the action of ethylene, AgNO3 (1100 mg L1 medium) was used. To prevent ethylene synthesis, 105 to 108 M AVG was added to growth medium. One-week-old seedlings were transferred to petri dishes containing AgNO3- or AVG-treated medium. Seedlings were observed daily, for up to 2 months. Six-week-old cultures were photographed.
Three- to 7-d-old seedlings were stained by 5-bromo-4-chloro-3-indolyl-
Seeds were germinated in auxin-free medium composed of Murashige and Skoog minimal organics medium (Sigma-Aldrich, St. Louis) solidified with 1.5% (w/v) agar (type E, Sigma-Aldrich). The Suc content within the medium was 0.3% (w/v). The plates were kept in the dark, at 4°C for 7 d. Afterward, the plates were transferred to a growth chamber (20°C, 100% relative humidity, and 16-h/8-h light/dark cycle; Conviron, Winnipeg, Manitoba, Canada). One-week-old seedlings were transferred to petri dishes containing the same medium, plus IAA, 2,4-D, or NAA as indicated. For assays of root waving/curling, seedlings grown on medium in square petri dishes were positioned vertically. Three-week-old cultures were evaluated by direct observation, and phenotypes were documented photographically.
We thank Fushi Wen for critical reading of the manuscript. Received May 3, 2003; returned for revision May 23, 2003; accepted May 30, 2003.
Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.103.026278.
1 This work was supported by the National Science Foundation (to M.C.H. and H.-H.W.), by the Department of Energy, Division of Energy Biosciences (to M.C.H. and H.-H.W.), by the University of Arizona College of Agriculture and Life Sciences Experiment Station, and by the National Institutes of Health (grant no. NCCAMSPSO AT00151 to the Center for Dietary Supplement Research Botanicals at University of California, Los Angeles to A.M.H. [director, Agricultural Botany Core] and H.-H.W. [junior investigator]). The National Science Foundation is acknowledged for partial support for purchase of mass spectrometric instrumentation (CHE grant no. 007829). * Corresponding author; e-mail hhwoo{at}ucla.edu; fax 3102065413.
Avsian-Kretchmer O, Cheng J-C, Chen L, Moctezuma E, Sung ZR (2002) Indole acetic acid distribution coincides with vascular differentiation pattern during Arabidopsis thaliana leaf ontogeny. Plant Physiol 130: 199209 Barlow PW (1975) The root cap. In JG Torrey, DT Clarkson, eds, The Development and Function of Roots. Academic Press, London, pp 2154 Barlow PW (2003) The root cap. J Plant Growth Regul (in press) Benjamins R, Quint A, Weijers D, Hooykaas P, Offringa R (2001) The PINOID protein kinase regulates organ development in Arabidopsis by enhancing polar auxin transport. Development 128: 40574067 Bennett MJ, Marchant A, Green HG, May ST, Ward SP, Millner PA, Walker AR, Schultz B, Feldmann KA (1996) Arabidopsis AUX1 gene: a permease-like regulator of root gravitropism. Science 273: 948950[Abstract] Bleecker AB, Kende H (2000) Ethylene: a gaseous signal molecule in plants. Annu Rev Cell Dev Biol 16: 118[CrossRef][ISI][Medline] Breyne P, Zabeau M (2001) Genome-wide expression analysis of plant cell cycle modulated genes. Curr Opin Plant Biol 4: 136142[CrossRef][ISI][Medline]
Brigham LA, Woo H-H, Wen F, Hawes MC (1998) Meristem-specific suppression of mitosis and a global switch in gene expression in the root cap of pea by endogenous signals. Plant Physiol 118: 12231231
Brown DE, Rashotte AM, Murphy AS, Normanly J, Tague BW, Peer WA, Taiz L, Muday GK (2001) Flavonoids act as negative regulators of auxin transport in vivo in Arabidopsis thaliana. Plant Physiol 126: 524535
