| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
|
First published online August 28, 2003; 10.1104/pp.103.025320 Plant Physiology 133:618-629 (2003) © 2003 American Society of Plant Biologists Isolation of a Gene Encoding a Copper Chaperone for the Copper/Zinc Superoxide Dismutase and Characterization of Its Promoter in PotatoGraduate School Experimental Plant Sciences, Laboratory of Plant Breeding, Department of Plant Sciences, Wageningen University, P.O. Box 386 6700 AJ Wageningen, The Netherlands
Gene expression during the potato (Solanum tuberosum) tuber lifecycle was monitored by cDNA-amplified fragment-length polymorphism, and several differentially expressed transcript-derived fragments were isolated. One fragment, named TDFL431, showed high homology to a copper (Cu) chaperone for Cu/zinc superoxide dismutase (CCS). The Ccs protein is responsible for the delivery of Cu to the Cu/zinc superoxide dismutase enzyme. The potato CCS (StCCS) full-length gene was isolated, and its sequence was compared with CCSs from other species. The promoter region of this gene was isolated, fused to the firefly luciferase coding sequence, and used for transformation of potato plants. The highest level of StCCS-luciferase expression was detected in the cortex of stem (like) tissues, such as stem nodes, stolons, and tubers; lower levels were detected in roots and flowers. The StCCS promoter contains regions highly homologous to several plant cis-acting elements. Three of them are related to auxin response, whereas four others are related to response to various stresses. Induction of the StCCS promoter was analyzed on 18 media, differing in hormone, sugar, and Cu content. StCCS expression was induced by auxin, gibberellins (GA4 + 7), fructose, sucrose, and glucose and was inhibited by relatively high concentrations of Cu.
Potato (Solanum tuberosum) plants undergo several developmental stages during their tuber lifecycle involving stolon formation, tuberization, tuber filling, dormancy, and tuber sprouting (Ewing and Struik, 1992  ). According to the classical hypothesis (Gregory, 1956), a substance is synthesized in the leaves under short-day conditions and transported to the stolons, where it triggers tuber formation (Struik et al., 1987). Tuberization is a complex developmental process resulting in the differentiation of an underground stolon into a specialized storage organ, the tuber (Taylor et al., 1992a; Visser et al., 1994). The process of tuberization comprises inhibition of longitudinal growth of the stolon followed by the initiation and growth of the tuber (Cutter, 1978). Tuberization is a continuous process, meaning that different developmental stages, from stolon induction to tuber growth, can occur in one plant simultaneously (Vreugdenhil and Struik, 1989). From a physiological point of view, dormancy can be considered to begin at tuber initiation and ends when buds are capable of extension growth (Wiltshire and Cobb, 1996). The starting moment of tuber formation is of importance for the length of the sprouting period (Claassens and Vreugdenhil, 2000). Thus not only tuberization but also the other phases of potato tuber life cycle, such as dormancy and sprouting, are asynchronous processes in nature and are therefore difficult to analyze individually.
To study gene expression during potato tuber life cycle, the screening of differentially expressed genes was performed in tuberization-related tissues obtained with a well-defined synchronous in vitro tuberization and dormancy system (Hendriks et al., 1991
Cu chaperones are small proteins that bind Cu in the cytosol and mediate its delivery to Cu-dependent target proteins (Harrison et al., 1999
As in other species, plant Ccs proteins are responsible for the delivery of Cu to the Cu/Zn Sodp (Zhu et al., 2000
In plants, the different members of the Cu chaperone family have been identified and characterized on different levels. The Arabidopsis CCH gene, highly homologous to the yeast ATX1 (Himelblau et al., 1998
Although the three members of the Cu chaperone family have been identified in plants and proven to complement their homologs in yeast, besides the CCH gene (Mira et al., 2001b
Isolation of TDFL431 Gene expression during the potato tuber lifecycle was studied using the cDNA-AFLP technique, and a number of differentially expressed TDFs were identified. The fragment named TDFL431 showed increased expression during tuberization, whereas during dormancy, its expression decreased to a non-detectable level 10 weeks after harvest (Fig. 1). In addition, L431 transcript was detected in stem nodes, swelling stolons, and young tubers.
The 175-bp-long TDFL431 is highly homologous to a Cu chaperone of the Cu/Zn superoxide dismutase (CCS) derived from different species.
