Plant Physiol. Illumina
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online November 6, 2003; 10.1104/pp.103.026039

Plant Physiology 133:1831-1842 (2003)
© 2003 American Society of Plant Biologists

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
133/4/1831    most recent
pp.103.026039v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (22)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Elomaa, P.
Right arrow Articles by Teeri, T. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Elomaa, P.
Right arrow Articles by Teeri, T. H.
Agricola
Right arrow Articles by Elomaa, P.
Right arrow Articles by Teeri, T. H.
GENETICS, GENOMICS, AND MOLECULAR EVOLUTION

Activation of Anthocyanin Biosynthesis in Gerbera hybrida (Asteraceae) Suggests Conserved Protein-Protein and Protein-Promoter Interactions between the Anciently Diverged Monocots and Eudicots1

Paula Elomaa*, Anne Uimari2, Merja Mehto3, Victor A. Albert, Roosa A.E. Laitinen and Teemu H. Teeri

Department of Applied Biology, P.O. Box 27, University of Helsinki, Helsinki FIN-00014, Finland (P.E., A.U., M.M., R.A.E.L., T.H.T.); and Natural History Museums and Botanical Garden, University of Oslo, P.O. Box 1172 Blindern, NO-0318 Oslo, Norway (V.A.A.)


    ABSTRACT
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
We have identified an R2R3-type MYB factor, GMYB10, from Gerbera hybrida (Asteraceae) that shares high sequence homology to and is phylogenetically grouped together with the previously characterized regulators of anthocyanin pigmentation in petunia (Petunia hybrida) and Arabidopsis. GMYB10 is able to induce anthocyanin pigmentation in transgenic tobacco (Nicotiana tabacum), especially in vegetative parts and anthers. In G. hybrida, GMYB10 is involved in activation of anthocyanin biosynthesis in leaves, floral stems, and flowers. In flowers, its expression is restricted to petal epidermal cell layers in correlation with the anthocyanin accumulation pattern. We have shown, using yeast (Saccharomyces cerevisiae) two-hybrid assay, that GMYB10 interacts with the previously isolated bHLH factor GMYC1. Particle bombardment analysis was used to show that GMYB10 is required for activation of a late anthocyanin biosynthetic gene promoter, PGDFR2. cis-Analysis of the target PGDFR2 revealed a sequence element with a key role in activation by GMYB10/GMYC1. This element shares high homology with the anthocyanin regulatory elements characterized in maize (Zea mays) anthocyanin promoters, suggesting that the regulatory mechanisms involved in activation of anthocyanin biosynthesis have been conserved for over 125 million years not only at the level of transcriptional regulators but also at the level of the biosynthetic gene promoters.


Anthocyanins are the most common pigments contributing to coloration in higher plants. Their biosynthesis is one of the best studied branches of secondary pathways, and to date, nearly all of the structural genes of the pathway defined by pigmentation mutants in various species have been isolated (for review, see Mol et al., 1998Go; Winkel-Shirley, 2001Go). In addition to the central pathway, regulatory proteins needed for activation of anthocyanin biosynthesis seem to be structurally conserved during evolution of flowering plants and are often also functionally interchangeable as shown using either transiently or stably transformed plants (Lloyd et al., 1992Go; Quattrocchio et al., 1993Go, 1998Go; Mooney et al., 1995Go; Bradley et al., 1998Go). Still, the mechanistic complexity of the regulation has become evident along with the characterization of the regulators in various plant species and has revealed that our current view of the regulatory network is still far from clear.

In plants, MYB-like transcription factors are encoded by large gene families (with more than 100 members in Arabidopsis). It is known that these genes are involved in diverse roles during plant development, but functions for the majority of these genes have not yet been assigned (Kranz et al., 1998Go; Meissner et al., 1999Go). MYB proteins contain a conserved DNA-binding domain (the MYB domain) with one to three imperfect repeats (R1-R3) that define their binding specificity to the target gene promoters (Martin and Paz-Ares, 1997Go). R2R3-type proteins form the largest class of MYB factors in plants and among them are the factors involved in activation of anthocyanin pigmentation in various plant species. In maize (Zea mays), genes for the whole anthocyanin biosynthetic pathway, starting from C2 (encoding chalcone synthase), are simultaneously activated by MYB and bHLH transcription factors encoded by the C1/Pl and the R/B gene families, respectively (Paz-Ares et al., 1987Go; Ludwig et al., 1989Go; Cone et al., 1993Go). Activation requires representatives of both types of regulators that interact with each other as shown in yeast (Saccharomyces cerevisiae) two-hybrid assays (Goff et al., 1992Go; Grotewold et al., 2000Go). However, direct physical binding to the target gene promoters has been demonstrated only for the C1 protein (Sainz et al., 1997Go; Lesnick and Chandler, 1998Go). Also in maize, another MYB domain factor, encoded by the P locus, regulates production of the related phlobaphene pigments by binding to the dihydroflavonol-4-reductase-encoding gene (DFR or A1 in case of maize) promoter, without the requirement of any known bHLH counterpart (Grotewold et al., 1994Go).

In petunia (Petunia hybrida), flavonoid biosynthesis is regulated in at least two separate molecular units (Quattrocchio et al., 1993Go). A petunia R2R3-type MYB factor, AN2, activates the late anthocyanin pathway genes, beginning with DFR in petal limbs (Quattrocchio et al., 1999Go). In a transient assay, AN2 can interact with either of two distinct bHLH factors, JAF13 or AN1, which both share high sequence homology with the maize R and snapdragon (Antirrhinum majus) DELILA proteins. In addition to anthocyanin biosynthesis, AN1 has been shown recently to act in acidification of the vacuoles in petal cells and morphogenesis of the seed coat epidermis (Spelt et al., 2002Go). It also has been shown that interaction of these proteins is required for the activation of the DFR promoter (Quattrocchio et al., 1998Go; Spelt et al., 2000Go). Stably transformed petunia plants indicate that ectopic expression of AN2 in leaves induces the expression of AN1 mRNA to levels normally found only in floral tissues, whereas AN2 does not have any effect on JAF13 expression. This indicates that AN2 functions upstream of AN1 but not of JAF13. In anthers, AN1 expression depends on AN4, a likely paralog of AN2 (Spelt et al., 2000Go). In addition to MYB and bHLH factors, a cytoplasmic WD40 repeat protein encoded by the AN11 locus is required for anthocyanin accumulation, probably via posttranslational regulation of AN2 (deVetten et al., 1997Go). In summary, anthocyanin accumulation patterning in petunia flowers is determined by tissue-specific expression of R2R3-type MYB genes (AN2 and AN4), whereas AN1 and AN11 are expressed in all pigmented tissues (Quattrocchio et al., 1993Go, 1999Go; Spelt et al., 2000Go).

In Arabidopsis, activation tagging led to identification of a bright-purple mutant (pap1-D) in which overexpression of a MYB factor led to massive accumulation of anthocyanins in the entire plant. The corresponding gene, PAP1, shows high sequence similarity with the petunia AN2 and maize C1 genes (Borevitz et al., 2000Go). Moreover, in Arabidopsis TTG1, a WD40 repeat protein similar to the petunia AN11 is required for activation of the late anthocyanin pathway in leaves and stems (Walker et al., 1999Go). Another MYB factor encoded by TT2 is specifically responsible for activation of late flavonoid metabolism and proanthocyanidin production in seeds and requires the presence of TT8, a bHLH factor (Nesi et al., 2000Go, 2001Go). However, interactions with other transcription factors and binding to target promoters remain to be demonstrated for these proteins.

