|
|
||||||||
|
First published online September 4, 2003; 10.1104/pp.103.026609 Plant Physiology 133:794-802 (2003) © 2003 American Society of Plant Biologists The Nitrilase ZmNIT2 Converts Indole-3-Acetonitrile to Indole-3-Acetic Acid1Lehrstuhl für Genetik, Technische Universität München, D85350 Freising, Germany (W.J.P., V.K., A.G., E.G.); Lehrstuhl für Pflanzenphysiologie, Ruhr-Universität, D44801 Bochum, Germany (A.M., M.P.); and Pioneer Hi-Bred International, Johnston, Iowa 501311004 (R.B.M.)
We isolated two nitrilase genes, ZmNIT1 and ZmNIT2, from maize (Zea mays) that share 75% sequence identity on the amino acid level. Despite the relatively high homology to Arabidopsis NIT4, ZmNIT2 shows no activity toward -cyano-alanine, the substrate of Arabidopsis NIT4, but instead hydrolyzes indole-3-acetonitrile (IAN) to indole-3-acetic acid (IAA). ZmNIT2 converts IAN to IAA at least seven to 20 times more efficiently than AtNIT1/2/3. Quantitative real-time polymerase chain reaction revealed the gene expression of both nitrilases in maize kernels where high concentrations of IAA are synthesized tryptophan dependently. Nitrilase protein and endogenous nitrilase activity are present in maize kernels together with the substrate IAN. These results suggest a role for ZmNIT2 in auxin biosynthesis.
Indole-3-acetic acid (IAA) is the most abundant natural auxin and was isolated from plants more than 50 years ago (Luckwill, 1952
Originally, the amino acid Trp was identified as the precursor of IAA, and IAA synthesis was suggested to occur by deamination and decarboxylation of Trp (for review, see Bandurski et al., 1995
Furthermore, two separate intracellular pools of Trp were suggested by the fact that exogenously added Trp can be converted to IAA more readily than endogenous Trp (Rapparini et al., 1999
Although details of IAA synthesis from Trp are still unclear, two major pathways have been postulated based on the detection of proposed intermediates and enzymes (for review, see Normanly and Bartel, 1999
Nitrilases (EC 3.5.5.1) that hydrolyze nitriles (e.g. IAN) to the corresponding carboxylic acids (as IAA) received particular interest due to their potential role in IAA biosynthesis. Nitrilase activity is observed in the crude extract of some plant families, including Crucifereae, Gramineae, and Musaceae (Thimann and Mahadevan, 1964a
As maize kernels accumulate high amounts of IAA conjugates (Epstein et al., 1980
Two genes encoding nitrilases were isolated from maize, ZmNIT1 (GenBank accession no. AY156979) and ZmNIT2 (GenBank accession no. AY156978). ZmNIT1 was mapped (Burr and Burr, 1991
RNA was extracted from isolated embryo, endosperm, and aleurone/pericarp of maize kernels. The expression of ZmNIT1 and ZmNIT2 in maize kernels was quantitatively examined by real-time PCR of cDNA (Fig. 1). The kernel-specific expression pattern was similar for ZmNIT1 and ZmNIT2; the steady-state transcription levels were highest in embryo tissue and increased until 5 weeks after pollination (data not shown).
To examine the nitrilase protein expression, we carried out immunoblot analyses with protein extracts of maize kernels (5 weeks after pollination). Anti-ZmNIT1 antibodies recognizing both nitrilases detected strong signals in the aleurone/pericarp layers and in the embryo, and a weaker signal in the endosperm (Fig. 2). Such western signals were not visible in the analysis using preimmune serum. This pattern of tissue-specific expression was further supported by immunoblot tests with kernel tissue prints (data not shown).
ZmNIT1 and ZmNIT2 expression was also determined in seedlings. In primary root tip 2, 4, and 7 d after germination, ZmNIT2 transcript levels of 4.0 ± 0.4, 15 ± 0.4, and 9.6 ± 0.6 fg µg1 total RNA, respectively, were detected, whereas ZmNIT1 expression was very low (0.21 ± 0.09, 0.26 ± 0.08, and 0.28 ± 0.03 fg µg1 total RNA, respectively). As ZmNIT2 mRNA expression was highest 4 d after germination, ZmNIT1 and ZmNIT2 expression was determined at this stage in different tissues of the seedling (Fig. 3). The same expression pattern was observed in light- and dark-grown seedlings.
