| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
|
First published online September 4, 2003; 10.1104/pp.103.026534 Plant Physiology 133:966-977 (2003) © 2003 American Society of Plant Biologists Translation Start Sequences Affect the Efficiency of Silencing of Agrobacterium tumefaciens T-DNA Oncogenes1Departments of Microbiology and Horticulture, Oregon State University, Corvallis, Oregon 97331
Agrobacterium tumefaciens oncogenes cause transformed plant cells to overproduce auxin and cytokinin. Two oncogenes encode enzymes that convert tryptophan to indole-3-acetic acid (auxin): iaaM (tryptophan mono-oxygenase) and iaaH (indole-3-acetamide hydrolase). A third oncogene (ipt) encodes AMP isopentenyl transferase, which produces cytokinin (isopentenyl-AMP). Inactivation of ipt and iaaM (or iaaH) abolishes tumorigenesis. Because adequate means do not exist to control crown gall, we created resistant plants by introducing transgenes designed to elicit posttranscriptional gene silencing (PTGS) of iaaM and ipt. Transgenes that elicit silencing trigger sequence-specific destruction of the inducing RNA and messenger RNAs with related sequences. Although PTGS has proven effective against a variety of target genes, we found that a much higher percentage of transgenic lines silenced iaaM than ipt, suggesting that transgene sequences influenced the effectiveness of PTGS. Sequences required for oncogene silencing included a translation start site. A transgene encoding a translatable sense-strand RNA from the 5' end of iaaM silenced the iaaM oncogene, but deletion of the translation start site abolished the ability of the transgene to silence iaaM. Silencing A. tumefaciens T-DNA oncogenes is a new and effective method to produce plants resistant to crown gall disease.
Crown gall tumors result from overproduction of auxin and cytokinin in plant cells transformed by Agrobacterium tumefaciens (Winans, 1992  ). These abnormally high phytohormone levels result from expression of three genes transferred stably into the plant genome from the A. tumefaciens tumor-inducing (Ti) plasmid: iaaM (Trp mono-oxygenase), iaaH (indole-3-acetamide hydrolase), and ipt (AMP isopentenyl transferase; Garfinkel et al., 1981; Ream et al., 1983). IaaM converts Trp into indole-3-acetamide, which IaaH converts into indole-3-acetic acid (auxin; Inzé et al., 1984; Schroeder et al., 1984; Thomashow et al., 1985, 1986; Van Onckelen et al., 1986). Loss of either enzyme prevents auxin production. Ipt converts AMP into isopentenyl-AMP, a cytokinin (Akiyoshi et al., 1984; Barry et al., 1984; Buchmann et al., 1985). Inactivation of ipt and either one of the two auxin biosynthesis genes abolishes crown gall formation (Ream et al., 1983).
Adequate means do not exist to control crown gall disease on grapes, fruit and nut trees, cane berries, chrysanthemum, rose, and other nursery crops. Inoculation of plants with Agrobacterium radiobacter strain K84 affords some protection against specific strains of A. tumefaciens (Moore, 1988
Our strategy to produce crown-gall-resistant plants was based on the phenomenon called posttranscriptional gene silencing (PTGS) or RNA interference (RNAi; Napoli et al., 1990
A number of transgene constructions can trigger PTGS. Early observations implicated high levels of sense-strand transcription across an untranslatable (or wild-type) transgene as an elicitor of PTGS; silencing often correlated with multiple-copy transgenes (Napoli et al., 1990 Our goal was to create crown-gall-resistant plants by introducing transgenes that elicit posttranscriptional silencing of two A. tumefaciens oncogenes, iaaM and ipt. Although silencing has proven effective against a variety of target genes, we found that iaaM was silenced in a much higher percentage of transgenic lines than ipt, suggesting that target gene sequences influenced the effectiveness of gene silencing.
Roots respond only to the auxin-producing oncogenes (iaaM and iaaH). The presence or absence of the cytokinin biosynthesis oncogene (ipt) does not affect crown gall development on roots of any plant species we have tested, including Arabidopsis, apple (Malus domestica), carrot (Daucus carota), potato (Solanum tuberosum), and Jerusalem artichoke (Helianthus tuberosus; Ream et al., 1983
Construction of Genes Encoding Sense-Strand RNAs with Premature Stop Codons
Two A. tumefaciens oncogenes were silenced in this study: iaaM and ipt. Constructions were based on the observation that mRNAs containing premature stop codons can destabilize homologous translatable RNA molecules (Dougherty et al., 1994
We introduced these transgenes (separately) into "haploid" tobacco (Nicotiana tabacum cvs Burley and Kentucky) and then doubled the chromosomes of kanamycin-resistant transformants to produce plants homozygous for each transgene. These plants were the subjects of our initial tests, which we repeated on the progeny of self pollinations.