We previously have investigated genes responsible for floral anthocyanin patterns in Gerbera hybrida, a common ornamental plant that belongs to the large eudicot plant family Asteraceae. We showed that the expression patterns of both a late gene of the flavonoid pathway encoding G. hybrida DFR (GDFR) and the bHLH-type regulatory gene (GMYC1) follow the anthocyanin accumulation patterns at various anatomical levels in different G. hybrida varieties (Helariutta et al., 1995Go; Elomaa et al., 1998Go). In this paper, we report characterization of a R2R3-type MYB domain transcription factor, GMYB10, a putative ortholog of petunia AN2 and Arabidopsis PAP1/PAP2, which is able to induce anthocyanin pigmentation in transgenic tobacco (Nicotiana tabacum). Expression analysis of GMYB10 suggests that it has a role in induction of both vegetative and petal pigmentation in G. hybrida. In a yeast two-hybrid analysis, GMYB10 is able to interact with the previously characterized bHLH domain factor GMYC1 (Elomaa et al., 1998Go). Moreover, deletion analysis of the target GDFR promoter (PGDFR2) using particle bombardment was performed to define the critical regions of the promoter for activation. We identified a sequence domain with high similarity to the anthocyanin regulatory elements (AREs) found in maize anthocyanin promoters and introduced mutations to this element. Transient analysis of the mutated promoter demonstrates a key role for the ARE in activation by GMYB10/GMYC1. Our results suggest that the regulatory mechanisms involved in activation of anthocyanin biosynthesis are conserved between the anciently diverged eudicots and monocots not only at the level of the regulatory proteins but also at the level of the target promoters.


    RESULTS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Isolation of G. hybrida MYB Domain Transcription Factors

We have isolated seven distinct cDNA clones encoding R2R3-type MYB domain factors from G. hybrida. First, we used PCR amplification with degenerate primers designed on the basis of conservation of the DNA-binding domain of the MYB transcription factors in plants. Three different cDNA fragments (GMYB1, GMYB8, and GMYB9a) were amplified from the G. hybrida petal cDNA, and 5'-/3'-RACE PCR was applied to isolate the corresponding full-length cDNAs. Second, high-throughput sequencing of various G. hybrida cDNA libraries revealed four additional expressed sequence tag (EST) sequences encoding R2R3-type MYB factors (G3-17E04, G1-29D05, G1-22G06, and G1-9F04).

As observed in BLAST searches against sequence databases, the three cDNAs obtained from the PCR approach shared high homology with MYB factors known to regulate the early steps of the general phenylpropanoid pathway. However, RNA-blot analysis showed that their expression pattern did not correlate with distribution of anthocyanin pigmentation in various G. hybrida tissues (A. Uimari, unpublished data). From the EST sequencing project, one clone (G3-17E04) was obtained from a cDNA library made of Botrytis cinerea-infected floral mRNA and three (G1-29D05, G1-22G06, and G1-9F04) from a cDNA library covering late stages of petal development. G1-9F04 (renamed GMYB10) shared highest homology with the AN2 gene of petunia (Fig. 1B; Quattrocchio et al., 1993Go, 1999Go). In our previous studies, we have shown that the G. hybrida bHLH factor GMYC1 needs a MYB counterpart to activate the PGDFR2 when bombarded under cauliflower mosaic virus (CaMV) 35S promoter into G. hybrida leaf tissue (Elomaa et al., 1998Go). This was demonstrated using the petunia AN2, but the corresponding G. hybrida gene was not identified. Here, we show that activation was also observed when GMYB10 was bombarded together with GMYC1 (see below), whereas GMYB1, GMYB8, and GMYB9a genes from G. hybrida failed to activate the reporter construct (A. Uimari, unpublished data).



View larger version (35K):
[in this window]
[in a new window]
 
Figure 1. Sequence analysis of the isolated G. hybrida R2R3-type MYB factors. A, Phylogenetic analysis of a selected set of R2R3-type MYB factors from various plant species including seven cDNAs isolated from G. hybrida. Parsimony and parsimony jacknife trees (Farris et al., 1996Go; see also Helariutta et al., 1996Go; Yu et al., 1999Go; Kotilainen et al., 2000Go) were produced of the aligned nucleotide sequences of the R2R3 DNA-binding domains. The grouping of GMYB10 in the single-most parsimonious tree suggests that the gene may function as an anthocyanin regulator. Previously published MYB gene nucleotide sequences were retrieved from the EMBL or GenBank databases (snapdragon MIXTA [X79108], snapdragon PHANTASTICA [AJ005586], Arabidopsis GL1 [M79448], Arabidopsis WEREWOLF [AF126399], Arabidopsis MYB101 [AF411970], Arabidopsis MYB113 [AY008378], Arabidopsis MYB12 [AF062864], Arabidopsis TT2 [AJ299452], Arabidopsis PAP1 [AF325123], Arabidopsis PAP2 [AF325124], petunia AN2 [AF146702], petunia Ph.MYB3 [Z13998], pea [Pisum sativum] MYB26 [Y11105], maize C1 [M37153], maize P [M73029], maize Pl [L19496], and maize ROUGH SHEATH2 [AF143447]). Maize snapdragon MYB305, MYB306, MYB308, MYB315, MYB330, and MYB440 nucleotide sequences were obtained from Prof. Cathie Martin (John Innes Centre, Norwich, UK). B, Amino acid comparison of the R2 and R3 DNA-binding regions of GMYB10 with Arabidopsis PAP1, PAP2, and TT2, petunia AN2, and maize C1 and Pl show high sequence conservation (full sequence identity marked in gray). The amino acid residues shown to be required for interaction of the maize C1 with a bHLH cofactor R (L77, R80, R83, and L84) are marked with arrows.

 


Phylogeny of the G. hybrida R2R3-Type MYB Factors

We performed phylogenetic analysis for a selected set of R2R3-type MYB regulators from various plant species to explore the evolutionary relationships of the G. hybrida genes and ESTs. Nucleotide sequences encoding the conserved R2R3 domains were aligned, and parsimony and parsimony jackknife trees (Farris et al., 1996Go) were produced (Fig. 1A). Arabidopsis AtMYB101 was selected as an outgroup among "typical" R2R3 MYB factors after Dias et al. (2003Go, their Fig. 1A). The phylogenetic positions of GMYB1, GMYB9a, and G1-29D05 showed no supported resolution with respect to several other MYB genes; therefore, explicit predictions for their functions cannot be provided. Nonetheless, the single-most parsimonious tree suggests that GMYB1 could be a ZmP relative, GMYB9a may be an ortholog of snapdragon MYB306, and G1-29D05 may be an ortholog of AtTT2. The four remaining G. hybrida sequences, however, group strongly with the functionally characterized MYB factors. G3-17E04 groups together with snapdragon PHANTASTICA and maize ROUGH SHEATH2, which are functional orthologs involved in specification of lateral organ identity in proximo-distal axis, in maintenance of meristem activity, and specifically in snapdragon, in determination of dorsoventral symmetry in leaves, bracts, and petal lobes (Waites et al., 1998Go; Timmermans et al., 1999Go; Tsiantis et al., 1999Go). GMYB8 and G1-22G06 group together in a clade with snapdragon MYB305 and MYB340 and pea MYB26, which all share similar DNA-binding properties and are involved in regulation of the general phenylpropanoid pathway (Moyano et al., 1996Go; Uimari and Strommer, 1997Go). The strongly supported phylogenetic position of GMYB10 with the previously characterized flavonoid MYBs (petunia AN2 and Arabidopsis PAP1 and PAP2) suggests that it may have a similar function in regulating anthocyanin biosynthesis.


Sequence Properties of GMYB10

Comparison of the amino acid sequence of GMYB10 with the petunia AN2, Arabidopsis PAP1, PAP2, and TT2, and maize C1 and Pl shows high sequence similarity especially in the DNA-binding domains (R2 and R3 regions) of these proteins (Fig. 1B). The C-terminal region of GMYB10 shows very limited sequence identity outside the R2R3 domain except for the presence of a motif highly similar to KPRPR(S/T)F (data not shown), which was previously reported for the subgroup of R2R3 MYBs comprising AN2, AtMYB75 (PAP1), AtMYB90 (PAP2), and AtMYB113 (Stracke et al., 2001Go). Grotewold et al. (2000)Go identified the key amino acid residues of maize C1 that are required for the interaction with the bHLH cofactor R. Modeling of the structure of the C1 MYB domains indicate that these amino acids (L77, R80, R83, and L84 located in the R3 repeat) are solvent exposed and, thus, provide a surface for interaction with R (Grotewold et al., 2000Go). As shown in Figure 1B, these residues are highly conserved in the presented dicot regulators, indicating that their function may involve interaction with other cellular factors.