By reverse-phase HPLC, we measured the in vitro enzyme activity of ZmNIT1 and ZmNIT2 toward IAN as substrate using bacterial crude extracts containing heterologously expressed nitrilases. ZmNIT2 efficiently converted IAN to IAA (Fig. 4C). In addition, indole-3-acetamide was formed as a side product. ZmNIT1 revealed only little activity (Fig. 4B) that was not changed in the absence of His-tag (data not shown). Bacterial crude extract containing only empty vectors did not convert IAN to IAA (Fig. 4A).
Nitrilase activity was confirmed (Fig. 5A) by the quantification of ammonia released during the reaction (Vorwerk et al., 2001
To allow direct comparison with nitrilases from Arabidopsis (Table II), the kinetic parameters of ZmNIT2 were determined at 30°C, pH 8.0, and revealed a KM value of 4.1 mM and Vmax of 286 nmol mg1 protein min1 for IAN (Table II). For 4-phenylbutyronitrile, ZmNIT2 revealed a higher turnover rate (Vmax = 2,000 nmol mg1 min1) but also a higher KM value (13.2 mM).
Endogenous nitrilase activity converting IAN to IAA was tested with protein extracts from embryo, endosperm, and aleurone/pericarp of maize kernels (Fig. 6). Nitrilase activity was observed in all the protein samples. Four weeks after pollination, higher activities of nitrilase were determined in embryo (1.62 ± 0.45 pmol mg1 protein min1, Fig. 6A) and aleurone/pericarp (1.74 ± 0.70 pmol mg1 protein min1, Fig. 6C) than in endosperm (0.77 ± 0.30 pmol mg1 protein min1, Fig. 6B). The activity in embryo increased about 5-fold from the 3rd to the 5th week after pollination. IAA was also detected in boiled controls for all the tests, but the level was much lower than that obtained with active proteins (data not shown). All of the data were corrected for the IAA amount observed in the boiled controls that might be generated by nonspecific conversion of IAN to IAA (Ilic et al., 1996
To evaluate the role of maize nitrilases in the conversion of IAN to IAA in vivo, we tested whether the substrate IAN was actually present in maize kernels. Extracts from subfractions of maize kernels were subjected to gas chromatography (GC)/mass spectrometry (MS), and IAN was identified by retention time, molecular mass, and typical fragmentation pattern (Müller and Weiler, 2000a
Two nitrilase genes, ZmNIT1 and ZmNIT2, were identified in maize. The chromosomal regions where the maize nitrilases are located are syntenic and probably result from ancient tetraploidization (Gale and Devos, 1998
Quantitative real-time PCR (Fig. 1) revealed the expression of ZmNIT1 and ZmNIT2 in maize kernels where Trp-dependent auxin biosynthesis prevails (Glawischnig et al., 2000
ZmNIT2 shows high activity with several substrates in vitro, including IAN (Fig. 5). According to their kinetic parameters, ZmNIT2 hydrolyzes IAN to IAA more efficiently than AtNIT1, AtNIT2, and AtNIT3 (Table II). This property and the fact that ZmNIT2 is expressed in the maize kernel where the substrate IAN is present (Figs. 1, 2, and 7) suggest that ZmNIT2 has the capacity to synthesize IAA in maize kernels. The Arabidopsis nitrilases, especially the comparatively highly expressed AtNIT1, could be involved in indole glucosinolate metabolism in addition to IAA biosynthesis (for review, see Glawischnig et al., 2003
As expected for a biosynthetic intermediate, the concentration of IAN in maize kernels is relatively low. It ranges from 24 pmol (3.7 ng) g1 fresh weight in endosperm to 347 pmol (54 ng) g1 fresh weight in embryo, 5 weeks after pollination (Table III), which is one order of magnitude lower than that reported for Arabidopsis seedlings (Normanly et al., 1997
Jensen and Bandurski (1994
ZmNIT2 mRNA was also detected in maize seedlings, where it is expressed in coleoptile, mesocotyl, and primary root (Fig. 3). This expression is not light inducible. Although ZmNIT2 mRNA is also expressed 7 d after germination, the amount of nitrilase protein rapidly decreased with seedling age (data not shown), indicating that nitrilase expression in seedling is partly regulated at the level of protein expression or stability. The presence of IAN in seedlings opens the possibility of a Trp-dependent IAA biosynthetic pathway via IAN in maize seedlings. However, in contrast to kernels, here, the contribution of Trp-dependent IAA biosynthesis is questioned (Östin et al., 1999
The enzymes potentially involved in IAN biosynthesis in maize are unknown. CYP79B homologs converting Trp to indole-3-acetaldoxime (IAOx; Hull et al., 2000
When compared with Arabidopsis nitrilases, ZmNIT2 shows highest homology to AtNIT4. AtNIT4 and ZmNIT2 share an identity of 69.3%, whereas ZmNIT2 and the other Arabidopsis nitrilases share an identity of about 60% (Table I). This observation is in contrast to the substrate specificities associated with these enzymes. Arabidopsis NIT4 is not active with IAN as substrate but reveals activity toward
Plant Material Maize (Zea mays) cultivar Landmark (a sweet corn) was grown on a local field in the vicinity of Munich, and the ears were harvested 2 to 5 weeks after the pollination. The material was deep frozen and kept at 70°C.