The results of the Southern-blot analysis using six different restriction enzymes are depicted in Figure 2. Hybridizations with the 175-bp-long TDFL431 resulted in two bands with the enzymes EcoRV, XbaI, and XhoI and one band with EcoRI, BamHI, and HindIII. These results suggested the presence of two copies or allelic versions of TDFL431 in the tetraploid potato genome of cv Bintje.
Because StCCS showed a transient expression pattern during the tuber lifecycle, was only expressed in stem-like tissues (stems, stolons, and tubers), and had a low copy number, it was selected for promoter isolation. In total, 2,933 bp were identified, from which 954 bp were upstream of the start codon (ATG). Both Southern-blot analysis and the sequence identification revealed the presence of at least two StCCS copies or alleles. To identify the sequence of the whole gene and to determine the exon/intron borders, a genomic DNA fragment and a cDNA fragment downstream the TDFL431 were isolated. Combining all of the sequencing data, we concluded that the StCCS gene is 2,802 nucleotides long from the ATG till the stop codon (TGA) and encodes a protein of 311 amino acids (Figs. 3A and 4). Comparing the sequence of StCCS gene with the potato tentative consensus (TC 49957) in The Institute for Genomic Research database (http://www.tigr.org), six exons have been identified, interrupted by five introns as depicted in Figure 3A. The 3'-untranslated region is 179 bp long ending with a poly(A) tail. The genomic sequence of the StCCS gene is available in the National Center for Biotechnology Information (NCBI) databases (accession no. AY196210).
The StCCS coding region was compared with sequences available from other species, such as tomato (Zhu et al., 2000
Ccs proteins from human, mouse, and yeast are organized in three domains as shown in Figure 4 by vertical bars. StCcsp domain I is 151 amino acids long, as in the other plant Ccs proteins. However, the human and yeast domain I are much smaller, 70 and 66 amino acids, respectively. Domain I is homologous to Atx1p Cu chaperone, and it contains a highly conserved region, MXCXXC, which is thought to be a Cu-binding site (Zhu et al., 2000
The transcription initiation site (TIS) was determined experimentally with the GeneRacer Kit (Invitrogen, Carlsbad, CA), and it was localized 86 bp upstream of the first ATG. A putative TATA box was found 72 bp upstream of the TIS followed by a CAAT motif 11 bp downstream (Fig. 3B).
The StCCS 5' region showed no overall sequence homology to any other promoter in the NCBI databases (Altschul et al., 1997
Box A is located 856 bp upstream of the TIS and has the same sequence as the auxin-responsive element small auxin-up RNA in soybean (Xu et al., 1997
The 954-bp fragment upstream of the translation initiation site from the StCCS gene was fused to the firefly luciferase+ reporter gene in the pBRH1 plasmid (Hulzink et al., 2002 In vitro plantlets were assayed for luciferase activity, including roots, stems, and leaves. Luciferase expression was detected in roots and stems, but no signal was identified in leaves. The highest expression was observed in root tips and in the stem nodes (data not shown). The in vitro plantlets were transferred to soil and analyzed for LUC+ gene expression. Several different tissues were assayed, such as leaves (young and fully grown), petioles, stems, roots, stolons (young, swelling, primary, and secondary), tubers (growing, mature, and dormant), flowers, and tuber sprouts. Potato fruits were not obtained under the greenhouse conditions used. The Lucp activity detected in the different tissues is presented in Figure 5. The different tissues were measured during different periods of time, different distances to the detector, and with different modes. To correct for all of these differences and to give a better idea of the relative expression in each organ, a relative time was added to each picture. The higher the relative time, the lower the expression in a particular organ.
Concerning the aboveground organs of the potato plant, the highest luciferase gene expression was detected in stems (Fig. 5, A, B, F, and G). The stronger signal was identified in the stem nodes, mostly in the apical part of the plant (Fig. 5A) and just above the ground (Fig. 5B). Sectioning of stem nodes revealed that the highest LUC+ gene expression was found in the axillary buds and in the cortex of the stem (Fig. 5, F and G). As shown in Figure 5B, luciferase activity was also detected in some petioles, although at a lower level than in the stem nodes. A much weaker signal was measured in flowers, more specifically in the stamens and in the calyx (Fig. 5E). No LUC+ expression was found in leaves. Regarding the underground tissues, the highest luciferase signal was identified in stolons, both primary and secondary (Fig. 5C). Some young (growing) intact tubers showed a medium LUC+ expression (Fig. 5C, white arrow), although after sectioning, a high expression was detected in the cortical region and in the pith (Fig. 5H). Analysis of the potato tuber sprouts revealed that StCCS is expressed in this organ although at a lower level (Fig. 5D). Also in sprouts, LUC+ expression was found in the cortex and in the internodes (data not shown).