Expression Pattern of GMYB10 Supports Its Involvement in Regulation of Anthocyanin Pigmentation

Expression analysis of GMYB10 provides further support for its role in activation of anthocyanin biosynthesis. RNA-blot analysis of the var. Regina using a 233-bp fragment from the 3' end of the GMYB10 cDNA as a probe indicates that expression of GMYB10 is detected in leaf blade, floral scape, petals, and petioles (Fig. 2A). In a DNA gel blot included in the hybridization, the 233-bp probe recognized one band in the var. Regina DNA digested with EcoRI or BamHI and two bands with HindIII at the washing stringency used for the RNA blot (data not shown). This suggests that the RNA blot presented in Figure 2A most probably represents the expression pattern of a single locus and that the two bands found in the HindIII digestion were due to restriction length polymorphism in the heterozygous cultivar as previously found for many other G. hybrida genes (e.g. Kotilainen et al., 1999Go, 2000Go).



View larger version (77K):
[in this window]
[in a new window]
 
Figure 2. Expression analysis of GMYB10. A, RNA-blot analysis using a 233-bp 3' fragment of the GMYB10 cDNA as a probe. Expression of GMYB10 is detected in leaf blade, petals, petioles, and flower scape; in tissues that are typically anthocyanin pigmented in the var. Regina. The lower panel shows ethidium bromide-stained ribosomal RNA bands for controlling the loading of the RNA gel. B, In situ analysis of petal cross section at stage 5 indicates that GMYB10 expression is located in epidermal cells. At this stage, accumulation of anthocyanin pigments is more prominent in adaxial side of the petal that is indicated by arrows. C, Sense RNA probe for GMYB10 as a control shows no signal.

 

In Regina, petals are bright red and scapes, petioles, and leaves also contain anthocyanins, especially under stress conditions. Under long exposure, a faint signal was detected in carpels that are also lightly anthocyanin pigmented in Regina and in bracts that may contain anthocyanins (data not shown). During petal development, the expression of GMYB10 starts at stage 3 when no pigmentation is observed and, thus, precedes late biosynthetic gene expression. The expression level is highest at stage 7, when the petals are already fully pigmented (data not shown). The expression of late biosynthetic genes, e.g. for GDFR, peak at this stage also (Helariutta et al., 1993Go). In situ analysis of petal cross sections localizes GMYB10 expression to the epidermal cells (Fig. 2, B and C), which is in correlation with the anthocyanin accumulation pattern.

RNA-blot analysis using the gene-specific probe of the differentially pigmented G. hybrida varieties Nero and Parade (for description, see Helariutta et al., 1995Go) reveal similar expression patterns at the flower organ level. As in var. Regina, GMYB10 expression is detected in petals that do not contain anthocyanins in var. Nero. Furthermore, no expression is seen in pappus bristles (sepals) of Nero or in stamens of Parade, although these organs are strongly anthocyanin pigmented in these varieties (data not shown). This suggests that, in flowers, GMYB10 is required for activation of petal pigmentation but does not alone define the final phenotype. In pappi and stamens instead, additional factors than GMYB10 appear to be involved in determination of the pigmentation phenotype.


Overexpression of GMYB10 in Transgenic Tobacco and G. hybrida

For functional analysis, we transformed GMYB10 under the control of the CaMV 35S promoter into tobacco (SR1). Four of 10 transgenic tobacco lines overexpressing GMYB10 accumulated high levels of anthocyanins in leaves and stems, which became evident after moving the plantlets into the greenhouse under high-light intensity (Fig. 3A). In flowers, pigmentation of sepals, anthers, and ovary walls was highly increased. No clear changes in petal pigmentation were observed (Fig. 3, B and C). To be able to compare the pigmentation phenotypes, the maize Lc, encoding a bHLH factor, was also transformed into tobacco. In these plants, high levels of anthocyanins accumulated in both petals and anther filaments, giving an opposite phenotype compared with the flowers overexpressing GMYB10 (Fig. 3C). No changes in vegetative pigmentation were detected in Lc transgenic plants. Analysis of these transgenic plants confirms the role of GMYB10 in anthocyanin pigmentation and demonstrates its ability to induce pigmentation in distant plant species.



View larger version (45K):
[in this window]
[in a new window]
 
Figure 3. Expression of GMYB10 in transgenic tobacco under CaMV 35S promotor. A, Strong enhancement of anthocyanin pigmentation is detected in leaves and stems of the transgenic line (left) compared with the untransformed control plant (right). B, Transgenic tobacco lines accumulate high levels of anthocyanins in sepals (left), but no changes in petal pigmentation are detected. Right, Untransformed control. C, Anthers and ovary walls of the GMYB10 overexpressing line (left) accumulate anthocyanins. In comparison, transgenic lines overexpressing the maize Lc encoding a bHLH factor show an opposite pattern with pigmented filaments and petal lobes (right). Center, Untransformed control.

 

Transformation of GMYB10 under the CaMV 35S promoter into G. hybrida resulted in formation of strongly anthocyanin pigmented calli in pieces of petioles that were cocultivated with Agrobacterium tumefaciens and grown under kanamycin selection (Fig. 4A). Using the construct with GMYB10 in antisense orientation, the resulting calli were green in color, and no signs of anthocyanin pigmentation were detected (Fig. 4B). The first antisense shoots have been recovered recently, but so far, we have not been able to regenerate shoots from the red calli overexpressing GMYB10.



View larger version (75K):
[in this window]
[in a new window]
 
Figure 4. Transformation of GMYB10 into G. hybrida under CaMV 35S promoter in sense and antisense orientation. On kanamycin selection, transgenic calli are formed at the ends of the petioles cocultivated with A. tumefaciens. A, Callus expressing GMYB10 in sense orientation strongly accumulates anthocyanins. B, Callus arising from the petioles cocultivated with the antisense construct shows no signs of anthocyanin accumulation.

 


GMYC1 and GMYB10 Interact with Each Other in Yeast Two-Hybrid Assay

The full-length coding regions of petunia AN2, GMYB10, and GMYC1 were cloned into yeast two-hybrid vectors to study whether these proteins can interact with each other. Using the CLONTECH MATCHMAKER GAL4-based system (CLONTECH Laboratories, Palo Alto, CA), we discovered that either GMYB10 or AN2, when expressed in the binding domain plasmid, alone activated the transcription of the LACZ reporter gene (data not shown). This indicates that both MYB proteins contain intrinsic transcriptional activation properties as has been shown previously for these types of proteins (Paz-Ares et al., 1987Go). In the GAL4 system that is based on constitutive expression of the fusion proteins, we could not see activation of LACZ gene expression in transformants containing the MYB domain proteins (either GMYB10 or AN2) fused with the activation domain and with GMYC1 fused with the DNA-binding domain (data not shown). This may be due to harmful constitutive expression of the MYB domain proteins and consequent selection of poorly expressing lines in yeast. Therefore, we used the MATCHMAKER LexA system (CLONTECH), in which the expression of the MYB/AD domain plasmids can be controlled by induction. Figure 5 shows the quantitative results of the Y2H analysis. Interactions of GMYB10/AD, AN2/AD, and GMYC1/BD with the corresponding empty plasmids gave no activation of LACZ reporter above the negative control (measured as {beta}-galactosidase activity). However, both GMYB10 and AN2, expressed as activation domain fusions, gave strong activity in combination with GMYC1 expressed in the binding domain plasmid, indicating a positive interaction between the MYB domain proteins and GMYC1. We have shown previously that the G. hybrida PGDFR2 is activated by GMYC1 and an MYB counterpart (petunia AN2) in particle bombardment assays (Elomaa et al., 1998Go). Combinations of GMYC1 together with petunia AN2 and GMYB10 from G. hybrida were further used to analyze of the critical cis-elements of the target PGDFR2.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 5. Interaction between GMYB10, AN2, and GMYC1 proteins in yeast two-hybrid assay (MATCHMAKER LexA system). We observed interaction between both GMYB10 and AN2 as activation domain (AD) fusion in combination with GMYC1 in binding domain (BD) fusion as measured in {beta}-galactoside activity. For control, we included each plasmid in combination with the corresponding empty plasmids (pLexA and pB42). We have omitted the positive control from the picture since it exceeds the scale.