Total RNA was isolated from kernels (Wessler, 1994
Real-time PCR primers specific to ZmNIT1 (forward, GACGATGACTATGTGCAGACCTAA; reverse, CAATCTCGTCCAATCCATGTATA) and to ZmNIT2 (forward, AGCTGCCAAGAGTGATATCGATACTAAG; reverse, CACAAGGAACATAACTGCGGCC) were designed based on the 3' sequences of ZmNIT1 and ZmNIT2. Q-solution (Qiagen, Valencia, CA) was included for the PCR of ZmNIT2 to increase specificity. For real-time PCR, total RNA was isolated from embryo, endosperm, and aleurone/pericarp of maize kernels with a RNA purification kit (NucleoSpin RNA Plant; Macherey & Nagel, Düren, Germany) and 2 µg of the total RNA was reverse transcribed with a cDNA synthesis kit (Taq-Man; Roche). Quantitative real-time PCR was carried out using the LightCycler (Roche), and the increase of PCR product was monitored using Syb®Green. The mRNA level of ZmNIT1 and ZmNIT2 was automatically calculated based on the standard curve obtained with the plasmid clones in the same batch of PCR. pBluescript (Stratagene, La Jolla, CA) transcripts were added to the realtime PCR as an internal standard, and their amplification levels were examined.
The coding regions of ZmNIT1 and ZmNIT2 were cloned into a pET3a expression vector containing a 6-His-tag (Novagen, Madison, WI). As the cDNA sequence of ZmNIT2 coding N terminus was incomplete, the missing part was introduced from the genomic clone of ZmNIT2. Sequencing of cDNA confirmed the endogenous expression of the 5' sequences. ZmNIT1 and ZmNIT2 proteins were heterologously expressed in Escherichia coli BL21(DE3). Bacterial cells were harvested by centrifugation at 8,000g for 8 min, resuspended in 50 mM potassium buffer (pH 8.0), and treated with lysozyme (1 mg mL1) for 30 min on ice. The resulting lysate was sonicated three times at 200 W for 10 s and was centrifuged at 10,000g for 30 min at 4°C. The supernatant was used for enzyme assay (crude extract). ZmNIT2 containing a C-terminal 6-His-tag was purified under native conditions using a Ni-NTA column (Qiagen). ZmNIT1 was purified under denaturing conditions with 8 M urea. After elution from the Ni-NTA column, pure ZmNIT1 was obtained by preparative SDS-PAGE (PrepCell; Bio-Rad, Hercules, CA). Purified enzymes were used for enzyme activity tests and immunization of rabbits (Eurogentec, Brussels, Belgium).
Deep-frozen plant materials were ground with mortar and pestles, suspended in extraction buffer (20 mM Tris, 140 mM NaCl, 1 mM EDTA, and 1 mM PMSF, pH 7.5), and cleared by centrifugation at 10,000g for 30 min. The crude protein in the supernatant was (NH4)2SO4 (75%, w/w) precipitated, redissolved, separated on a 10% (v/v) SDS-PAGE gel, transferred to a nitrocellulose membrane, and probed with nitrilase-specific antibodies. The membrane was further incubated with anti-rabbit immunoglobulin G conjugated with Cy5 (Amersham Pharmacia Biotech, Piscataway, NJ), and the signal was detected with a phosphoimager (Storm 860; Amersham Pharmacia Biotech) using a red fluorescence filter.