Rojas-Beltran et al. (2000
Given that StCCS is a Cu chaperone, it was expected that its expression would change in the presence of high (or low) concentrations of Cu. Therefore, greenhouse-grown potato plants were sprayed with 50 mM CuSO4, and luciferase signal was measured 30 min, 1 h, and 2 h after treatment. No significant changes in luciferase activity were detected in any of the tissues at the different time points. Because no changes were detected in greenhouse-grown plants after they were sprayed with CuSO4, the effect of Cu was tested in in vitro-grown plantlets. In these plantlets, high concentrations of Cu (10 mM of CuSO4) showed a negative effect on StCCS gene expression, bringing Luc+ activity down to less than one-third (Fig. 7) relative to the expression found in plantlets grown in MS10.
To identify factors influencing StCCS gene expression, transgenic plants containing the StCCS promoter fused to the luciferase gene were grown in vitro in media supplemented with several hormones and sugars (Fig. 7). With regard to the sugars, plantlets grown in media containing Fru, Suc, or Glc showed a higher LUC+ gene expression relative to the plants grown in MS10, whereas the non-metabolizable sugar alcohols, sorbitol and mannitol, did not show any significant effect. Concerning the hormones, the synthetic auxin 2,4-dichlorophenoxyacetic acid (2,4-D) showed a more than 5-fold increase in StCCS expression, whereas gibberellins (GA4 + 7) led to a 2-fold increase in luciferase activity. Although the different sugars and hormones seem to influence StCCS expression, the t test indicates, with 99% confidence, that the synthetic auxin 2,4-D has an inducing effect and the 10 mM CuSO4 an inhibitory affect on StCCS expression.
Gene expression during the potato tuber life cycle was monitored using the cDNA-AFLP technique, and several differentially expressed genes were identified. One of them, named TDFL431 was expressed during tuber formation and early stages of tuber development. Its expression was uniquely detected in stem-like tissues, such as stems, stolons, and tubers (Fig. 1). In addition, it showed the highest level of expression in newly developing organs, as swelling stolons and young tubers. Similar results were obtained with the StCCS promoter/LUC+ fusion, where the highest signal was identified in stolons, sectioned tubers, and nodes. A lower level of expression was detected in sprouts and even lower in flowers and roots. No expression was observed in leaves either with cDNA-AFLP or with promoter LUC+ fusions. Interestingly, high levels of expression of other Cu chaperones, such as CCH, have been also found in stems of Arabidopsis plants (Mira et al., 2001b ).
Until now, no reports have been published on the presence of Ccsp in leaves of any plant species. Because both isoforms of Cu/Zn Sodp, cytosolic and plastidic, are expressed in potato leaves (Rojas-Beltran et al., 2000 Analysis of the 954-bp sequence corresponding to the StCCS promoter resulted in the identification of several potential binding sites for transcription factors. Three of them were highly similar to auxin-responsive elements. The possible function of these controlling sequences is supported by the fact that StCCS expression was increased 5-fold in the presence of the synthetic auxin 2,4-D (50 µM).
It is known that the expression of the Cu/Zn SOD is induced by stress, such as light (Rao et al., 1996
Alignment of the sequence of the potato CCS gene with other species resulted in the identification of differences in the protein structure between plant, human, and yeast, although the conserved motifs MXCXXC in domain I and CXC in domain III were present in the Ccsp of all of the species. The differences found at the nucleotide and amino acid level between the Ccsp of plants and other eukaryotic species supported the hypothesis that Cu chaperones function in a slightly different manner in plants and other species (Wintz and Vulpe, 2002
Promoter-luciferase fusions showed that CCS expression was confined to the cortical region of several stem (-like) tissues. The cortex of the stem contains parenchyma cells usually with high abundance of plastids (Esau, 1977
Pekker et al. (2002
Although Cu can be toxic, the Cu chaperones are not detoxification proteins; they clearly function in a "chaperone" like manner, guiding and protecting the metal ion while facilitating appropriated partnerships (O'Halloran and Culotta, 2000
StCCS expression is induced by auxin, which is known to play a role in different stages of potato development. Auxins have a promoting effect on cell elongation/expansion, and depending on the time point at which they are applied, they can have an inhibitory (Kumar and Wareing, 1974 The results described herein will contribute to a better understanding of CCS genes in plants, which might function in a slightly different manner than in other eukaryotic organisms. Additionally, because the StCCS promoter confers expression mostly in stem (-like) tissues, it could be used for the unraveling of cis-elements responsible for specific expression in these organs.