 


Deletion Analysis of PGDFR2 Using Particle Bombardment

We have previously isolated a 1,195-bp promoter fragment, PGDFR2, and have showed, using stably transformed plants, that it is functional and contains all essential elements needed for correct spatial and temporal regulation of GDFR activity in G. hybrida var. Regina (Elomaa et al., 1998Go). In this study, we performed an analysis of the critical cis-elements of the PGDFR2 by generating serial deletion constructs starting from the 5' end using either restriction enzymes or exonuclease treatment (Fig. 6A). Reporter constructs were made by fusing the full-length promoter (1,195 bp) and each deletion version of the PGDFR2 with the firefly luciferase (LUC) gene. Because GDFR is expressed only in the epidermal cell layer of petal (Helariutta et al., 1993Go), we used the full-length PGDFR2 (1,195 bp) fused with the RUC (Renilla luciferase) as an internal control to be able to optimize the bombardment conditions so as to target primarily the epidermal cells and to get the control signal from the same cells that express the reporter constructs.



View larger version (35K):
[in this window]
[in a new window]
 
Figure 6. A, Schematic representation of the PGDFR2 sequence. The deletion end points are marked with arrows. Sequence of the 276-bp fragment of the promoter is shown below the graph, and the location of the putative ARE (as defined by Lesnick and Chandler, 1998Go) is in bold and underlined. B, Results of the deletion analysis performed by particle bombardment. Each deletion construct was bombarded into petal tissue as such as well into leaf tissue together with the regulatory genes (GMYC1 + petunia AN2 or GMYC1 + GMYB10). The results indicate that 276 bp of the promoter still confers almost to the same level of activation as the full length promoter. The critical regions needed for activation lie within 200 bp of the translation start.

 

Each reporter construct was bombarded into petal tissue, and luciferase activities were measured after 24 h. The activity (LUC/RUC value) of each deletion construct was reported as a fraction (percentage) of the activity given by the full-length promoter. Similarly, each construct was bombarded into leaves but in combinations with known regulators: either GMYC1 + AN2 or GMYC1 + GMYB10, which were each co-expressed under the CaMV 35S promoter. As PGDFR2 is not active in leaf tissue; instead of it, we used the CaMV 35S-RUC as an internal control to normalize the individual bombardments. We did not observe activation of the reporter construct when the regulators were bombarded alone (data not shown).

The results of the bombardments are summarized in Figure 6B. Both experimental sets (petal and leaf bombardments) show that relatively large deletions from the 5' end of the promoter can be made without losing the reporter gene activity. Even a 276-bp fragment (from the translation start) of PGDFR2 confers similar levels of reporter gene activity as the full-length promoter, and a 200-bp fragment still gives about 80% of the full-length activity in petal tissue and 25% to 40% in leaves. Larger deletions clearly abolish the reporter gene activities in both tissues. Based on bombardment experiments, we conclude that the critical region that responds to the MYB/MYC-mediated activation lies within the first 200 bp of the promoter.


A Putative ARE in PGDFR2

When we compared the sequence of the -200 to -83 region of the PGDFR2 with the sequences of the previously studied monocot promoters (A2, A1, and Bz1 of maize), we identified a region with very high sequence similarity to the putative ARE described from maize (Tuerck and Fromm, 1994Go; Lesnick and Chandler, 1998Go). Figure 7A shows a comparison of both previously defined consensus sequences in maize to the corresponding area found in PGDFR2. The comparison indicates that 13 of 16 nucleotides in this region are identical in PGDFR2. In G. hybrida, the location of the region is underlined in Figure 6A. Within the region, we identified a sequence that resembles the MYB-binding consensus site (C/TAACG/TG), although it has been shown that C1 of maize can bind to a variety of sequences (Sainz et al., 1997Go; Lesnick and Chandler, 1998Go). Furthermore, a site resembling a bHLH-binding site (CANNTG) lies after this region; however, it is in the complementary strand (PGDFR2 "reverse" in Fig. 6A). High sequence similarity with the previously characterized maize anthocyanin regulatory regions suggests that a similar region may be needed for activation of anthocyanin biosynthetic genes in dicots also.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 7. A, Sequence comparison of the putative ARE found from GDFR2 promoter with the previously characterized Tuerck and Fromm (1994Go) consensus sequence and the ARE by Lesnick and Chandler (1998Go) indicate high sequence similarity. We introduced specific mutations (mb1, mb2, mc1, mc2, and md1) to the putative ARE of GDFR2 promoter to study the role of this region in anthocyanin regulation. B, Mutated full-length PGDFR2 constructs were bombarded into petals together with an internal control, PGDFR2-RUC. Mutations in the site resembling an MYB-binding site (AGTT), mb1 and mb2, and in a site adjacent to it, mc1 and mc2, reduced reporter gene activation to approximately 20% to 40% of the activity of the non-mutated full length promoter. Mutation of resembling the bHLH binding site (CANNTG in reverse chain), md1, did not affect the reporter gene activation.

 


Specific Mutations to the Putative ARE

The importance of the putative ARE was tested by mutating this region in the full-length version of PGDFR2. With help of PCR, we changed three different regions within the consensus sequence as shown in Figure 7A. Each construct was bombarded into Regina petal tissue with the non-mutated full-length PGDFR2-RUC as an internal control. Bombardment into petals indicated that mutations at the site resembling an MYB-binding site (mb1 and mb2) and at the regions proximal to it (mc1 and mc2) reduced reporter gene activities to approximately 20% to 40% of the full-length promoter. The same decrease is seen in a construct where both sites are mutated. However, mutation in the putative bHLH motif (md) did not significantly affect reporter gene activity (Fig. 7B).


    DISCUSSION
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

GMYB10 Encodes an R2R3 MYB Domain Protein Involved in Anthocyanin Biosynthesis

High sequence conservation of GMYB10 with petunia AN2, Arabidopsis PAP1 and PAP2, and maize C1 together with its phylogenetic position among the set of R2R3-type MYB factors suggests that GMYB10 may have a role in regulating anthocyanin pigmentation in G. hybrida. In the phylogenetic tree constructed in this study, the monocot factors C1 and Pl are clustered into a different clade, whereas the (putative) dicot anthocyanin regulators (GMYB10, AN2, PAP1, PAP2, and Atmyb113) are well supported to be members of the another lineage. Our observation is in concordance with the recent results reported by Dias et al. (2003Go, their Fig. 1B) that suggest C1 and AN2 (or C1 and GMYB10) to be paralogs that have retained similar function.

The functional role of GMYB10 in anthocyanin regulation is further supported by its expression, which is restricted to organs that may become anthocyanin pigmented such as leaves, petals, scapes, and petioles. Furthermore, in G. hybrida petals, expression is localized to epidermal cells in correlation with the anthocyanin accumulation pattern. Moreover, transgenic tobacco plants overexpressing GMYB10 under control of the CaMV 35S promoter showed strongly enhanced leaf and sepal pigmentation. The phenotypes resemble transgenic tobacco cv xanthi expressing either Arabidopsis PAP1 or PAP2 (Borevitz et al., 2000Go), with the exception that GMYB10 did not activate petal pigmentation in cv SR1. This may reflect a genetic difference between the two cultivars of tobacco or the inability of GMYB10 to interact with other regulatory factors needed to activate biosynthesis. Still another possibility for the lack of tobacco petal pigmentation is the use of the CaMV 35S promoter. Benfey and Chua (1990Go) reported that the 35S promoter is not highly active in all cells of tobacco, and especially in petals, the promoter confers expression principally in vascular tissue and in trichomes and only weakly in epidermal tissue. However, further studies are required to distinguish between these possibilities.

The maize C1 cDNA did not enhance anthocyanin pigmentation in any tissue when transformed into tobacco cv xanthi (Lloyd et al., 1992Go). Neither did the bHLH-type transcription factors DELILA from snapdragon or Lc from maize induce leaf pigmentation in tobacco, although they increased flower pigmentation by activation of DFR expression in petals (Mooney et al., 1995Go). Together with this study, these observations suggest that the absence of an endogenous MYB factor in tobacco leaves and sepals limits pigment production and that maize C1 is probably too distantly related to be able to activate the tobacco promoters. It is also possible that GMYB10 may be able to activate the early genes of the biosynthetic pathway in tobacco because chalcone synthase expression was not detected in tobacco leaves (Mooney et al., 1995Go).