The nitrilase activity of recombinant ZmNIT1 and ZmNIT2 converting IAN to IAA in bacterial crude extract was examined by IAA quantification based on a reverse-phase C18 HPLC. The reaction mixture (50 mM potassium phosphate buffer, pH 8.0, 1 mM IAN, and 50 µg of boiled or active proteins, final volume of 100 µL) was incubated for 3 h at 30°C. Reactions were stopped by the addition of 10% (v/v) acetic acid, and the mixture was immediately partitioned three times with 100 µL of ethyl acetate. The recovered organic phase was evaporated in a speed-vac (H.-Saur, Reutlingen, Germany), and the dried substances were dissolved in 100% (v/v) methanol and analyzed on a HPLC with a reverse-phase column (LiChroCART 125-4, RP-18, 5 µm; Merck, West Point, PA). The mobile phase was delivered at a flow rate of 1 mL min1 with an initial mixture of 25% (v/v) methanol in 10% (v/v) acetic acid for 2 min and was followed by a 12-min linear gradient to 70% (v/v) methanol. The elution profile was monitored with a photodiode array detector (Detector 158; Beckman Instruments, Fullerton, CA). The peaks eluted at 9.2, 13.0, and 15.1 min were identified as indole-3-acetamide, IAA, and IAN, respectively, by comparison with the standard substances with respect to retention time and UV spectrum.
For determination of substrate specificity and kinetic parameters of recombinant ZmNIT1 and ZmNIT2, nitrilase activity was measured by quantification of ammonia produced during the enzyme action using the Berthelot reaction (Bolleter et al., 1961
To measure endogenous nitrilase activity, we isolated embryo, endosperm, and aleurone/pericarp extracted in 50 mM potassium phosphate buffer (pH 8.0, 1 mM DTT) and cleared by centrifugation at 17,500g for 30 min. The supernatant was precipitated with 75% (w/v) ammonium sulfate and was centrifuged again. The pellet was resuspended with 1 mL of 50 mM potassium phosphate buffer, pH 8.0, and desalted with a disposable column (NAP-10; Amersham Pharmacia Biotech). The desalted fraction was used for enzyme activity test. Reaction mixture (40 µg of protein, 1 mM IAN, and 50 mM potassium phosphate buffer, pH 8.0, total volume of 250 µL) was incubated at 30°C in the dark for 3 h. The pH was then adjusted higher than 9.5 with 1 M Na2CO3, and the solution was extracted with 400 µL of ethyl acetate. The aqueous lower phase was recovered, and the partitioning procedure was repeated after addition of 200 µL of water. The collected aqueous phase was acidified and partitioned as described for the test with recombinant enzymes. The final sample was separated on an HPLC with a reverse-phase column (LiChroCART 2504, RP-18, 5 µm; Merck). The mobile phase was delivered at a flow rate of 1.2 mL min1 with an initial mixture of 25% (v/v) methanol in 10% (v/v) acetic acid for 2 min and followed by a 12-min linear gradient to 70% (w/v) methanol. The elution was monitored with a fluorescence detector (RF-10AXL; Shimadzu, Duisburg, Germany) at the emission wavelength of 360 nm with excitation at 285 nm. The amount of produced IAA was determined by integration of the peak area and was corrected for nonspecific conversion.
One gram of endosperm, embryo, aleurone/pericarp, coleoptile, and primary root tissue, respectively, was ground in liquid nitrogen and extracted with 5 mL of methanol for 1 h at room temperature and for 5 min at 60°C. The solvent was removed under reduced pressure and the residue was extracted in 500 µL of water, 500 µL of MeOH, and 1 mL of CHCl3. The chloroform fraction was dried and redissolved in 200 µL of 30% (v/v) MeOH in water, sonicated, and centrifuged for 20 min at 100,000g. The supernatant was applied to reverse-phase HPLC using a Luna RP-18 column (250 x 0.4 mm; Phenomenex, Torrance, CA). The column was developed at a flow rate of 1 mL min1 with a gradient of 10 min isocratic flow at 30% (v/v) aqueous methanol 0.01% (v/v) trifluoroacetic acid, followed by a linear gradient up to 100% (v/v) methanol 0.01% (v/v) trifluoroacetic acid during 10 min. The effluent was monitored photometrically at 280 nm. During separation, fractions of 1 mL were collected and the retention volume of IAN (20.5 mL) was determined afterward using 0.5 mM solution. MeOH was removed from the pooled IAN-containing fractions and the remaining water phase was extracted with EtOAc. The solvent was removed under reduced pressure and the residue was redissolved in 10 µL of CHCl3. One microliter was analyzed by GC-MS, as described in Müller and Weiler (2000a
We thank Dr. Benjamin Burr for processing mapping data, Prof. Udo Wienand for providing an endosperm-specific library, Prof. Elmar W. Weiler, Dr. Monika Frey, and Dr. Ulrich Genschel for critical discussions, and Laura Helming for excellent help in isolating the cDNAs. Received May 8, 2003; returned for revision July 1, 2003; accepted July 8, 2003.
Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.103.026609.
1 This work was supported by the Deutsche Forschungsgemeinschaft Schwerpunktprogramm 1067.
2 Present address: Department of Molecular Biology, Dankook University, Seoul 140714, South-Korea. * Corresponding author; e-mail egl{at}wzw.tum.de; fax 498161715636.
Bacher A, Rieder C, Eichinger D, Arigoni D, Fuchs G, Eisenreich W (1999) Elucidation of novel biosynthesis pathways and metabolite flux patterns by retrobiosynthetic NMR analysis. FEMS Microbiol Rev 22: 567598[CrossRef]
Bak S, Tax FE, Feldmann KA, Galbraith DW, Feyereisen R (2001) CYP83B1, a cytochrome P450 at the metabolic branch point in auxin and indole glucosinolate biosynthesis in Arabidopsis. Plant Cell 13: 101111 Bandurski RS, Cohen JD, Slovin J, Reinecke DM (1995) Auxin biosynthesis and metabolism. In JP Davies, ed, Plant Hormones: Physiology, Biochemistry, and Molecular Biology. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp 3965
Bartel B, Fink GR (1994) Differential regulation of an auxin-producing nitrilase gene family in Arabidopsis thaliana. Proc Natl Acad Sci USA 91: 66496653
Bartel B, LeClere S, Magidin M, Zolman BK (2001) Inputs to the active indole-3-acetic acid pool: de novo synthesis, conjugation hydrolysis, and indole-3-butyric acid Bartling D, Seedorf M, Mithoefer A, Weiler EW (1992) Cloning and expression of an Arabidopsis nitrilase which can convert indole-3-acetonitrile to the plant hormone, indole-3-acetic acid. Eur J Biochem 205: 417424[ISI][Medline]
Bartling D, Seedorf M, Schmidt RC, Weiler E (1994) Molecular characterization of two cloned nitrilases from Arabidopsis thaliana: key enzymes in biosynthesis of the plant hormone indole-3-acetic acid. Proc Natl Acad Sci USA 91: 60216025 Bolleter WT, Bushman CJ, Tidwell PW (1961) Spectrophotometric determination of ammonia as indophenol. Anal Biochem 33: 592594 Burr B, Burr FA (1991) Recombinant inbreds for molecular mapping in maize: theoretical and practical considerations. Trends Genet 7: 5560[ISI][Medline]
Epstein E, Cohen JD, Bandurski RS (1980) Concentration and metabolic turnover of indoles in germinating kernels of Zea mays L. Plant Physiol 65: 415421 Fahey JW, Zalemann AT, Talalay P (2001) The chemical diversity and distribution of glucosinolates and isothiocyanates among plants. Phytochemistry 56: 551[CrossRef][ISI][Medline]
Frey M, Chomet P, Glawischnig E, Stettner C, Grün S, Winkelmair A, Eisenreich W, Bacher A, Meeley RB, Briggs SP et al. (1997) Analysis of a chemical plant defense mechanism in grasses. Science 277: 696699
Gale MD, Devos KM (1998) Plant comparative genetics after 10 years. Science 282: 656659 Glawischnig E, Mikkelsen MD, Halkier BA (2003) Glucosinolate biosynthesis and metabolism. In Y Abrol, A Ahmad eds, Sulphur in Plants. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp 145162
Glawischnig E, Tomas A, Eisenreich W, Spiteller P, Bacher A, Gierl A (2000) Auxin biosynthesis in maize kernels. Plant Physiol 123: 11091119 Helminger J, Rausch T, Hilgenberg W (1985) Metabolism of 14C-indole-3-acetaldoxime by hypocotyls of Chinese cabbage. Phytochemistry 24: 24972502[CrossRef] Hillebrand H, Bartling D, Weiler EW (1998) Structural analysis of the NIT2/NIT1/NIT3 gene cluster encoding nitrilases, enzymes catalyzing the terminal activation step in indole-acetic acid biosynthesis in Arabidopsis thaliana. Plant Mol Biol 36: 8999[CrossRef][ISI][Medline]
Hull AK, Vij R, Celenza JL (2000) Arabidopsis cytochrome P450s that catalyze the first step of tryptophan-dependent indole-3-acetic acid biosynthesis. Proc Natl Acad Sci USA 97: 23792384 Ilic N, Normanly J, Cohen JD (1996) Quantification of free plus conjugated indole-acetic acid in Arabidopsis requires correction for the nonenzymatic conversion of indolic nitriles. Plant Physiol 111: 781788[Abstract] Jensen PJ, Bandurski RS (1994) Metabolism and synthesis of indole-3-acetic acid (IAA) in Zea mays (levels of IAA during kernel development and the use of in vitro endosperm systems for studying IAA biosynthesis). Plant Physiol 106: 343351[Abstract] Jensen PJ, Bandurski RS (1996) Incorporation of deuterium into indole-3-acetic acid and tryptophan in Zea mays seedlings grown on 30% deuterium oxide. J Plant Physiol 147: 697702
Kobayashi M, Izui H, Nagasawa T, Yamada H (1993) Nitrilase in biosynthesis of the plant hormone indole-3-acetic acid from indole-3-acetonitrile: cloning of the Alcaligenes gene and site-directed mutagenesis of cysteine residues. Proc Natl Acad Sci USA 90: 247251
Koshiba T, Kamiya Y, Iino M (1995) Biosynthesis of indole-3-acetic acid from L-tryptophan in coleoptile tips of maize (Zea mays L.). Plant Cell Physiol 36: 15031510 Kutz A, Müller A, Peter H, Kaiser WM, Piotrowski M, Weiler EM (2002) A role for nitrilase 3 in the regulation of root morphology in sulfur starving Arabidopsis thaliana. Plant J 30: 95106[CrossRef][ISI][Medline] Luckwill LC (1952) Application of paper chromatography to the separation and identification of auxins and growth inhibitors. Nature 169: 375 Ludwig-Müller J, Hilgenberg W (1988) A plasma membrane-bound enzyme oxidases L-tryptophan to indole-3-acetaldoxime. Physiol Plant 74: 240250[CrossRef]
Michalczuk L, Ribnicky DM, Cooke TJ, Cohen JD (1992) Regulation of indole-3-acetic acid biosynthesis pathways in carrot cell cultures. Plant Physiol 100: 13461353
Mikkelsen MD, Hansen CH, Wittstock U, Halkier BA (2000) Cytochrome P450 CYP79B2 from Arabidopsis catalyzes the conversion of tryptophan to indole-3-acetaldoxime, a precursor of indole glucosinolates and indole-3-acetic acid. J Biol Chem 275: 3371233717 Müller A, Hillebrand H, Weiler EW (1998) Indole-3-acetic acid is synthesized from L-tryptophan in roots of Arabidopsis thaliana. Planta 206: 362369[CrossRef][ISI][Medline] Müller A, Weiler EW (2000a) Indolic constituents and indole-3-acetic acid biosynthesis in the wild-type and a tryptophan auxotroph mutant of Arabidopsis thaliana. Planta 211: 855863[CrossRef][ISI][Medline] Müller A, Weiler EW (2000b) IAA synthase, an enzyme complex from Arabidopsis thaliana catalyzing the formation of indole-3-acetic acid from (S)-tryptophan. Biol Chem 381: 679686[Medline] Normanly J, Bartel B (1999) Redundancy as a way of life: IAA metabolism. Curr Opin Plant Biol 2: 207213[CrossRef][ISI][Medline]
Normanly J, Cohen J, Fink GR (1993) Arabidopsis thaliana auxotrophs reveal a tryptophan-independent biosynthetic pathway for indole-3-acetic acid. Proc Natl Acad Sci USA 90: 1035510359 Normanly J, Grisafi P, Fink GR, Bartel B (1997) Arabidopsis mutants resistant to the auxin effects of indole-3-acetonitrile are defective in the nitrilase encoded by the NIT1 gene. Plant Cell 9: 17811790[Abstract]
Östin A, Ilic N, Cohen JD (1999) An in vitro system from maize seedlings for tryptophan-independent indole-3-acetic acid biosynthesis. Plant Physiol 119: 173178
Piotrowski M, Schönfelder S, Weiler EW (2001) The Arabidopsis thaliana NIT4 and its orthologs in tobacco Rapparini F, Cohen JD, Slovin JP (1999) Indole-3-acetic acid biosynthesis in Lemna gibba studied using stable isotope labeled anthranilate and tryptophan. Plant Growth Regul 27: 139144[CrossRef] Rausch T, Hilgenberg W (1980) Partial purification of nitrilase from Chinese cabbage. Phytochemistry 19: 747750[CrossRef] Ribnicky DM, Ilic N, Cohen JD, Cooke TJ (1996) The effects of exogenous auxins on endogenous indole-3-acetic acid metabolism: the implications for carrot somatic embryogenesis. Plant Physiol 112: 549558[Abstract] Schmidt RC, Müller A, Hain R, Bartling D, Weiler EW (1996) Transgenic tobacco plants expressing the Arabidopsis thaliana nitrilase II enzyme. Plant J 9: 683691[CrossRef][ISI][Medline]
Sekimoto H, Seo M, Dohmae N, Takio K, Kamiya Y, Koshiba T (1997) Cloning and molecular characterization of plant aldehyde oxidase. J Biol Chem 272: 1528015285
Seo M, Akaba S, Oritani T, Delarue M, Bellini C, Caboche M, Koshiba T (1998) Higher activity of an aldehyde oxidase in the auxin-overproducing superroot1 mutant of Arabidopsis thaliana. Plant Physiol 116: 687693 Tam YY, Normanly J (1998) Determination of indole-3-pyruvic acid levels in Arabidopsis thaliana by gas chromatography-selected ion monitoring-mass spectrometry. J Chromatogr A 800: 101108[CrossRef][ISI][Medline] Thimann KV, Mahadevan S (1964a) Nitrilase: occurrence, preparation and general mode of action. Arch Biochem Biophys 105: 133141. Thimann KV, Mahadevan S (1964b) Nitrilase: substrate specificity and possible mode of action. Arch Biochem Biophys 107: 6268.[CrossRef][Medline] Vorwerk S, Biernacki S, Hillebrand H, Janzik I, Müller A, Weiler EW, Piotrowski M (2001) Enzymatic characterization of the recombinant Arabidopsis thaliana nitrilase subfamily encoded by the NIT2/NIT1/NIT3 gene cluster. Planta 212: 508516[CrossRef][ISI][Medline]
Walz A, Park S, Slovin JP, Ludwig-Müller J, Momonoki YS, Cohen JD (2002) A gene encoding a protein modified by the phytohormone indole acetic acid. Proc Natl Acad Sci USA 99: 17181723 Wessler SR (1994) Isolation of RNA from Wx and wx endosperms. In M Freeling, V Walbot, eds, The Maize Handbook. Springer-Verlag, New York, pp 545546
Wright AD, Sampson MB, Neuffer MG, Michalczuk L, Slovin JP, Cohen JD (1991) Indole-3-acetic acid biosynthesis in the mutant maize orange pericarp, a tryptophan auxotroph. Science 254: 9981000
Zhao Y, Christensen SK, Fankhauser C, Cashman JR, Cohen JD, Weigel D, Chory J (2001) A role for flavin monooxygenase-like enzymes in auxin biosynthesis. Science 291: 306309 Related articles in Plant Physiol.:
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||