Putative iaaM-silencing plants (TDP1 lines) were challenged with an ipt mutant (strain 338; Garfinkel et al., 1981
Experiments with grafted plants showed that our iaaM-stop construct did not elicit systemic silencing of the iaaM oncogene. We grafted: (a) vector-only scions (PEV6-B14) to three iaaM-silencing rootstocks (TDP1-B7) and (b) iaaM-silencing scions to four vector-only rootstocks. Wild-type (A348) and ipt-mutant A. tumefaciens were inoculated onto vector-only and iaaM-stop regions of each stem. All seven plants gave identical results: Tissue containing only vector sequences did not silence iaaM, regardless of its position in the plant (rootstock or scion). Vector-only stems produced large unorganized galls when inoculated with wild-type A. tumefaciens, and they were susceptible to an ipt mutant. In contrast, all stems that contained the iaaM-stop transgene silenced iaaM. These stems did not respond to infection with an ipt mutant, and they produced shooty galls when inoculated with wild-type A. tumefaciens. Thus, the iaaM-stop transgene was highly effective in cells containing the construct, but it did not produce a signal that could move across a graft (downward or upward). Escobar et al. (2003
Of 45 putative ipt-silencing plants (CW1 lines), one (CW1-K27) did not respond to the wild-type ipt gene on the incoming A. tumefaciens T-DNA. This line did not respond when challenged with an iaaM mutant (strain 328; Fig. 2C). It produced small necrotic galls (Fig. 2C) typical of auxin-rich tumors (Garfinkel et al., 1981 We tested 29 lines (CW4) that contained the fused ipt::iaaM-stop transgene. One line (CW4-B30) reduced tumorigenesis significantly, showing little or no response to inoculation with wild-type A. tumefaciens (Fig. 2D). Although this line reduced gall size markedly and prevented gall formation at some inoculation sites, it did not abolish tumorigenesis. Nine other CW4 lines produced shooty galls in response to infection by wild-type A. tumefaciens, indicating that these tumor cells expressed ipt but not iaaM. Two additional CW4 lines did not respond to infection with an ipt mutant, indicating that these lines also silenced iaaM. Thus, 41% (12 of 29) of the ipt::iaaM-stop plants silenced iaaM, but only one of these lines (3%) also silenced ipt. As controls, we constructed 11 kanamycin-resistant plant lines (designated PEV6) that contained the transformation vector T-DNA without a transgene downstream of the CaMV promoter. These lines developed unorganized tumors upon infection with wild-type A. tumefaciens (data not shown). An iaaM mutant induced shooty tumors, whereas an ipt mutant caused small necrotic galls, as expected (data not shown). Thus, PEV6 lines responded to A. tumefaciens in the same way as the parental non-transgenic tobacco cultivars, indicating that vector sequences did not block T-DNA oncogene expression.
We performed Southern-blot analyses on representative plant lines of each type. Figure 3A shows the T-DNA structures from lines containing either the iaaM-stop or the ipt::iaaM-stop transgene. Each DNA sample was digested with BamHI, which will produce an 1,800-bp fragment from intact copies of either transgene (Fig. 1). The blot was probed with radiolabeled iaaM sequences, and all lines (except for PEV6 lines, which contained only vector sequences) exhibited an 1,800-bp BamHI fragment indicating the presence of an intact transgene (Fig. 3A, lanes 1–8). All lines that silenced incoming wild-type A. tumefaciens oncogenes (TDP1 lines B7, B17, B27, and CW4-B30) also contained at least one rearranged transgene copy (Fig. 3A, lanes 4–7).