Casimiro I, Marchant A, Bhalerao RP, Beeckman T, Dhooge S, Swarup R, Graham N, Inzé D, Sandberg G, Casero PJ et al. (2001) Auxin transport promotes Arabidopsis lateral root initiation. Plant Cell 13: 843852
Chen JG, Ullah H, Young JC, Sussman MR, Jones AM (2001) ABP1 is required for organized cell elongation and division in Arabidopsis embryogenesis. Genes Dev 15: 902911 Christensen SK, Dagenais N, Chory J, Weigel D (2000) Regulation of auxin response by the protein kinase PINOID. Cell 100: 469478[CrossRef][ISI][Medline] Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735743[CrossRef][ISI][Medline] den Boer BGW, Murray JAH (2000a) Triggering the cell cycle in plants. Trends Cell Biol 10: 245250[CrossRef][ISI][Medline] den Boer BGW, Murray JAH (2000b) Control of plant growth and development through manipulation of cell cycle genes. Curr Opin Biotechnol 11: 138145[Medline] Doonan J, Forbert P (1997) Conserved and novel regulators of the plant cell cycle. Curr Opin Cell Biol 9: 824830[CrossRef][Medline] Edlund A, Eklof S, Sundberg B, Moritz T, Sandberg G (1995) A microscale techniques for gas chromatography-mass spectrometry measurements of picogram amounts of indole-3-acetic acid in plant tissues. Plant Physiol 108: 10431047[Abstract]
Fang Y, Hirsch AM (1998) Studying early nodulin gene ENOD40 expression and induction by nodulation factor and cytokinin in transgenic alfalfa. Plant Physiol 116: 5368 Folts JD (2002) Potential health benefits from the flavonoids in grape products on vascular disease. Adv Exp Med Biol 505: 95111[Medline] Garbers C, DeLong A, Deruere J, Bernasconi P, Soll D (1996) A mutation in protein phosphatase 2A regulatory subunit A affects auxin transport in Arabidopsis. EMBO J 15: 21152124[ISI][Medline] Hawes MC, Bengough GA, Cassab G, Ponce G (2003) Root cap and rhizosphere. J Plant Growth Regul (in press) Hawes MC, Gunawardena U, Miyasaka S, Zhao X (2000) The role of root border cells in plant defense. Trends Plant Sci 5: 128132[CrossRef][ISI][Medline]
Hawes MC, Lin H-J (1990) Correlation of pectolytic enzymes activity with the programmed release of cells from root caps of pea. Plant Physiol 94: 18551859
Hinmanen K, Boucheron E, Vanneste S, de Almeida Engler J, Inzé D (2002) Auxin-mediated cell cycle activation during early lateral root initiation. Plant Cell 14: 23392351 Jacobs M, Rubery PH (1988) Naturally occurring auxin transport regulators. Science 24: 346349 Jakob KM, Trosko JE (1965) The relation between 5-aminouracil-induced mitotic synchronization and DNA synthesis. Exp Cell Res 40: 5667[Medline] Lichtenthaler HK (1987) Chlorophylls and carotenoids: pigments of photosynthetic biomembranes. Methods Enzymol 148: 350382[ISI] Ljung K, Hull AK, Kowalczyk M, Marchant A, Celenza J, Cohen JD, Sandberg G (2002) Biosynthesis, conjugation, catabolism and homeostasis of IAA in Arabidopsis thaliana. Plant Mol Biol 50: 309332[CrossRef][ISI][Medline] Lopez-Lazaro M, Akiyama M (2002) Flavonoids as anticancer agents: structure-activity relationship study. Curr Med Chem Anti Cancer Agents 2: 691714 Magyar Z, Meszaros T, Miskolczi P, Deak M, Feher A, Brown S, Kondorosi E, Athanasiadis A, Pongor S, Bilgin M et al. (1997) Cell cycle phase specificity of putative cyclin-dependent kinase variants in synchronized alfalfa cells. Plant Cell 9: 223235[Abstract]
Marchant A, Bhalerao R, Casimiro I, Eklof J, Casero PJ, Bennett M, Sandberg G (2002) AUX1 promotes lateral root formation by facilitating indole-3-acetic acid distribution between sink and source tissues in the Arabidopsis seedling. Plant Cell 14: 589597 Mckeon TA, Yang S-F (1987) Biosynthesis and metabolism of ethylene. In PJ Davies, ed, Plant Hormones and Their Role in Plant Growth and Development. Martinus Nijhoff Publishers, Dordrecht, The Netherlands, pp 94112 Murphy A, Peer WA, Taiz L (2000) Regulation of auxin transport by aminopeptidases and endogenous flavonoids. Planta 211: 315324[CrossRef][ISI][Medline]