In G. hybrida, overexpression of GMYB10 alone activated anthocyanin biosynthesis in callus. However, strong accumulation of anthocyanins may interfere with the regeneration step as also previously detected in petunia (Quattrocchio et al., 1993Go); so far, we have not been able to produce pigmented transgenic shoots. Still, the formation of purple calli in transgenic G. hybrida provides further evidence for the functional role of GMYB10 in regulation of anthocyanin pigmentation.


The Role of GMYB10 in Regulation of G. hybrida Anthocyanin Pigmentation

In G. hybrida, GMYB10 is expressed in vegetative tissues (in the leaf blade, petioles, and flower scapes) that under normal greenhouse conditions are only lightly pigmented in var. Regina. However, typically under stress or under high light, they become purple. In our previous studies, we have produced transgenic G. hybrida overexpressing the snapdragon DELILA cDNA encoding a bHLH transcriptional activator (Goodrich et al., 1992Go). These plants showed highly enhanced vegetative pigmentation in leaves, petioles, and flower scapes (Elomaa and Teeri, 2001Go). This indicates that activation of pigmentation in these organs is dependent of the presence of both MYB and bHLH domain transcription factors and that the lack of vegetative pigmentation in G. hybrida, in contrast to tobacco, is probably due to absence of the bHLH counterpart. This is further supported by our observation that in the particle bombardment assay, GMYB10 alone cannot induce the PGDFR2-LUC reporter in leaves but requires the presence of a bHLH factor (GMYC1). The yeast two-hybrid analysis showed that GMYB10 and GMYC1 are able to interact with each other. However, we still postulate that in vivo, GMYC1 is probably not the correct partner for GMYB10 in leaves because it is not expressed there, and, further, transgenic plants overexpressing GMYC1 did not show increased vegetative pigmentation (P. Elomaa, unpublished data). Instead, we hypothesize that in leaves, there is a different bHLH counterpart (possibly induced under high light/stress) for GMYB10.

In flowers, GMYB10 expression was invariably detected in petals in differentially pigmented G. hybrida varieties (data not shown). However, our previous studies show that the expression of GMYC1 correlates with the spatial distribution of anthocyanin pigmentation and GDFR expression in these varieties (Elomaa et al., 1998Go). For example, in the var. Nero, the absence of anthocyanin pigments correlates to the highly reduced levels of GMYC1 expression. In light of this knowledge, we believe that activation of G. hybrida petal pigmentation requires the presence of both GMYB10 and GMYC1 and that GMYC1 in particular is the key factor in defining pigmentation patterns (e.g. in varieties with differentially pigmented petals of various flower types or with spatial patterns within the petals). In different varieties, pappus (sepal) and stamen pigmentation may also vary. In these organs, irrespective of their pigmentation phenotype, we did not detect expression of GMYB10, and the expression of GMYC1 was also faint and invariant (Elomaa et al., 1998Go). Therefore, we conclude that pappus and stamen pigmentation in G. hybrida is mediated by as-yet unidentified factors.


Analysis of the PGDFR2 Indicates a High Level of Conservation of Regulatory Mechanisms at the Promoter Level

Having isolated two putative anthocyanin regulators, GMYC1 and GMYB10, acting on the late biosynthetic gene GDFR in G. hybrida, we wanted to define the critical cis-acting regions of the corresponding promoter that would be responsible for transcriptional regulation. Deletion analysis indicated that a relatively small region of the promoter is required for activation by GMYC1 and GMYB10, as has also been observed in maize anthocyanin promoters (Tuerck and Fromm, 1994Go; Bodeau and Walbot, 1996Go; Lesnick and Chandler, 1998Go). A 276-bp region of the promoter (counted from the translation start) gave almost similar levels of activation as the full-length promoter (1,195 bp) both in petals and leaves. Within the 200-bp region of the promoter, we found a highly conserved region that has been shown to be important in regulation of the maize anthocyanin biosynthetic genes. The putative ARE is similar to the maize ARE as defined by Lesnick and Chandler (1998Go) in 13 of 16 nucleotides and contains a site resembling an MYB-binding (C/TAACG/TG) site and a region resembling a bHLH-binding site (CANNTG). Specific mutations in the putative MYB-binding site and in a site just adjacent to it reduced the reporter gene activation in petals to 20% to 40% when compared with the non-mutated full-length promoter. However, mutation in the putative bHLH-binding site did not have any effect. These results clearly suggest that the ARE is needed for full activation of the late anthocyanin genes in eudicots and monocots, indicating high conservation of the regulatory mechanisms involved in anthocyanin biosynthesis not only at the level of regulators but also at promoter level and over vast evolutionary time (over 125 million years; Hughes, 1994Go; Sanderson and Doyle, 2001Go).

Still, as observed earlier in maize, our results with transient analyses suggest that the ARE is probably not the only region conferring DFR activation. First, the activation is not completely abolished by the introduced mutations, and second, if we cobombard the mutated versions of the 276-bp promoter into leaf together with the constitutively expressed regulators, we observe full activity of the reporter constructs (data not shown). This indicates that the introduced mutations are not severe enough to abolish binding of the regulators produced in excess, and it is also possible that there are additional sites within the 276 bp that are responding to the regulators. The latter conclusion is also supported by the fact that we observe only very weak activation (hardly above background) of the reporter construct if we place the 16-bp ARE region four times in front of the 35S minimal promoter and bombard it into leaves together with the regulators (M. Mehto, unpublished data). Further experiments are still needed to identify the other regulatory regions. However, recent in vivo studies on maize mutant lines with transposon insertions in the A1 ARE emphasize the importance of ARE in regulation of anthocyanin biosynthetic genes. These insertions cause striking effects on pigmentation, which is in contrast to previous transient experiments and in vitro-binding experiments in which no single cis-element completely abolished A1 activity when mutated (Pooma et al., 2002Go). The authors postulate that ARE may be recognized by other cellular factors or, alternatively, it may participate in maintaining a particular chromatin structure required for expressional activation (Pooma et al., 2002Go).


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Plant Material

Gerbera hybrida (Asteraceae) var. Terra Regina, var. Terra Nero, and var. Terra Parade used in this research were obtained from Terra Nigra B.V. (De Kwakel, The Netherlands) and grown under standard greenhouse conditions. Developmental stages of the inflorescence are described by Helariutta et al. (1993Go) and anthocyanin accumulation patterns of different varieties are in Helariutta et al. (1995Go).


Isolation of G. hybrida MYB Factors

We used degenerate primers to amplify MYB domain transcription factors from G. hybrida petal cDNA as reported by Uimari and Strommer (1997Go). For PCR, total RNA was isolated using Trizol reagent (Life Technologies/Gibco-BRL, Cleveland) and mRNA using the PolyATract kit (Promega, Madison, WI). Three different cDNA fragments (GMYB1, GMYB8, and GMYB9a) were obtained and amplified as full length using the 5'-/3'-RACE kit of Roche (Mannheim, Germany). Four R2R3 MYB domain cDNAs were obtained by EST sequencing the G. hybrida cDNA libraries (M. Kotilainen and S. Koskela, unpublished data). The cDNAs were chosen for further analysis based on BLAST search on sequence databases. Accession numbers for the seven isolated MYB factors are as follows: AJ554697 (GMYB1), AJ554698 (GMYB8), AJ554699 (GMYB9a), AJ554700 (GMYB10), AJ554701 (G1-29D05), AJ554702 (G1-22G06), and AJ554703 (G3-17E04).


RNA-Blot and in Situ Analysis

For RNA-blot analysis, total RNA was isolated using Trizol reagent (Life Technologies/Gibco-BRL) from various plant tissues according to the manufacturer's instructions. Ten micrograms of total RNA was loaded on each lane, and the ethidium bromide-stained ribosomal bands were used as standards for equal loading. RNA blots were hybridized using 32P-labeled probes according to standard protocols (Sambrook et al., 1989Go). For a gene-specific probe, a 233-bp fragment from the 3' end of cDNA was used (digested with BstX1 and KpnI from the plasmid pGMYB10). The gene-specific blots were washed using 0.5x SSC (75 mM NaCl and 7.5 mM Na3citrate, pH 7.0) and 0.1% (w/v) SDS at 58°C.