The T-DNAs each contained a single EcoRI site located in the 3'-untranslated region (UTR) downstream of the transgene (Fig. 1). Each integrated copy of the T-DNA, when digested with EcoRI, produced a restriction fragment extending from the EcoRI site in the 3'-UTR to the nearest EcoRI site upstream in the plant genome, resulting in fragments containing unknown lengths of plant DNA. Thus, the number of EcoRI fragments indicated the minimum transgene copy number. All plant lines examined contained at least two transgene copies (Fig. 3B), which proved sufficient to silence an incoming iaaM oncogene upon infection of lines TDP1-B17 and TDP1-B27. Transgenes present in more than two copies silenced target oncogenes in some instances (e.g. lines TDP1-B7 and CW4-B30; Fig. 3B, lanes 1 and 6) but not in others (e.g. lines CW4-B1 and TDP1-B31; Fig. 3B, lanes 3 and 8). Thus, transgene copy number did not correlate with the ability to silence incoming A. tumefaciens oncogenes. Intact copies of the ipt-stop transgene in CW1 plant lines released a 682-bp restriction fragment upon digestion with Hinf1; both lines examined (CW1-K27 and CW1-K52) contained one intact copy (Fig. 3C). Two rearranged copies of ipt-stop were evident in both Hinf1 and EcoRI digests of the ipt-silencing line (CW1-K27), but the non-silencing line (CW1-K52) did not contain rearranged copies (Fig. 3C).
PTGS drastically reduces cytoplasmic accumulation of mRNA encoded by the eliciting transgene and by other genes that contain sufficient sequence identity (Dougherty et al., 1994 As anticipated, all iaaM-silencing lines examined (TDP1-B7, -B17, and -B27) lacked sense-strand transgene mRNA, which should migrate at 2.08 kb (Fig. 4A, lanes 1–3). Three non-silencing lines also lacked sense-strand iaaM-stop mRNA; data are shown for one line (TDP1-B31; Fig. 4A, lane 4). Because these blots were exposed to film for an extended period, we observed signals from ribosomal RNAs (rRNA) in all lanes, including those with RNA from vector-only plants (PEV6-B2 and PEV6-B14; Fig. 4A, lanes 9 and 10), which shares no significant homology with the probe.
Large antisense iaaM transcripts accumulated to high levels in iaaM-silencing lines (TDP1-B7 and -B17; Fig. 5A, lanes 1 and 2). These antisense RNAs included molecules that formed a distinct band at approximately 3.8 kb and smaller species of heterogeneous length, which formed a smear (Fig. 5A, lanes 1–3). The length of these antisense transcripts suggests that they may have originated at the nopaline synthase promoter of the transformation vector (Fig. 1). Ribosomal RNAs (Fig. 5B) and ubiquitin mRNA (Fig. 4C) in these preparations formed discrete bands indicating that they were not degraded. A plant line that reduced iaaM expression (TDP1-B27) contained a much smaller amount of iaaM-stop antisense RNA (Fig. 5A, lane 3) than lines that abolished iaaM expression (TDP1-B7 and -B17; Fig. 5A, lanes 1 and 2). A line that did not silence iaaM (TDP1-B31) contained just a trace of antisense RNA (Fig. 5A, lane 4). Thus, high levels of iaaM-stop antisense RNA correlated with silencing of this oncogene.