Plant Material
Two different tetraploid varieties of potato (Solanum tuberosum) used were potato cvs Karnico and Bintje. Potato cv Bintje was used to isolate genomic DNA and total RNA, whereas potato cv Karnico was used for transformation experiments because of its outstanding transformation efficiency (Heeres et al., 2002
For the identification of genes involved in tuber lifecycle, a well-defined in vitro synchronous tuberization and dormancy system, optimized for potato cv Bintje, was applied (Hendriks et al., 1991
DNA manipulations were conducted using standard procedures as described by Sambrook et al. (1989
Total RNA used for the northern-blot analysis was isolated from the different tissues according to Bachem et al. (1998
Total RNA was isolated from axillary buds harvested on each of the 10 d of in vitro tuber formation, as described by Bachem et al. (1998
The templates used for cDNA-AFLP were prepared according to Bachem et al. (1996
Nucleotide and translated sequences were compared with nucleotide and amino acid sequences of the GenBank nonredundant databases by using the Blastn and Blastx sequence alignment programs (Altschul et al., 1997
Isolation of the promoter region was carried out with the help of the Universal GenomeWalker Kit (BD Biosciences Clontech, Palo Alto, CA) according to manufacturer's instructions (Siebert et al., 1995
Three walks were performed from the TDFL431 toward and into the promoter region. As a result of the first walk, two PCR fragments were obtained from the DraI digested library, with a length of 815 and 549 bp. They were almost identical except for the 266-bp addition, which corresponded to an intron. The PCR fragment obtained in the second walk was amplified from the PvuII library and was 1,058 bp long, and the third one was a 1,074-bp product from the DraI library.
The StCCS promoter sequence was compared with the GenBank eukaryotic promoter database (epd) using the BLASTn sequence alignment program (Altschul et al., 1997
The sequence of StCCS gene was compared with nonredundant NCBI database with the BLASTx protein alignment program (Altschul et al., 1997
Total RNA was isolated from potato stolons from potato cv Bintje with the GenElute Mammalian total RNA miniprep Kit (Sigma-Aldrich) according to Fossati (2002
The StCCS 3' region was isolated using two different approaches. First, the transcribed region between amino acid 209 and the poly(A) tail was isolated with the GeneRacer Kit (Invitrogen). Second, to identify possible introns in the same region, a PCR was performed with a primer starting at amino acid 189 (TGGCTCAAGTCAATATGG) and another primer from amino acid 308 (GTTGCTTCCCAGATAGTT). The GeneRacer kit reactions were performed as described in the previous section and the StCCS gene-specific primers used were: GSP9 and GR3' for the primary PCR and GSP10 and GR3'N for nested PCR (Table I).
To be able to clone the regulatory region of the StCCS gene, a 954-bp fragment upstream of the ATG was isolated by PCR using the primers L431luc2 (–863AAGCTT GAAGAACATATGAAGGTAG) and L431luc3 (60CTCGAGTTTTCACTCTTTTTA TATCC). This fragment was fused to a modified firefly luciferase gene, LUC+ (Sherf and Wood, 1994 To determine the luciferase activity in the transformants, eight clonal plants were produced from each of the primary transformants and grown on Murashige and Skoog medium supplemented with 10 g of Suc and 50 mg mL–1 kanamycin at 25°C with 16 h of light. When the plantlets had six to seven leaves, they were transferred to soil. Several tissues of the in vivo and in vitro plants were analyzed for luciferase gene expression including roots, stolons (young and swelling stolons), tubers (young <1 cm and mature), stems (nodes and internodes), leaves (young and full-grown), petioles, flowers, and tuber sprouts. During these experiments, no fruits were obtained.
To analyze the effects of Cu on the Cu chaperone for the Cu/Zn Sodp, the greenhouse-grown transgenic plants containing the StCCS promoter region fused with the luciferase gene were sprayed with 50 mM CuSO4. Luciferase activity was measured 30 min, 1 h, and 2 h after treatment.