For in situ probes, the full-length GMYB10 cDNA was cloned into pBlue-script II SK or KS+ (Stratagene, La Jolla, CA) in sense and antisense orientations under T7 promoter. Sense and antisense RNA probes were synthesized using T7 polymerase and labeled using the DIG RNA Labeling Kit (Roche) according to the manufacturer's instructions. The probe was hydrolyzed chemically in alkaline carbonate buffer to reduce the size, and an additional ethanol precipitation step was included. Petal samples were collected from stage 5 (Helariutta et al., 1993Go), fixed in 50% [v/v] ethanol, 5% [v/v] acetic acid, and 3.7% [v/v] formaldehyde, dehydrated using ethanol series, cleared in xylene or Histochoice (Amresco, Solon, Ohio), and finally embedded in Tissue-tek embedding wax (Sakura, Zoeterwoute, The Netherlands). Seven- to 10-µm cross sections of the petals were cut using a microtome and placed on Superfrost plus slides (N: Menzel-Gläser, Braunschweig, Germany). Nonradioactive hybridizations were done essentially as in Di Laurenzio et al. (1996Go) except that Proteinase K concentration was 10 mg L-1. After detection of the signal, sections were mounted in 50% (v/v) glycerol.


Plant Transformation

Full-length GMYB10 was cloned under the CaMV 35S promoter in a plasmid pHTT602 (Elomaa and Teeri, 2001Go) and conjugated into Agrobacterium tumefaciens strain C58C1 (van Larebeke et al., 1974Go) harboring pGV2260 (Deblaere et al., 1985Go) using triparental mating (van Haute et al., 1983Go). Tobacco (Nicotiana tabacum) SR1 leaf explants were transformed as described by Horsch et al. (1985Go) except that we did not use any feeder cells. The tobacco plantlets were rooted in the presence of 100 mg L-1 kanamycin, and the integration of the transgene was verified using PCR. G. hybrida transformation was done as reported by Elomaa and Teeri (2001Go).


Yeast (Saccharomyces cerevisiae) Two-Hybrid Analysis

Yeast two-hybrid analysis was performed using the MATCHMAKER LexA two-hybrid system (CLONTECH) as described by Kotilainen et al. (2000Go). The full coding sequences of GMYC1, GMYB10, and petunia (Petunia hybrida) AN2 were amplified by PCR and cloned into the yeast vectors. {beta}-Galactosidase activity was measured using o-nitrophenyl {beta}-D-galactopyranoside as substrate for seven to eight individual transformants for each interaction combination according to the manufacturer's protocol.


Construction of Serial Deletions and Mutated Versions of the PGDFR2

The deletion constructs of the PGDFR2 were done either by PCR, restriction enzyme digestions, or exonuclease treatment using standard protocols and cloned in front of the firefly LUC gene encoding luciferase (Ow et al., 1986Go). In front of the LUC gene, the tobacco mosaic virus leader {Omega} was used as a translational enhancer (Gallie et al., 1987Go). All constructs were verified by sequencing. D-485 was amplified from the full-length PGDFR2 using primers 5'GAAGGTACCACATGTATGTATACTCAG3' and 5'GTCCTGCAGGTTTTATTTGGTGGGTATTA3'. D-349 was done by deleting a KpnI + BstXI fragment of the full-length PGDFR2-LUC construct. D-276, D-200, and D-83 were obtained by exonuclease treatment of D-349 plasmid, and the deletion endpoints were verified by sequencing. D-169 was amplified using primers 5'CAGACAAGCTTCACCCGATTCCCTCTTC 3' and 5'GTCCTGCAGGTTTTATTTGGTGGGTATTA3'. Specific mutations were introduced to the putative ARE by PCR. The mutations were designed into a primer containing the PmaCI site, and another primer contained the BstXI site. This fragment was replaced in the full-length PGDFR2 by the amplified mutated fragment and verified by sequencing. The mutations were further introduced to the D-276 versions by replacing a XcaI + ClaI fragment of the constructs.


Transient Expression Analysis

For particle bombardment, Bio-Rad PDS-1000/He equipment (Bio-Rad Laboratories, Hercules, CA) was used. The conditions for gold particle preparation and bombardment were as previously reported (Elomaa et al., 1998Go). The plant material for petal bombardments was taken from flowering plants (var. Regina) from standard greenhouse conditions. For petal bombardments, the developmental stage 7 was used (Helariutta et al., 1993Go). Leaf material was obtained from in vitro plantlets. At minimum, five petals or leaves were bombarded with each construct. Firefly luciferase and Renilla luciferase activities were measured with the Promega Dual Luciferase kit with modifications reported earlier (Elomaa et al., 1998Go). LUC/RUC values were calculated to normalize the bombardment conditions.


    ACKNOWLEDGMENTS
 
We thank Dr. Francesca Quattrocchio for the petunia AN2 plasmid and Prof. Susan Wessler for the maize Lc cDNA. Prof. Cathie Martin is thanked for providing sequence data for the phylogenetic analysis. We also thank Dr. James S. Farris for permission to use the XAC parsimony jackknifing application. Eija Takala and Anu Rokkanen are thanked for their excellent technical assistance throughout the project and Sanna Peltola for taking care of the plants in the greenhouse. V.A.A. acknowledges support from US National Science Foundation grant DBI-0115684.

Received April 26, 2003; returned for revision May 20, 2003; accepted September 7, 2003.


    FOOTNOTES
 
1 This work was supported by the Academy of Finland (project no. 41397 to P.E.). Back

2 Present address: A.I. Virtanen Institute, University of Kuopio, P.O. Box 1627, 70211 Kuopio, Finland. Back

3 Present address: Thermolabsystems, Ratastie 2, 01620 Vantaa, Finland. Back

Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.103.026039.

* Corresponding author; e-mail Paula.Elomaa{at}Helsinki.Fi; fax 358-9-19158727.


    LITERATURE CITED
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Benfey PN, Chua N-H (1990) The cauliflower mosaic virus 35S promoter: combinatorial regulation of transcription in plants. Science 250: 959-966[Abstract/Free Full Text]

Bodeau JP, Walbot V (1996) Structure and regulation of the maize Bronze2 promoter. Plant Mol Biol 32: 599-609[CrossRef][Web of Science][Medline]

Borevitz JO, Xia Y, Blount J, Dixon RA, Lamb C (2000) Activation tagging identifies a conserved MYB regulator of phenylpropanoid biosynthesis. Plant Cell 12: 2383-2393[Abstract/Free Full Text]

Bradley JM, Davies KM, Delores SC, Bloor SJ, Lewis DH (1998) The maize Lc regulatory gene up-regulates the flavonoid biosynthetic pathway of Petunia. Plant J 13: 381-392[CrossRef][Web of Science]

Cone KC, Cocciolone SM, Burr FA, Burr B (1993) Maize anthocyanin regulatory gene Pl is a duplicate of C1 that functions in the plant. Plant Cell 5: 1795-1805[Abstract]

Deblaere R, Bytebier B, De Greve H, Deboeck F, Schell J, Van Montagu M, Leemans J (1985) Efficient octopine Ti plasmid-derived vectors for Agrobacterium-mediated gene transfer to plants. Nucleic Acids Res 13: 4777-4788[Abstract/Free Full Text]

deVetten N, Quattrocchio F, Mol J, Koes R (1997) The an11 locus controlling flower pigmentation in petunia encodes a novel WD-repeat protein conserved in yeast, plants, and animals. Genes Dev 11: 1422-1434[Abstract/Free Full Text]

Dias AP, Braun EL, McMullen MD, Grotewold E (2003) Recently duplicated maize R2R3 myb genes provide evidence for distinct mechanisms of evolutionary divergence after duplication. Plant Physiol 131: 610-620[Abstract/Free Full Text]

Di Laurenzio L, Wysocka-Diller J, Malamy JE, Pysh L, Helariutta Y, Freshour G, Hahn MG, Feldmann KA, Benfey PN (1996) The SCARECROW gene regulates an asymmetric cell division that is essential for generating the radial organization of the Arabidopsis root. Cell 86: 423-433[CrossRef][Web of Science][Medline]