Nuclear transgene RNA levels were also highest in iaaM-silencing lines. The real-time RT-PCR procedure was designed to detect both sense and antisense RNAs. Nuclei isolated from iaaM-silencing lines contained more transgene RNA (antisense and/or sense) than non-silencing lines. For example, nuclei from iaaM-silencing line TDP1-B17 contained three to 19 times more transgene RNA than the non-silencing lines (TDP1-B13, -B31, and -B62; data not shown). These results correlated well with the northern blots. Taken together, they indicate that iaaM-silencing lines contained high levels of iaaM-stop antisense RNA, but lines that failed to silence iaaM showed little transcription through the transgene in either direction. All three non-silencing lines examined expressed only traces of iaaM-stop RNA. In contrast, any line that contained a high level of this RNA also silenced the iaaM oncogene. Thus, the iaaM-stop transgene was highly effective at silencing the iaaM oncogene, except in cases where chromosomal position prevented adequate transcription of the transgene. Plants that contained the ipt::iaaM-stop transgene accumulated varying quantities of transgene-encoded sense-strand RNA of the predicted size, 2.8 kb (Fig. 4A), as expected from our observation that most of these lines did not silence the target oncogenes. Two non-silencing lines (CW4-B1 and -B11) accumulated large quantities of transgene RNA that hybridized to an iaaM antisense RNA probe (Fig. 4A, lanes 5 and 6) whereas another (CW4-B22) contained a small amount (Fig. 4A, lane 7). Transgene RNA accumulated to an intermediate level in line CW4-B30 (Fig. 4A, lane 8), which silenced iaaM and severely limited the effect of the ipt oncogene upon infection with A. tumefaciens (Fig. 2D). Hybridization of these RNAs to radiolabeled ipt DNA produced similar results: Line CW4-B30 contained more 2.8-kb transgene RNA than line CW4-B22 (data not shown). Transgene RNA levels in nuclei from these plant lines corresponded to those in RNA preparations from whole cells: Line CW4-B11 contained two to four times more transgene RNA than CW4-B30 or CW4-B22, which had the least transgene RNA (data not shown). In the successful ipt-silencing line (CW1-K27), we did not detect transgene-encoded mRNA in preparations of total cellular or nuclear RNA (Fig. 6, A, lane 1, and C). A line (CW1-K52) that did not silence ipt accumulated a large amount of transgene mRNA of the predicted size: 1 kb (Fig. 6A, lane 2). Thus, high levels of ipt-stop RNA did not trigger silencing of the ipt oncogene. We did not detect long antisense RNAs homologous to ipt in either plant line (Fig. 6A). The absence or presence of transgene mRNA in these lines correlated with their ability or inability to silence the ipt oncogene. The absence of transgene RNA in nuclei from plant line CW1-K27 (Fig. 6C) suggests that transcriptional gene silencing inhibited ipt oncogene expression.
dsRNAs are potent inducers of gene silencing (Angell and Baulcombe, 1997
We developed two mixed-infection assays to evaluate the efficacy of oncogene silencing transgenes. In these assays, Kalanchoe daigremontiana stems or potato tuber discs were infected with a mixture of two bacterial strains: (a) wild-type A. tumefaciens (A348) and (b) disarmed A. tumefaciens (EHA101) containing the oncogene-silencing plasmid (pJP17). Disarmed strains lack oncogenes, but they retain virulence (vir) genes required to move transgenes from a binary plasmid vector (e.g. pJP17) into plants. Mixed infection assays obviated the need to create transgenic plants. This assay involves multiple transformation events, thereby masking chromosomal position effects that can influence the effectiveness of a particular integrated transgene.
K. daigremontiana stems develop pronounced tumors in response to A. tumefaciens. These tumors have distinct morphologies corresponding to overproduction of cytokinin, auxin, or both (Garfinkel et al., 1981
To quantify the degree of iaaM silencing, we co-inoculated potato discs with the same A. tumefaciens mixtures used in the assays on K. daigremontiana. Potato tubers respond to auxin but not to cytokinin (Ream et al., 1983
Sense-strand RNAs that contain premature stop codons elicit gene silencing if they can initiate translation from a start codon downstream of the premature stop (D.C. Baulcombe, personal communication; Que et al., 1997 To examine sequence requirements for silencing iaaM, we deleted 189 bp from the 5' end of iaaM-stop to make an untranslatable construct (pJC14; Fig. 7). K. daigremontiana developed wild-type tumors when co-inoculated with A348 and EHA101 containing this untranslatable iaaM transgene (data not shown), indicating that the region containing translation initiation sequences was necessary for silencing iaaM. Likewise, potato discs co-inoculated with A348 and EHA101(pJC14) developed as many tumor foci as those co-inoculated with A348 and a vector-only control strain [EHA101(pJP21)]. In side-by-side comparisons, the translatable iaaM construct (pJP17) reduced tumor foci 3-fold relative to a vector-only control (P = 0.0005; n = 39), whereas the untranslatable derivative (pJC14) had no significant effect: Tumor foci were 1.3-fold higher than the vector-only control (P = 0.3; n = 38). Although the untranslatable transgene contained 90% of the iaaM sequences present in the successful iaaM-silencing transgene, the truncated construct did not silence iaaM.