Three randomly chosen transgenic clones containing the StCCS promoter/LUC+ and one untransformed potato cv Karnico were propagated so that 150 plantlets from each clone were available. They were grown in vitro for 20 d on Murashige and Skoog medium supplemented with 3% (w/v) Suc. Eight plants from each clone were grown on 18 different media for 8 d at 25°C with 16 h of light. Sixteen media were supplemented with different hormone and sugar conditions, whereas two other media were supplemented with 100 µM and 10 mM CuSO4. The hormones were added to Murashige and Skoog medium supplemented with 1% (w/v) Suc in the following concentrations: 25 mg L–1 benzylaminopurine, 50 µM dicamba, 50 µM 2,4-D, 7 mM ethephon, 50 µM kinetine, 100 µM abscisic acid, 200 µM methyl jasmonate, 5 mg L–1 ancymidol, 1.75 mg mL–1 2-chloroethyltrimethylammonium chloride, and 50 µM GA4 + 7. The hormones and sugars were chosen based on their influence (inducing or inhibiting) in gene expression during the potato life cycle (Li, 1985
Protein extraction was carried out essentially as described by Leeuwen et al. (2000 As expected, the plantlets incubated in some media showed yellow leaves and did not grow as much. To make the luciferase measurements comparable, only green tissue was harvested. Determination of protein concentration in these extracts was performed with the Protein Assay ESL (Roche Diagnostics, Mannheim, Germany) according to manufacturer's recommendations. To standardize further measurements, all of the samples were diluted to the same protein concentration. For the luciferase measurements, 10 µL of each protein extract was used mixed with 40 µL of luciferase extraction buffer.
For the measurement of luciferase activity, the protein extracts were thawed on ice, and 5 µL of each sample was mixed with 100 µL of flash-assay buffer (20 mM Tricine, 2.67 mM MgSO4, 0.1 mM EDTA, 2 mM dithiothreitol, 470 µM D-luciferin, and 5 mM ATP, pH 7.8). The luciferase activity was measured in a luminometer (Luminoskan LS, Labsystem, Helsinki) at 25°C. Luciferase signal was quantified for 2 s, 10 s, and 1 min. Several dilutions of luciferase (Roche Diagnostics) in luciferase extraction buffer were used for calibration (0.1–200 units mL–1). To determine whether the differences in luciferase expression, under the influence of the different hormones and sugars, were statistically significant, a Student's t test was performed for each sample.
Upon request, all novel materials described in this publication will be made available in a timely manner for noncommercial research purposes.
We are very grateful to Irma Straatman-Engelen for the northern-blot analysis and to Dirk-Jan Huigen for helping with the greenhouse-grown plants. We also thank Dr. Anne-Marie Wolters, Dr. Niek Appeldoorn, and Dr. Krit Raemakers for critical reading of the manuscript. Received April 11, 2003; returned for revision May 26, 2003; accepted June 26, 2003.
Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.103.025320. * Corresponding author; e-mail luisa.trindade{at}wur.nl; fax 31–317–483457.