Elomaa P, Mehto M, Kotilainen M, Helariutta Y, Nevalainen L, Teeri TH (1998) A bHLH transcription factor mediates organ, region and flower type specific signals on dihydroflavonol-4-reductase (dfr) gene expression in the inflorescence of Gerbera hybrida (Asteraceae). Plant J 16: 93-99[CrossRef][Medline]

Elomaa P, Teeri TH (2001) Transgenic Gerbera. In YPS Bajaj, ed, Biotechnology in Agriculture and Forestry, Transgenic Crops III, Vol 48. Springer-Verlag, Berlin, pp 139-154

Farris JS, Albert VA, Källersjö M, Lipscomb D, Kluge AG (1996) Parsimony jackknifing outperforms neighbor joining. Cladistics 12: 99-124[CrossRef]

Gallie DR, Sleat DE, Watts JW, Turner PC, Wilson TMA (1987) The 5'-leader sequence of tobacco mosaic virus RNA enhances the expression of foreign gene transcripts in vitro and in vivo. Nucleic Acids Res 15: 3257-3273[Abstract/Free Full Text]

Goff SA, Cone KC, Chandler VL (1992) Functional analysis of the transcriptional activator encoded by the maize B gene: evidence for a direct functional interaction between two classes of regulatory proteins. Genes Dev 6: 864-875[Abstract/Free Full Text]

Goodrich J, Carpenter R, Coen ES (1992) A common gene regulates pigmentation pattern in diverse plant species. Cell 68: 955-964[CrossRef][Web of Science][Medline]

Grotewold E, Drummond BJ, Bowen B, Peterson T (1994) The myb-homologous P gene controls phlobaphene pigmentation in maize floral organs by directly activating a flavonoid biosynthetic gene subset. Cell 76: 543-553[CrossRef][Web of Science][Medline]

Grotewold E, Sainz MB, Tagliani L, Hernandez JM, Bowen B, Chandler VL (2000) Identification of the residues in the Myb domain of maize C1 that specify the interaction with the bHLH cofactor R. Proc Natl Acad Sci USA 97: 13579-13584[Abstract/Free Full Text]

Helariutta Y, Elomaa P, Kotilainen M, Seppänen P, Teeri TH (1993) Cloning of cDNA coding for dihydroflavonol-4-reductase (DFR) and characterization of dfr expression in the corollas of Gerbera hybrida var. Regina (Compositae). Plant Mol Biol 22: 183-193[CrossRef][Web of Science][Medline]

Helariutta Y, Kotilainen M, Elomaa P, Teeri TH (1995) Gerbera hybrida (Asteraceae) imposes regulation at several anatomical levels during inflorescence development on the gene for dihydroflavonol-4-reductase. Plant Mol Biol 28: 935-941[CrossRef][Medline]

Helariutta Y, Kotilainen M, Elomaa P, Kalkkinen N, Bremer K, Teeri TH, Albert VA (1996) Duplication and functional divergence in the chalcone synthase gene family of Asteraceae: Evolution with substrate change and catalytic simplification. Proc Natl Acad Sci USA 93: 9033-9038[Abstract/Free Full Text]

Horsch RB, Fry JE, Hoffmann NL, Eichholtz D, Rogers SG, Fraley RT (1985) A simple and general method for transferring genes into plants. Science 227: 1229-1231[Abstract/Free Full Text]

Hughes NF (1994) The enigma of angiosperm origins. Cambridge University Press, Cambridge, UK

Kotilainen M, Elomaa P, Uimari A, Albert VA, Yu D, Teeri TH (2000) GRCD1, an AGL2-like MADS box gene, participates in the C function during stamen development in Gerbera hybrida. Plant Cell 12: 1893-1902[Abstract/Free Full Text]

Kotilainen M, Helariutta Y, Mehto M, Pöllönen E, Albert VA, Elomaa P, Teeri TH (1999) GEG participates in the regulation of cell and organ shape during corolla and carpel development in Gerbera hybrida. Plant Cell 11: 1093-1104[Abstract/Free Full Text]

Kranz HD, Denekamp M, Greco R, Jin H, Leyva A, Meissner RC, Petroni K, Urzainqui A, Bevan M, Martin C et al. (1998) Towards functional characterization of the members of the R2R3-MYB gene family from Arabidopsis thaliana. Plant J 16: 263-276[CrossRef][Web of Science][Medline]

Lesnick ML, Chandler VL (1998) Activation of the maize anthocyanin gene a2 is mediated by an element conserved in many anthocyanin promoters. Plant Physiol 117: 437-445[Abstract/Free Full Text]

Lloyd AM, Walbot V, Davis RW (1992) Arabidopsis and Nicotiana anthocyanin production activated by maize regulators R and C1. Science 258: 1773-1775[Abstract/Free Full Text]

Ludwig SR, Habera LF, Dellaporta SL, Wessler SR (1989) Lc, a member of the maize R gene family responsible for tissue-specific anthocyanin production, encodes a protein similar to transcriptional activators and contains the myc-homology region. Proc Natl Acad Sci USA 86: 7092-7096[Abstract/Free Full Text]

Martin C, Paz-Ares J (1997) MYB transcription factors in plants. TIG 13: 67-73

Meissner RC, Jin H, Cominelli E, Denekamp M, Fuertes A, Greco R, Kranz HD, Penfield S, Petroni K, Urzainqui A et al. (1999) Function search in a large transcription factor gene family in Arabidopsis: assessing the potential of reverse genetics to identify insertional mutations in R2R3 MYB genes. Plant Cell 11: 1827-1840[Abstract/Free Full Text]

Mol J, Grotewold E, Koes R (1998) How genes paint flowers and seeds. Trends Plant Sci 3: 212-217[CrossRef][Web of Science]

Mooney M, Desnos T, Harrison K, Jones J, Carpenter R, Coen E (1995) Altered regulation of tomato and tobacco pigmentation genes caused by the delila gene of Antirrhinum. Plant J 7: 333-339

Moyano E, Martinez-Garcia JF, Martin C (1996) Apparent redundancy in myb gene function provides gearing for the control of flavonoid biosynthesis in Antirrhinum flowers. Plant Cell 8: 1519-1532[Abstract]

Nesi N, Debeaujon I, Jond C, Pelletier G, Caboche M, Lepiniec L (2000) The TT8 gene encodes a basic helix-loop-helix domain protein required for expression of DFR and BAN genes in Arabidopsis siliques. Plant Cell 12: 1863-1878[Abstract/Free Full Text]

Nesi N, Jond C, Debeaujon I, Caboche M, Lepiniec L (2001) The Arabidopsis TT2 gene encodes an R2R3 MYB domain protein that acts as a key determinant for proanthocyanidin accumulation in developing seed. Plant Cell 13: 2099-2114[Abstract/Free Full Text]

Ow DW, Wood KV, DeLuca M, De Wet JR, Helinski DR, Howell SH (1986) Transient and stable expression of the firefly luciferase gene in plant cells and transgenic plants. Science 234: 856-859[Abstract/Free Full Text]

Paz-Ares J, Ghosal D, Wienand U, Peterson PA, Saedler H (1987) The regulatory C1 locus of Zea mays encodes a protein with homology to myb proto-oncogene products and with structural similarities to transcriptional activators. EMBO J 6: 3553-3558[Web of Science][Medline]

Pooma W, Gersos C, Grotewold E (2002) Transposon insertions in the promoter of the Zea mays a1 gene differentially affect transcription by the Myb factors P and C1. Genetics 161: 793-801[Abstract/Free Full Text]

Quattrocchio F, Wing JF, Leppen HTC, Mol JNM, Koes RE (1993) Regulatory genes controlling anthocyanin pigmentation are functionally conserved among plant species and have distinct set of target genes. Plant Cell 5: 1497-1512[Abstract]

Quattrocchio F, Wing JF, van der Woute K, Mol JNM, Koes R (1998) Analysis of bHLH and MYB domain proteins: species-specific regulatory differences are caused by divergent evolution of target anthocyanin genes. Plant J 13: 475-488[CrossRef][Web of Science][Medline]