We repeatedly observed marked differences in the ability of iaaM and ipt transgenes (with premature stop codons) to elicit destruction of transgene RNAs and silence wild-type oncogenes. These differences occurred even though both transgenes were expressed from the same promoter, flanked by identical 5'- and 3'-UTRs, and located in the same context relative to other T-DNA genes, such as the nopaline synthase promoter-neomycin phosphotransferase (Pnos-nptII) gene fusion. In the genome of transgenic plants, T-DNA location, copy number, and structure varies from one plant line to another, and each of these properties can affect the quantity and direction of transcription (sense, antisense, or both) through a transgene. Nevertheless, the pronounced difference between the performance of the iaaM- and ipt-stop transgenes occurred in a large number of independent lines, which suggests that properties of the specific target sequences, rather than other factors, were primarily responsible for the large difference in success rate.
Translation start sequences in the iaaM-stop transgene may explain its ability to silence the incoming T-DNA oncogene and to trigger destruction of its own RNA. The iaaM-stop transgene contained an in-frame AUG (codon 18) flanked by sequences that promote initiation of translation. A small (189-bp) deletion that removed these sequences abolished the ability of this transgene to silence iaaM. In contrast, the ipt-stop transgene lacked alternative translation start sites. Thus, transgenes encoding untranslatable sense-strand RNAs failed to elicit gene silencing, whereas translatable iaaM-stop constructs were highly effective at silencing iaaM. Similar observations were made for other transgenes. Gene silencing elicited by sense-strand chalcone synthase transgenes is reduced by premature stop codons in the coding sequence (Que et al., 1997 Levels of transgene RNA in oncogene-silencing and non-silencing tobacco support our conclusion that translatable iaaM-stop sense-strand RNA elicited gene silencing very effectively whereas untranslatable ipt-stop (and truncated iaaM-stop) RNA did not. If a sense-strand RNA was a potent elicitor of gene silencing, we expected it to silence the target gene in any transgenic line that strongly expressed this RNA. In addition, we predicted weak (or no) transgene expression in lines that failed to silence the target gene. This is exactly what we observed with the translatable iaaM-stop construct: All non-silencing lines contained very little transgene RNA, but all iaaM-silencing lines contained significant amounts of degraded transgene RNA. Conversely, we reasoned that transgene RNAs unable to trigger gene silencing (such as the untranslatable sense-strand ipt-stop RNA) might be present at high levels in many non-silencing lines. This was the case in the non-silencing ipt-stop line we examined. The sole ipt-silencing line exhibited transcriptional gene silencing, not PTGS. This further supports our conclusion that the untranslatable ipt-stop transgene was unable to trigger PTGS, in contrast to the translatable iaaM-stop transgene, which was highly effective in the majority of transgenic lines.
In this study, we have shown that the iaaM oncogene is susceptible to gene silencing and that the T-DNA-encoded auxin biosynthetic pathway can be blocked by this strategy. Rootstocks are resistant to crown gall when they are engineered to contain transgenes that silence iaaM. We used this approach to create apple rootstocks resistant to crown gall (Viss et al., 2003
Transgene Construction Three transgenes containing premature stop codons were constructed: iaaM-stop, ipt-stop, and ipt::iaaM-stop (Fig. 1). The third codon of each gene was converted to a stop codon by PCR using primers containing the desired mutations. In addition to the nonsense codon, a frameshift mutation and a new restriction site were introduced into each transgene.
A plasmid containing EcoRI fragment 7 (pRK290-pBR325-Eco 7; Garfinkel et al., 1981
The upstream primer used to produce iaaM-stop (shown 5' to 3'; CGGGATCCATGTCATGAACCTCTCCTTGATAAC) contained a BamHI site (GGATCC) upstream of the first iaaM codon (bold italicized ATG). This primer contained a stop codon (bold TGA) in place of the third codon (GCT) of iaaM, thereby creating a BspHI site (TCATGA); it also lacked the first two bases (TC) of the fourth codon. The downstream primer used to amplify iaaM-stop (CGGGATCCTGCGACTCATAGT) included the BamHI site within the iaaM gene (Barker et al., 1983 The upstream primer used to amplify ipt-stop (GAAGATCTGATCATGGACTGAATCTAATTTTCGGTCC) contained BglII (AGATCT) and BclI (TGATCA) sites upstream of the ipt start codon (italicized). In this primer, the first base (C) of the third codon was deleted, and the first base (C) of the fourth codon was changed to A. These mutations created a TGA nonsense codon (bold type), a frameshift mutation, and a HinfI site (GANTC). The downstream primer (GAAGATCTGATCACTAATACATTCCGAACGG) contained the complement of the ipt termination codon (bold CTA) and BclI and BglII sites at the 5' end. PCR with these primers produced a 747-bp amplicon containing the entire ipt-stop coding sequence, which contains 722 bp.