Abe H, Yamaguchi-shinozaki K, Urao T, Iwasaki T, Hosokawa D, Shinozaki K (1997) Role of Arabidopsis MYC and MYB homologs in drought- and abscisic acid-regulated gene expression. Plant Cell 9: 1859–1868[Abstract] Allen RD, Webb RP, Schake SA (1997) Use of transgenic plants to study antioxidant defenses. Free Radic Biol Med 23: 473–479[CrossRef][ISI][Medline]
Altschul SF, Madden TL, Schaffer AA, Zhang JH, Zhang Z, Miller W, Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25: 3389–3402 Asada K (1992) Ascorbate peroxidase: a hydrogen peroxide-scavenging enzyme in plants. Physiol Plant 85: 235–241[CrossRef] Bachem C, van der Hoeven R, Lucker J, Oomen R, Casarini E, Jacobsen E, Visser R (2000) Functional genomic analysis of potato tuber life-cycle. Potato Res 43: 297–312[CrossRef] Bachem CWB, Oomen RJFJ, Visser RGF (1998) Transcript imaging with cDNA-AFLP: a step-by-step protocol. Plant Mol Biol Rep 16: 157–173 Bachem CWB, van der Hoeven RS, de Bruijn SM, Vreugdenhil D, Zabeau M, Visser RGF (1996) Visualisation of differential gene expression using a novel method of RNA fingerprinting based on AFLP: analysis of gene expression during potato tuber development. Plant J 9: 745–753[CrossRef][ISI][Medline]
Balandin T, Castresana C (2002) AtCOX17, an Arabidopsis homolog of the yeast copper chaperone COX17. Plant Physiol 129: 1852–1857 Ballas N, Wong LM, Theologis A (1993) Identification of the auxin-responsive element, AuxRE, in the primary indoleacetic acid-induced gene, PS-IAA4/5, of pea (Pisum sativum). J Mol Biol 233: 580–596[CrossRef][ISI][Medline] Borsane O, Díaz P, Agius MF, Valpuesta V, Monza J (2001) Water generates an oxidative stress through the induction of a specific Cu/Zn superoxide dismutase in Lotus corniculatus leaves. Plant Sci 161: 757–763[CrossRef] Bowler C, van Camp W, van Montagu M, Inzé D (1994) Superoxide dismutase in plants. Crit Rev Plant Sci 13: 199–218
Church MG, Gilbert W (1984) Genomic sequencing. Proc Natl Acad Sci USA 81: 1991–1995 Claassens MMJ, Vreugdenhil D (2000) Is dormancy of potato tubers the reverse of tuber initiation? Potato Res 43: 347–369
Culotta VC, Klomp LW, Strain J, Casareno RL, Krems B, Gitlin JD (1997) The copper chaperone for superoxide dismutase. J Biol Chem 272: 23469–23472 Cutter EG (1978) Structure and development of the potato plant. In PM Harris, ed, The Potato Crop. Chapman and Hall, London, pp 70–152 Elliott KA, Shirsat AH (1998) Promoter region of the extA extensine gene from Brassica napus control activation in response to wounding and tensile stress. Plant Mol Biol 37: 675–687[CrossRef][ISI][Medline] Esau K (1977) Membranous modifications in sieve element plastids of spinach affected by the aster yellows disease. J Ultrastruct Res 59: 87–100[Medline] Ewing EE, Struik PC (1992) Tuber formation in potato: induction, initiation, and growth. In Horticultural Review, Vol 14. John Wiley & Sons, New York, pp 89–198 Fossati T (2002) Plant RNA extraction using GenElute mammalian total RNA miniprep kit. Origins Nr 6: 12–13 Gamonet F, Lauquin GJM (1998) The Saccharomyces cerevisiae LYS7 gene is involved in oxidative stress protection. Eur J Biochem 251: 716–723[Medline]
Giuliano G, Pichersky E, Malik VS, Timko MP, Scolnik PA, Cashmore AR (1988) An evolutionary conserved protein binding sequence upstream of a plant light-regulated gene. Proc Natl Acad Sci USA 85: 7089–7093
Glerum DM, Shtanko A, Tzagoloff A (1996) Characterisation of COX17, a yeast gene in copper metabolism and assembly of cytochrome oxidase. J Biol Chem 271: 14504–14509 Gregory LE (1956) Some factors for tuberisation in the potato plant. Am J Bot 43: 281–288[CrossRef][ISI]