Quattrocchio F, Wing J, van der Woute K, Souer E, de Vetten N, Mol J, Koes R (1999) Molecular analysis of the anthocyanin2 gene of petunia and its role in the evolution of flower color. Plant Cell 11: 1433-1444[Abstract/Free Full Text]

Sainz MB, Grotewold E, Chandler VL (1997) Evidence for direct activation of an anthocyanin promoter by the maize C1 protein and comparison of DNA binding by related myb domain proteins. Plant Cell 9: 611-625[Abstract]

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY

Sanderson MJ, Doyle JA (2001) Sources of error and confidence intervals in estimating the age of angiosperms from rbcL and 18S rDNA data. Am J Bot 88: 1499-1516[Free Full Text]

Spelt C, Quattrocchio F, Mol JNM, Koes R (2000) anthocyanin1 of petunia encodes a basic helix-loop-helix protein that directly activates transcription of structural anthocyanin genes. Plant Cell 12: 1619-1631[Abstract/Free Full Text]

Spelt C, Quattrocchio F, Mol JNM, Koes R (2002) ANTHOCYANIN1 of petunia controls pigment synthesis, vacuolar pH, and seed coat development by genetically distinct mechanisms. Plant Cell 14: 2121-2135[Abstract/Free Full Text]

Stracke R, Werber M, Weisshaar B (2001) The R2R3-MYB gene family in Arabidopsis thaliana. Curr Opin Plant Biol 4: 447-456[CrossRef][Web of Science][Medline]

Timmermans MCP, Hudson A, Becraft PW, Nelson T (1999) ROUGH SHEATH2: a myb protein that represses knox homeobox genes in maize lateral organ primordia. Science 284: 151-153[Abstract/Free Full Text]

Tsiantis M, Schneeberger R, Golz JF, Freeling M, Langdale JA (1999) The maize rough sheath2 gene and leaf development programs in monocot and dicot plants. Science 284: 154-156[Abstract/Free Full Text]

Tuerck JA, Fromm ME (1994) Elements of the maize A1 promoter required for transactivation by the anthocyanin B/C1 or phlobaphene P regulatory genes. Plant Cell 6: 1655-1663[Abstract]

Uimari A, Strommer J (1997) Myb26: a MYB-like protein of pea flowers with affinity for promoters of phenylpropanoid genes. Plant J 12: 1273-1284[CrossRef][Web of Science][Medline]

van Haute E, Joos H, Maes M, Warren G, van Montagu M, Schell J (1983) Intergeneric transfer and exchange recombination of restriction fragments cloned in pBR322: a novel strategy for the reversed genetics of the Ti plasmids of Agrobacterium tumefaciens. EMBO J 2: 411-417[Web of Science][Medline]

van Larebeke N, Engler G, Holsters M, van der Esacker S, Schilperoort RA, Schell J (1974) Large plasmid in Agrobacterium tumefaciens essential for crown gall-inducing ability. Nature 252: 169-170[CrossRef][Medline]

Waites R, Selvadurai HRN, Oliver IR, Hudson A (1998) The PHANTAS TICA gene encodes a MYB transcription factor involved in growth and dorsoventrality of lateral organs in Antirrhinum. Cell 93: 779-789[CrossRef][Web of Science][Medline]

Walker AR, Davison PA, Bolognesi-Winfield AC, James CM, Srinivasan N, Blundell TL, Esch JJ, Marks MD, Grey JC (1999) The TRANSPARENT TESTA GLABRA1 locus, which regulates trichome differentiation and anthocyanin biosynthesis in Arabidopsis, encodes a WD40 repeat protein. Plant Cell 11: 1337-1349[Abstract/Free Full Text]

Winkel-Shirley B (2001) It takes a garden. How work on diverse plant species has contributed to an understanding of flavonoid metabolism. Plant Physiol 127: 1399-1404[Free Full Text]

Yu D, Kotilainen M, Pöllänen E, Mehto M, Elomaa P, Helariutta Y, Albert VA, Teeri TH (1999) Organ identity genes and modified patterns of flower development in Gerbera hybrida (Asteraceae). Plant J 17: 51-62[CrossRef][Web of Science][Medline]




This article has been cited by other articles:


Home page
J Exp BotHome page
S. K. Broholm, E. Pollanen, S. Ruokolainen, S. Tahtiharju, M. Kotilainen, V. A. Albert, P. Elomaa, and T. H. Teeri
Functional characterization of B class MADS-box transcription factors in Gerbera hybrida
J. Exp. Bot., September 18, 2009; (2009) erp279v1.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
R. A. E. Laitinen, M. Ainasoja, S. K. Broholm, T. H. Teeri, and P. Elomaa
Identification of target genes for a MYB-type anthocyanin regulator in Gerbera hybrida
J. Exp. Bot., October 1, 2008; 59(13): 3691 - 3703.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. K. Broholm, S. Tahtiharju, R. A. E. Laitinen, V. A. Albert, T. H. Teeri, and P. Elomaa
A TCP domain transcription factor controls flower type specification along the radial axis of the Gerbera (Asteraceae) inflorescence
PNAS, July 1, 2008; 105(26): 9117 - 9122.
[Abstract] [Full Text] [PDF]


Home page
jashsHome page
H. Ma, M. Pooler, and R. Griesbach
Ratio of Myc and Myb Transcription Factors Regulates Anthocyanin Production in Orchid Flowers
J. Amer. Soc. Hort. Sci., January 1, 2008; 133(1): 133 - 138.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
Y. Ban, C. Honda, Y. Hatsuyama, M. Igarashi, H. Bessho, and T. Moriguchi
Isolation and Functional Analysis of a MYB Transcription Factor Gene that is a Key Regulator for the Development of Red Coloration in Apple Skin
Plant Cell Physiol., July 1, 2007; 48(7): 958 - 970.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
S. Shimada, H. Otsuki, and M. Sakuta
Transcriptional control of anthocyanin biosynthetic genes in the Caryophyllales
J. Exp. Bot., March 1, 2007; 58(5): 957 - 967.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
H. Mano, F. Ogasawara, K. Sato, H. Higo, and Y. Minobe
Isolation of a Regulatory Gene of Anthocyanin Biosynthesis in Tuberous Roots of Purple-Fleshed Sweet Potato
Plant Physiology, March 1, 2007; 143(3): 1252 - 1268.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
M. T. Sweeney, M. J. Thomson, B. E. Pfeil, and S. McCouch
Caught Red-Handed: Rc Encodes a Basic Helix-Loop-Helix Protein Conditioning Red Pericarp in Rice
PLANT CELL, February 1, 2006; 18(2): 283 - 294.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
K.-H. Jung, M.-J. Han, Y.-S. Lee, Y.-W. Kim, I. Hwang, M.-J. Kim, Y.-K. Kim, B. H. Nahm, and G. An
Rice Undeveloped Tapetum1 Is a Major Regulator of Early Tapetum Development
PLANT CELL, October 1, 2005; 17(10): 2705 - 2722.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
R. A.E. Laitinen, J. Immanen, P. Auvinen, S. Rudd, E. Alatalo, L. Paulin, M. Ainasoja, M. Kotilainen, S. Koskela, T. H. Teeri, et al.
Analysis of the floral transcriptome uncovers new regulators of organ determination and gene families related to flower organ differentiation in Gerbera hybrida (Asteraceae)
Genome Res., April 1, 2005; 15(4): 475 - 486.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. M. Hernandez, G. F. Heine, N. G. Irani, A. Feller, M.-G. Kim, T. Matulnik, V. L. Chandler, and E. Grotewold
Different Mechanisms Participate in the R-dependent Activity of the R2R3 MYB Transcription Factor C1
J. Biol. Chem., November 12, 2004; 279(46): 48205 - 48213.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
133/4/1831    most recent
pp.103.026039v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (22)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Elomaa, P.
Right arrow Articles by Teeri, T. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Elomaa, P.
Right arrow Articles by Teeri, T. H.
Agricola
Right arrow Articles by Elomaa, P.
Right arrow Articles by Teeri, T. H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY® THE PLANT CELL
Copyright © 2003 by the American Society of Plant Biologists