PCR amplicons digested with BamHI (iaaM-stop) or BglII (ipt-stop) were joined to BamHI-digested pUC119 (Yanisch-Perron et al., 1985
Mutant oncogenes were introduced into the BamHI site of plant transformation vector pPEV6 (Lindbo and Dougherty, 1992a
These pPEV6 derivatives, which encode kanamycin resistance, were mobilized from E. coli strain TG1 into Agrobacterium tumefaciens by tri-parental mating with E. coli strain MM294(pRK2013). The A. tumefaciens recipient harbored disarmed Ti plasmid pCIB542, which encodes resistance to spectinomycin and streptomycin (Lindbo and Dougherty, 1992a
To create a transgene designed to produce both sense and antisense RNAs from iaaM and ipt, we fused the iaaM- and ipt-stop transgenes in tandem and situated them between opposing promoters (Fig. 7). First, we constructed a plasmid (pJP8) that contained opposing CaMV and FMV promoters. We amplified the enhanced FMV promoter from pCGN8063 (McBride and Summerfelt, 1990
Upon request, all novel materials described in this publication will be made available in a timely manner for noncommercial research purposes, subject to the requisite permission from any third-party owners of all or parts of the material. Obtaining any permissions will be the responsibility of the requestor.
Leaf discs of haploid tobacco (Nicotiana tabacum cvs Burley 49 and Kentucky 149) were transformed (Horsch et al., 1985
A. tumefaciens strains used to challenge potential oncogene-silencing transgenic plants contained either wild-type pTiA6NC (A348) or derivatives with Tn5 insertions in iaaM (strain 328) or ipt (strain 338) in the A136 genetic background (Garfinkel et al., 1981
A. tumefaciens cultures were grown overnight in yeast extract-peptone broth (Garfinkel et al., 1981
RNA and DNA were extracted from leaves of transgenic tobacco using SDS/phenol followed by LiCl precipitation as described previously (Ream and Field, 1999
Samples containing 5 to 10 µg of total RNA or restriction endonuclease-digested genomic DNA were subjected to agarose gel electrophoresis and were transferred to Gene Screen Plus nylon membranes (New England Nuclear, Boston). Procedures for capillary blotting and hybridization were as described (Ream and Field, 1999
Nuclei were isolated from 25 g of tobacco leaf tissue from plants incubated in the dark 2 d before harvest. Nuclear RNA isolation was carried out as described (Cox and Goldberg, 1988 Real-time RT-PCR was carried out using an Applied Biosystems Prism 7700 Sequence Detector with version 1.7 software and the Quantitect SYBR Green RT-PCR kit (Qiagen USA, Valencia, CA). Three targets were examined: ipt, iaaM, and 5.8S rRNA. PCR primers amplified products of 100, 150, and 165 bp, respectively. The primers for iaaM and ipt amplified a region from the 3' end of each transgene; primers were: iaaM sense strand, GAACCAAGCGGTTGATAACAGCC; iaaM antisense strand, CTGCGACTCATAGTCCAGGAATAC; ipt sense strand, CCATGCGCGCCAACAGGA; and ipt antisense strand, GAAGATCTGATCACTAATACATTCCGAAC. The entire 5.8s rRNA gene from tobacco was amplified using: GACTCTCGGCAACGGATATCTC (5' primer) and ACGCGATGCGTGACGCCC (3' primer). Regular RT-PCR was performed using the Qiagen One-Step RT-PCR kit to test primer efficiency and to produce standards for real-time RT-PCR. A standard curve was constructed for every primer set using RNA transcribed in vitro (Riboprobe kit, Promega). RNA stocks were diluted in 2-fold increments from 10 to 1,280 pg. Template plasmids for in vitro transcription contained full-length iaaM-stop (pHL183) and ipt-stop (pJH3) transgenes in pCR2.1 (Invitrogen, Carlsbad, CA). Plasmids were linearized with SacI before transcription. The 5.8s rRNA template (pJH13) contained an apple 5.8S rRNA gene obtained by RT-PCR and inserted into pCR4-TOPO (Invitrogen). This plasmid was linearized with PstI before in vitro transcription. Standard curves were obtained as outlined in the User Bulletin No. 2 for the ABI Prism 7700 Sequence Detection system. The iaaM and ipt RNA levels were normalized between samples to the 5.8s rRNA level. Real-time RT-PCR products were separated on 2% (w/v) agarose gels to check product size.
We thank Drs. Bill Dougherty, Bill Proebsting, and Stanton B. Gelvin for advice and encouragement, and we thank Dr. David C. Baulcombe for an especially productive discussion in which he suggested that we examine iaaM for alternate translation initiation sites. Received May 6, 2003; returned for revision May 30, 2003; accepted June 6, 2003.
Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.103.026534.
1 This work was supported by the U.S. Department of Agriculture (grant no. 2001–02760) and by the Oregon State University Agricultural Research Foundation. * Corresponding author; e-mail reamw{at}orst.edu; fax 541–737–0496.
Akiyoshi DE, Klee H, Amasino RM, Nester EW, Gordon MP (1984) T-DNA of Agrobacterium tumefaciens encodes an enzyme of cytokinin biosynthesis. Proc Natl Acad Sci USA 81: 5994–5998 Angell SM, Baulcombe DC (1997) Consistent gene silencing in transgenic plants expressing a replicating potato virus X RNA. EMBO J 16: 3675–3684[CrossRef][ISI][Medline] Barker R, Idler K, Thompson D, Kemp J (1983) Nucleotide sequence of the T-DNA region of the Agrobacterium tumefaciens octopine Ti plasmid pTi15955. Plant Mol Biol 2: 335–350[CrossRef][ISI]
Barry GF, Rogers SG, Fraley RT, Brand L (1984) Identification of a cloned cytokinin biosynthetic gene. Proc Natl Acad Sci USA 81: 4776–4780 Bass BL (2000) Double-stranded RNA as a template for gene silencing. Cell 101: 235–238[CrossRef][ISI][Medline]
Baulcombe D (2002) An RNA microcosm. Science 297: 2002–2003
Baulcombe DC (2000) Unwinding RNA silencing. Science 290: 1108–1109 Buchmann I, Marner FJ, Schroder G, Waffenschmidt S, Schroder J (1985) Tumor genes in plants: T-DNA encoded cytokinin biosynthesis. EMBO J 4: 853–859[ISI][Medline]
Chuang CF, Meyerowitz EM (2000) Specific and heritable genetic interference by double-stranded RNA in Arabidopsis thaliana. Proc Natl Acad Sci USA 97: 4985–4990 Cluster PD, O'Dell M, Metzlaff M, Flavell RB (1996) Details of T-DNA structural organization from a transgenic Petunia population exhibiting co-suppression. Plant Mol Biol 32: 1197–1203[CrossRef][ISI][Medline] Cogoni C, Macino G (1999a) Gene silencing in Neurospora crassa requires a protein homologous to RNA-dependent RNA polymerase. Nature 399: 166–169[CrossRef][Medline]
Cogoni C, Macino G (1999b) Posttranscriptional gene silencing in neurospora by a RecQ DNA helicase. Science 286: 2342–2344 Conner JA, Tantikanjana T, Stein JC, Kandasamy MK, Nasrallah JB, Nasrallah ME (1997) Transgene-induced silencing of S-locus genes and related genes in Brassica. Plant J 11: 809–823[CrossRef][ISI] Cox KH, Goldberg RB (1988) Analysis of plant gene expression. In CH Shaw, ed, Plant Molecular Biology: A Practical Approach, Ed 1. IRL Press, Oxford, pp 1–35
Dombek P, Ream W (1997) Functional domains of Agrobacterium tumefaciens single-stranded DNA-binding protein VirE2. J Bacteriol 179: 1165–1173 Dougherty WG, Lindbo JA, Smith HA, Parks TD, Swaney S, Proebsting WM (1994) RNA-mediated virus resistance in transgenic plants: exploitation of a cellular pathway possibly involved in RNA degradation. Mol Plant-Microbe Interact 7: 544–552[Medline] Dougherty WG, Parks TD (1995) Transgenes and gene suppression: telling us something new? Curr Opin Cell Biol 7: 399–405[CrossRef][ISI][Medline] Escobar MA, Civerolo EL, Polito VS, Pinney KA, Dandekar AM (2003) Characterization of oncogene-silenced transgenic plants: implications for Agrobacterium biology and post-transcriptional gene silencing. Mol Plant Pathol 4: 57–65
Escobar MA, Civerolo EL, Summerfelt KR, Dandekar AM (2001) RNAi-mediated oncogene silencing confers resistance to crown gall tumorigenesis. Proc Natl Acad Sci USA 98: 13437–13442 Escobar MA, Leslie CA, McGranahan GH, Dandekar AM (2002) Silencing crown gall disease in walnut (Juglans regia L.). Plant Sci 163: 591–597[CrossRef] Fire A, Xu SQ, Montgomery MK, Kostas SA, Driver SE, Mello CC (1998) Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391: 806–811[CrossRef][Medline] Garfinkel DJ, Simpson RB, Ream LW, White FF, Gordon MP, Nester EW (1981) Genetic analysis of crown gall: fine structure map of the T-DNA by site-directed mutagenesis. Cell 27: 143–153[CrossRef][ISI][Medline]
Hamilton AJ, Baulcombe DC (1999) A species of small antisense RNA in posttranscriptional gene silencing in plants. Science 286: 950–952
Horsch RB, Fry JE, Hoffmann NL, Eichholtz D, Rogers SG (1985) A simple and general method of transferring genes into plants. Science 227: 1229–1231 Inzé D, Follin A, Van Lijsebettens M, Simoens C, Genetello C, Van Montagu M, Schell J (1984) Genetic analysis of the individual T-DNA genes of Agrobacterium tumefaciens: further evidence that two genes are involved in indole-3-acetic acid synthesis. Mol Gen Genet 194: 265–274
Jorgensen RA, Atkinson RG, Forster RLS, Lucas WJ (1998) An RNA-based information superhighway in plants. Science 279: 1486–1487 Kennerdell JR, Carthew RW (1998) Use of dsRNA-mediated genetic interference to demonstrate that frizzled and frizzled 2 act in the wingless pathway. Cell 95: 1017–1026[CrossRef][ISI][Medline]
Kozak M (1989) The scanning model for translation: an update. J Cell Biol 108: 229–241
Kozak M (1991) Structural features in eukaryotic mRNAs that modulate the initiation of translation. J Biol Chem 266: 19867–19870 Lindbo JA, Dougherty WG (1992a) Pathogen-derived resistance to a potyvirus: immune and resistant phenotypes in transgenic tobacco expressing altered forms of a potyvirus coat protein nucleotide sequence. Mol Plant-Microbe Interact 5: 144–153[Medline] Lindbo JA, Dougherty WG (1992b) Untranslatable transcripts of the tobacco etch virus coat protein gene sequence can interfere with tobacco etch virus replication in transgenic plants and protoplasts. Virology 189: 725–733[CrossRef][ISI][Medline]
Llave C, Xie Z, Kasschau KD, Carrington JC (2002) Cleavage of Scarecrow-like mRNA targets directed by a class of Arabidopsis miRNA. Science 297: 2053–2060 Maniatis T, Fritsch EF, Sambrook J (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Marano MR, Baulcombe D (1998) Pathogen-derived resistance targeted against the negative-strand RNA of tobacco mosaic virus: RNA strand-specific gene silencing? Plant J 13: 537–546[Cr |
TOP
ABSTRACT
RESULTS
-DNA digested with HindIII; numbers beside this lane indicated fragment size in base pairs. C, Transgene copy number and structure in ipt-stop (CW1) tobacco lines. Genomic DNA (10 µg lane–1) from lines CW1-K27 (lanes 1 and 4) and CW1-K52 (lanes 2 and 5) was digested with either Hinf1 (lanes 1 and 2) or EcoRI (lanes 4 and 5). Lane 3 contained 100 ng of pUC119-ipt plasmid DNA (equivalent to 5 copies genome–1) digested with Hinf1. Numbers on the left side of the gel indicate the size (in base pairs) and location of 
-D-galactoside, and 4 µM isopropylthio-
-naphthalene acetic acid, 400 mg L–1 timentin, and 200 mg L–1 kanamycin. Kanamycin-resistant shoots were transferred to Murashige and Skoog medium with 400 mg L–1 timentin and 400 mg L–1 kanamycin for rooting, and resulting plantlets were transplanted to soil. The chromosome numbers were doubled as described (Smith et al., 1994