Guilfoyle T, Hagen G, Ulmasov T, Murfett J (1998) How does auxin turn on genes? Plant Physiol 118: 341–347 Hagen G, Guilfoyle T (2002) Auxin-responsive gene expression: genes, promoters and regulatory factors. Plant Mol Biol 49: 373–385[CrossRef][ISI][Medline] Harrison MD, Jones CE, Dameron CT (1999) Copper chaperones: function, structure and copper-binding properties. J Biol Inorg Chem 4: 145–153[CrossRef][ISI][Medline] Heeres P, Schipers-Rozenboom M, Jacobsen E, Visser RGF (2002) Transformation of a large number of potato varieties: genotype-dependent variation in efficiency and somaclonal variability. Euphytica 124: 13–22[CrossRef] Hendriks T, Vreugdenhil D, Stiekema WJ (1991) Patatin and four serine proteinase inhibitor genes are differentially expressed during potato tuber development. Plant Mol Bol 17: 385–394 Higgins DG, Sharp PM (1989) Fast and sensitive multiple sequence alignments on a microcomputer. CABIOS 5: 151–153
Higo K, Ugawa Y, Iwamoto M, Korenaga T (1999) Plant cis-acting regulatory DNA elements (PLACE) database: 1999. Nucleic Acids Res 27: 297–300
Himelblau E, Mira H, Lin SJ, Culotta VC, Peñarrubia L, Amasino RM (1998) Identification of a functional homolog of the yeast copper homeostasis gene ATX1 from Arabidopsis. Plant Physiol 117: 1227–1234
Hulzink RJM, de Groot PFM, Croes AF, Quaedvlieg W, Twell D, Wullems GJ, van Herpen MMA (2002) The 5'-untranslated region of the ntp303 gene strongly enhances translation during pollen tube growth, but not during pollen maturation. Plant Physiol 129: 342–353 Jackson SD, Willmitzer L (1994) Jasmonic acid spraying does not induce tuberisation in short-day-requiring potato species kept in non-inducing conditions. Planta 194: 155–159[CrossRef] Kumar D, Wareing PF (1974) Studies on tuberisation of Solanum andigena: II. Growth hormones and tuberisation. New Phytol 73: 833–840 Leeuwen W, Hagendoorn MJM, Ruttink T, Poecke R, van der Plas LHW, van der Krol AR (2000) The use of luciferase reporter system for in planta gene expression studies. Plant Mol Biol Rep 18: 143a–143t Li PH (1985) Potato Physiology. Academic Press, Harcourt Brace Jovanovich Publishers, Philadelphia, PA, pp 1–586
Lin S, Culotta VC (1995) The ATX1 Gene of Saccharomyces cerevisiae encodes a small metal homeostasis factor that protects cells against reactive oxygen toxicity. Proc Natl Acad Sci USA 92: 3784–3788
Lin SJ, Pufahl RA, Dancis A, O'Holloran TV, Culotta VC (1997) A role for the Saccharomyces cerevisiae ATX1 gene in copper trafficking and iron transport. J Biol Chem 272: 9215–9220
Liu ZB, Ulmasov T, Shi X, Hagen G, Guilfoyle TJ (1994) The soybean GH3 promoter contains multiple auxin-inducible elements. Plant Cell 6: 645–657 Martinez CA, Loureiro ME, Oliva MA, Maestri M (2001) Differential responses of superoxide dismutases in freezing resistant Solanum curbilobum and freezing sensitive Solanum tuberosum subjected to oxidative and water stress. Plant Sci 160: 505–515[Medline]
McCord JM, Fridovich I (1969) Superoxide dismutase: an enzymatic function for erythrocuprein (hemocuprein). J Biol Chem 244: 6049–6055 Mira H, Martinez-Garcia F, Peñarrubia L (2001b) Evidence for the plant-specific intercellular transport of the Arabidopsis copper chaperone CCH. Plant J 25: 521–528[CrossRef][ISI][Medline] Mira H, Vilar M, Péres-Payá E, Peñarrubia L (2001a) Functional and conformational properties of the exclusive C-domain from the Arabidopsis copper chaperone (CCH). Biochem J 357: 545–549[CrossRef][Medline]
Müller-Röber BT, Ko
O'Halloran TV, Culotta VC (2000) Metallochaperones, an intracellular shuttle service for metal ions. J Biol Chem 275: 25057–25060 Pekker I, Tel-Or E, Mittler R (2002) Reactive oxygen intermediates and glutathione regulate the expression of cytosolic ascorbate peroxidase during iron-mediated oxidative stress in bean. Plant Mol Biol 49: 429–438[Medline]
Perl A, Aviv D, Willmitzer L, Galun E (1991) In vitro tuberization potatoes harboring Piechulla B, Merforth N, Rudolph B (1998) Identification of tomato Lhc promoter region necessary for circadian expression. Plant Mol Biol 38: 655–662[CrossRef][ISI][Medline] Rao MV, Paliyath G, Ormrod DP (1996) Ultraviolet-B and ozone-induced biochemical changes in antioxidant enzymes of Arabidopsis thaliana. Plant Physiol 110: 125–136[Abstract] Rogers SO, Bendich AJ (1988) Extraction of DNA from plant tissues. Plant Mol Biol Manual A6: 1–10 Rojas-Beltran JA, Dejaeghere F, Abdallakotb M, duJardin P (2000) Expression and activity of antioxidant enzymes during potato dormancy. Potato Res 43: 383–393 Rushton PJ, Torres JT, Parniske M, Wernert P, Hahlbrock K, Somssich IE (1996) Interaction of elicitor-induced DNA-binding protein with elicitor response elements in the promoter of parsley PR1 genes. EMBO J 15: 5690–5700[ISI][Medline] Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual, Ed 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
Schmidt PJ, Rae TD, Pufahl RA, Hamma T, Strain J, O'Halloran TV, Culotta VC (1999) Multiple protein domains contribute to the action of the copper chaperone foe superoxide dismutase. J Biol Chem 274: 23719–23725 Sherf BA, Wood KV (1994) Firefly luciferase engineered for improved genetic reporting. Promega Notes 49: 14–21
Siebert PD, Chenchik A, Kellogg DE, Lukyanov KA, Lukyanov SA (1995) An improved PCR method for walking in uncloned genomic DNA. Nucleic Acids Res 23: 1087–1088
Struik PC, Boon EJ, Vreugdenhil D (1987) Effects of extracellular extracts from leaves on the tuberization of cuttings of potato (Solanum tuberosum L.). Plant Physiol 84: 214–217 Taylor MA, Mad Arif SA, Kumar A, Davies HV, Srobie LA, Pearce S, Flavell AJ (1992) Expression and sequence analysis of cDNAs induced during early stages of tuberization in different organs of the potato plant (Solanum tuberosum L.). Plant Mol Biol 20: 641–651[CrossRef][Medline] Trindade LM (2003) Potato life-cycle: from genes to promoters to cis-acting elements. PhD thesis. Wageningen University, The Netherlands Trindade LM, Horvath B, Bachem C, Jacobsen E, Visser RGF (2003) Isolation and functional characterisation of a stolon specific promoter from potato (Solanum tuberosum L.). Gene 303: 77–87[Medline] van Camp W, Inzé D, van Montagu M (1997) The regulation and function of tobacco superoxide dismutases. Free Radic Biol Med 23: 515–520[CrossRef][ISI][Medline] Visser RGF (1991) Regeneration and transformation of potato by Agrobacterium tumefaciens. In K Lindsey, ed, Plant Tissue Culture Manual B5. Dordrecht, The Netherlands, pp 1–9 Visser RGF, Vreugdenhill D, Hendriks T, Jacobsen E (1994) Gene expression and carbohydrate content during stolon to tuber transition in potatoes (Solanum tuberosum). Physiol Planta 90: 285–292[CrossRef] Vreugdenhil D, van Dijk W (1989) Effects of ethylene on the tuberization of potato (Solanum tuberosum) cuttings. Plant Growth Regul 8: 31–39 Vreugdenhil D, Struik PC (1989) An integrated view of the hormonal regulation of tuber formation in potato. Physiol Plant 75: 525–531[CrossRef] Wiltshire JJJ, Cobb AH (1996) A review of the physiology of potato tuber dormancy. Ann Appl Biol 129: 553–569 Wintz H, Vulpe C (2002) Plant copper chaperones. Biochem Soc Trans 30: 732–735[CrossRef][ISI][Medline] Xu N, Hagen G, Guilfoyle T (1997) Multiple auxin response modules in the soybean SAUR 15A promoter. Plant Sci 126: 193–201[CrossRef]
Xu X, van Lammeren AAM, Vermeer E, Vreugdenhil D (1998) The role of gibberellins, abscisic acid, and sucrose in the regulation of potato tuber formation in vitro. Plant Physiol 117: 575–584 Yu Q, Rengel Z (1999) Drought and salinity differentially influence activities of superoxide dismutase in narrow leafed lupins. Plant Sci 142: 1–11[CrossRef] Zhu H, Shipp E, Sanchez RJ, Liba A, Stine JE, Hart J, Gralla EB, Nersissian AM, Valentine JS (2000) Cobalt(2+) binding to human and tomato copper chaperone for superoxide dismutase: implications for the metal ion transfer mechanism. Biochemistry 39: 5413–5421[CrossRef][Medline] This article has be |
TOP
ABSTRACT
RESULTS
-32P]dCTP by random priming. Membranes were washed at 65°C for 15 min each time, twice in 2x SSC and 0.1% (w/v) SDS and finally in 1x SSC and 0.1% (w/v) SDS. 
mann J, Hannah C, Willmitzer L, Sonnewald U (1990) One of two different ADP-glucose pyrophosphorylase genes from potato responds strongly to elevated levels of sucrose. Mol Gen Genet 224: 136–146