Okada K, Ueda J, Komaki MK, Bell CJ, Shimura Y (1991) Requirement of the auxin polar transport system in early stages of Arabidopsis floral bud formation. Plant Cell 3: 677684
Peer WA, Brown DE, Tague BW, Muday GK, Taiz L, Murphy AS (2001) Flavonoid accumulation patterns of transparent testa mutants of Arabidopsis. Plant Physiol 126: 536548 Planchais S, Glab N, Inzé D, Bergounious C (2000) Chemical inhibitors: a tool for plant cell cycle studies. FEBS Lett 476: 7883[CrossRef][ISI][Medline] Potuschak T, Doerner P (2001) Cell cycle controls: genome-wide analysis in Arabidopsis. Curr Opin Plant Biol 4: 501506[CrossRef][ISI][Medline] Prisnsen E, Van Laer S, Oden S, Van Onckelen H (2000) Auxin analysis. In GA Tucker, JA Roberts, eds, Plant Hormone Protocols, Methods in Molecular Biology, Vol 141. Humana Press, Totowa, NJ, pp 4965
Rashotte AM, DeLong A, Muday GK (2001) Genetic and chemical reductions in protein phosphatase activity alter auxin transport, gravity response, and lateral root growth. Plant Cell 13: 16831697 Reid MS (1987) Ethylene in plant growth, development, and senescence. In PJ Davies, ed, Plant Hormones and Their Role in Plant Growth and Development. Martinus Nijhoff Publishers, Dordrecht, The Netherlands, pp 257279 Ruegger M, Dewey E, Hobbie L, Brown D, Bernasconi P, Turner J, Muday GK, Estelle M (1997) Reduced naphthylphthalamic acid binding in the tir3 mutant of Arabidopsis is associated with a reduction in polar auxin transport and diverse morphological defects. Plant Cell 9: 745757[Abstract] Sievers A, Braun M (1996) The root cap: structure and function. In Y Waisel, A Eshel, U Kafkafi, eds, Plant Roots: The Hidden Half, Ed 2. Marcel Dekker, New York, pp 3149 Steinberg FM, Bearden MM, Keen CL (2003) Cocoa and chocolate flavonoids: implications for cardiovascular health. J Am Diet Assoc 103: 215223[CrossRef][ISI][Medline] Ulmasov T, Murfett J, Hagen G, Guilfoyle TJ (1997) Aux/IAA proteins repress expression of reporter genes containing natural and highly active synthetic auxin response elements. Plant Cell 9: 19631971[Abstract] Vogt T, Jones P (2000) Glycosyltransferases in plant natural product synthesis: characterization of a supergene family. Trends Plant Sci 5: 380386[CrossRef][ISI][Medline] Woo HH, Brigham LA, Hawes MC (1994) Primary structure of the mRNA encoding a 16.5-kDa ubiquitin-conjugating enzyme of Pisum sativum. Gene 148: 369370[Medline] Woo HH, Brigham LA, Hawes MC (1995) Molecular cloning and expression of mRNAs encoding H1 histone and an H1 histone-like sequences in root tips of pea (Pisum sativum L.). Plant Mol Biol 28: 11431147[Medline] Woo HH, Hawes MC (1997) Cloning of genes whose expression is correlated with mitosis and localized in dividing cells in root caps of Pisum sativum L. Plant Mol Biol 35: 10451051[CrossRef][Medline] Woo HH, Kuleck G, Hirsch AM, Hawes MC (2002) Flavonoids: signal molecules in plant development. In BS Buslig, JA Manthey, eds, Flavonoids in Cell Function, Advances in Experimental Medicine and Biology, Vol 505. Kluwer Academic/Plenum Publishers, New York, pp 5160
Woo HH, Orbach M, Hirsch AM, Hawes MC (1999) Meristem-localized inducible expression of an UDP-glycosyltransferase gene is essential for growth and development in pea and alfalfa. Plant Cell 11: 23032316 Zazimalova E, Napier RM (2003) Points of regulation for auxin regulation. Plant Cell Rep 21: 625634[ISI][Medline] This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS |