Plant Physiol. Journal of Pharmacology and Experimental Therapeutics
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Plant Physiology 133:1862-1872 (2003)
© 2003 American Society of Plant Biologists

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via ISI Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Himanen, K.
Right arrow Articles by Inzé, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Himanen, K.
Right arrow Articles by Inzé, D.
Agricola
Right arrow Articles by Himanen, K.
Right arrow Articles by Inzé, D.
DEVELOPMENT AND HORMONE ACTION

The Arabidopsis Locus RCB Mediates Upstream Regulation of Mitotic Gene Expression1

Kristiina Himanen2, Christophe Reuzeau, Tom Beeckman, Siegbert Melzer, Olivier Grandjean, Liz Corben3 and Dirk Inzé*

Department of Plant Systems Biology, Flanders Interuniversity Institute for Biotechnology, Ghent University, Technologiepark 927, B-9052 Gent, Belgium (K.H., T.B., L.C., D.I.); CropDesign N.V., B-9052 Gent, Belgium (C.R.); Université de Liège, Sart-Tilman, B-4000 Liège, Belgium (S.M.); and Institut National de la Recherche Agronomique, Centre de Versailles, Route de Saint-Cyr, F-78026, France (O.G.)


    ABSTRACT
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 RT-PCR
 LITERATURE CITED
 
Transcriptional regulation of cell cycle regulatory genes, such as B-type cyclins, is tightly linked with the mitotic activity in the meristems. To study the regulation of a B-type cyclin gene, a targeted genetic approach was undertaken. An Arabidopsis line containing a fusion construct between the CYCB1;1 promoter and a bacterial {beta}-glucuronidase marker gene (uidA) was used in ethyl methanesulfonate mutagenesis. The mutants were screened for altered CYCB1;1::uidA expression patterns. In a reduced CYCB1;1 expression mutant (rcb), the CYCB1;1::uidA expression was severely affected, being excluded from the shoot and root apical meristems and leaf primordia and shifted to cells associated with root cap and stomata. In addition to the overall reduction of the endogenous CYCB1;1 transcript levels, other G2-to-M phase-specific genes were also down-regulated by the mutation. In the mutant plants, the inflorescence stem growth was reduced, indicating low meristem activity. Based on the altered CYCB1;1::uidA expression patterns in rcb root meristem, a model is proposed for RCB that mediates the tissue specificity of CYCB1;1 promoter activity.


The eukaryotic cell cycle is controlled at two major checkpoints, one before DNA replication (G1 to S) and one before mitosis (G2 to M). In yeast (Saccharomyces cerevisiae) and animals, progression through these checkpoints is driven by cyclin-dependent kinases (CDKs), the activity of which depends on interaction with their regulatory subunits, the cyclins. Different cyclins mediate the cell cycle phase-specific activation of the CDKs and modify their substrate specificity in a spatial and temporal manner (Stals and Inzé, 2001Go). In Arabidopsis, five classes of CDKs have been identified (Vandepoele et al., 2002Go), but only two of them have been extensively characterized: CDKA;1 (formerly known as Cdc2a), which is active at the G1-to-S and G2-to-M checkpoints, and CDKB1;1 (formerly known as Cdc2b), whose activity is highest at the G2-to-M-transition (Mironov et al., 1999Go; Joubès et al., 2000Go; Porceddu et al., 2001Go; Menges and Murray, 2002Go). CDKB1;1 represents a plant-specific CDK that is thought to interact with the mitotic cyclin CYCB1;1 at the G2-to-M transition (Criqui et al., 2000Go) and also both genes show a coordinated transcriptional up-regulation during the G2-to-M phase (Mironov et al., 1999Go). Three main classes of cyclins (A, B, and D type) have been described in plants, and in the Arabidopsis genome, a total of 30 cyclins have been identified (Vandepoele et al., 2002Go). D-type cyclins are preferentially induced by mitogen stimuli at the G1 phase (Soni et al., 1995Go; Fuerst et al., 1996Go; Richard et al., 2002Go). Unlike the D-type cyclins, the levels of A- and B-type cyclins are tightly controlled by cell cycle progression. The promoter activities and transcript levels of A-type cyclins have been shown to increase at mid S phase (Fuerst et al., 1996Go; Shaul et al., 1996Go). For B-type cyclins, G2 and M phase-specific peaks in expression have been shown in many plant species, such as Arabidopsis (Ferreira et al., 1994aGo), Catharanthus roseus (Ito et al., 1998Go), and Nicotiana sylvestris (Tréhin et al., 1999Go).

As regulatory proteins, cyclins have a high turnover rate, and their cyclic appearance results from stringent regulation at the transcriptional level (Shaul et al., 1996Go; Criqui et al., 2001Go). A well-characterized example is the B-type cyclin, CYCB1;1. Transcriptional regulation of CYCB1;1 is tightly related to cell cycle activity and can be used as a marker for detecting mitotically active tissues (Ferreira et al., 1994bGo; Shaul et al., 1996Go; Colón-Carmona et al., 1999Go). The expression of the CYCB1;1 promoter-driven bacterial gus ({beta}-glucuronidase) gene (CYCB1; 1;;uidA) has been shown to correlate well with the mRNA localization of the endogenous gene (de Almeida Engler et al., 1999Go). The cell cycle-specific gene activation of CYCB1;1 is mediated via cis-acting elements in the promoter (Ito et al., 1998Go, 2001Go; Tréhin et al., 1999Go; Planchais et al., 2002Go).

Despite extensive analysis of the transcriptional control of the mitotic cyclin CYCB1;1, little is known about the regulatory pathways that affect its promoter activity. In an attempt to study the upstream regulation of the CYCB1;1 promoter, a targeted genetic approach was undertaken. The CYCB1;1::uidA line was used in chemical mutagenesis, thereby allowing visualization of mutations that specifically affect the promoter activity. Mutants were screened for altered patterns of CYCB1;1::uidA expression. We report the identification and characterization of a mutant line with reduced CYCB1;1::uidA expression (designated rcb). The rcb mutant lost CYCB1;1::uidA expression in both shoot and root apical meristems and leaf primordia, whereas the expression was ectopically induced in cells associated with root cap and stomata. In addition, the overall endogenous levels of the CYCB1;1 transcripts and those of other mitotic genes were reduced in the rcb mutant. In mature plants, the total length of the inflorescence stem and its diameter were significantly affected, indicating an effect on the meristem activity. Based on the altered CYCB1;1::uidA expression patterns in rcb root meristems, we propose a model in which RCB mediates the tissue specificity of the CYCB1;1 promoter activity.


    RESULTS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 RT-PCR
 LITERATURE CITED
 

Isolation of the rcb Mutant and Genetic Analysis

To study the regulation of the CYCB1;1 promoter activity, 2,000 seeds of the transgenic Arabidopsis line containing a CYCB1;1::uidA promoter fusion (Ferreira et al., 1994bGo) were mutagenized with ethyl methanesulfonate. The M1 plants were self-fertilized, and 7,850 of the M2 plants (314 M2 families) were screened for altered patterns of CYCB1;1::uidA promoter activity in the root tips. From the mutant screening, one line with rcb expression was chosen for further analysis. In this line, the CYCB1;1::uidA expression appeared to be ectopically induced in the root cap cells, whereas it was absent from the root apical meristem (Fig. 1, A and B). To confirm that the altered CYCB1;1::uidA expression in rcb was not caused by a mutation in the CYCB1;1::uidA promoter, the wild-type and rcb promoters (1.27 kb) from the T-DNA constructs were isolated by PCR and sequenced. The sequences did not differ, indicating that the altered expression was caused by an independent mutation.



View larger version (86K):
[in this window]
[in a new window]
 
Figure 1. Bright- and dark-field images of whole-mount GUS-stained plants. A, CYCB1;1::uidA in wild type. B, CYCB1;1::uidA in rcb mutant. C, CYCB1;1::uidA in a heterozygous (rcb/RCB) plant with weak expression in the meristem combined with root cap expression. Anatomical analysis of histochemically stained Arabidopsis seedling roots. D, Longitudinal section (5 µm) of 9-d-old wild-type seedling root in which CYCB1;1::uidA staining is restricted to epidermal and cortical cell files. E, Longitudinal section of rcb mutant with CYCB1;1::uidA expression shifted to cells of the lateral root cap and absence of expression in the root apical meristem. Differential interference contrast microscopy of histochemically stained leaves at different developmental stages in 4-d-old seedlings (F-K). F to H, CYCB1;1::uidA in wild type. I to K, CYCB1;1::uidA in rcb. F and I, Shoot apices showing the emerging first pair of leaf primordia (SAM). G and J, Young developing leaves. H and K, Detailed view of adaxial epidermis of developing leaves showing the stomatal complexes. H, CYCB1;1::uidA expression restricted to developing stomata at the meristemoid stage in wild type. K, Localization of CYCB1;1::uidA in palisade cells underneath mature guard cells; arrows indicate unstained stomata. Expression of CYCB1;1::uidA during inflorescence development (L and M). L, GUS staining in wild-type inflorescences at different developmental stages. CYCB1;1::uidA is expressed in the entire pistil. M, Presence of GUS staining in wild-type ovaries and absence from the nectaries. N, CYCB1;1::uidA expression in rcb inflorescences. CYCB1;1::uidA is absent from pistils but strongly expressed in the nectaries (O). C, cortex; CRC, columella root cap; E, epidermis; En, endodermis; LRC, lateral root cap; S, stele. Bars = 200 µm (A-C), 100 µm (D, E, F, and I), 1 mm (G and J), and 50 µm (H and K).

 

Before further phenotypic analysis, the mutant line was subjected to three successive backcrosses with the CYCB1;1::uidA starter line. In the F1 population, gain of CYCB1;1::uidA expression in the root cap was detected in all of the progeny, indicating that thercb mutation was semidominant. In the F2 population, three classes of expression patterns were observed. When compared with the homozygous wild-type (RCB/RCB; Fig. 1A) and homozygous mutant plants (rcb/rcb; Fig. 1B), the heterozygous mutants (rcb/RCB; Fig. 1C) had intermediate expression patterns. As with the homozygous mutants, the heterozygous mutants (F1, 100%; and F2, 50%) showed a gain of CYCB1;1::uidA expression in the lateral root cap. In the root apical meristem, however, intermediate intensities of the CYCB1;1::uidA expression were observed, whereas in the homozygous mutants, no expression was detected in that tissue. In the F2 population, the segregation pattern of ectopic CYCB1;1::uidA expression in the root cap again suggested the semidominant nature of the rcb mutation.

To further confirm that the rcb mutation was independent from the CYCB1;1::uidA transgene, test crosses were performed between the rcb mutants and the C24 wild-type plants. The CYCB1;1::uidA expression pattern in the F1 population resembled that obtained from the backcrosses, although the GUS staining was often much weaker because of the reduced amount of CYCB1;1::uidA T-DNA in the progeny. In the F2 population, CYCB1;1::uidA-driven GUS staining patterns typical for wild-type (RCB/RCB, 24%), heterozygous (rcb/RCB, 47%), rcb mutant (rcb/rcb, 24%), and GUS-negative (5%) genotypes were encountered. This result confirmed that the mutation was independent from the uidA promoter fusion itself because the wild-type (RCB/RCB) CYCB1;1::uidA expression patterns could be recovered without introducing wild-type alleles of the uidA construct. However, the segregation pattern of the GUS-negative plants was only 5% in the F2 population, indicating that rcb contained two alleles of the uidA transgene. The segregation pattern of GUS-negative lines (5%) was also confirmed by kanamycin selection: Only 10 of 200 F2 plants were sensitive to the selection. This result again underlines the fact that the rcb mutation resides outside the CYCB1;1::uidA fusion because the mutation was able to relocalize the expression of the two CYCB1;1::uidA transgenes.

To determine the genomic locus of the rcb mutation, genetic mapping was initiated with amplified fragment length polymorphism (AFLP) markers (Peters et al., 2001Go). To introduce mapped markers into the rcb mutant line, the M3 line of rcb (in Arabidopsis C24 ecotype) was crossed with Columbia-0 (Col-0) ecotype. From a segregating F2 population, 40 mutants, four wild-type plants, and the parental lines were selected by GUS assay of 2-week-old root segments. The selected lines were processed for bulked segregant AFLP analysis according to Peters et al. (2001Go). From each of the 16 primer combinations used, on average five polymorphic markers for each were identified for C24 and Col-0 ecotypes. The bulked segregant analysis showed linkage with eight markers located in the lower arm of chromosome 2 for the rcb mutation (data not shown). Also, the non-linkage was analyzed, and the rcb mutation was not linked with the polymorphic markers on chromosomes 1, 3, 4, or 5. The CYCB1;1 gene itself is located in chromosome 4 (At4g37490). In addition, single simple length polymorphism markers (Bell and Ecker, 1994Go) for each of the Arabidopsis chromosomes were tested to confirm the putative loci. Analysis of 40 mutants with chromosome 2-specific markers (nga1126 [chromosome 2, 51 cM], nga168 [chromosome 2, 74 cM], and an INDEL marker in chromosome 2 [79 cM]) gave segregation patterns of 28:23:28 individuals for the C24 genotype, 11:19:13 for the heterozygous mutant genotype, and 1:0:1 for the Col-0 genotype, respectively. These data suggest that the rcb mutation is located on the lower arm of chromosome 2.


The CYCB1;1::uidA Expression and CYCB1;1 mRNA Patterns in the rcb Mutant

The rcb mutant was selected on the basis of a remarkable change in the CYCB1;1 promoter-driven GUS staining patterns. To further characterize the cell specificity of the CYCB1;1::uidA expression in rcb roots, the wild-type expression pattern was analyzed in anatomical sections. In the primary root apical meristem of the wild-type plant, the CYCB1;1::uidA expression was detected in a cell type-specific manner in the epidermal and cortical cell files (Fig. 1D), whereas in the newly developed meristems of lateral root primordia, the expression was uniform (Ferreira et al., 1994bGo; Beeckman et al., 2001Go). In rcb, this expression pattern was severely altered. The expression was absent from the epidermal and cortical cell files in the root apex but was ectopically induced in the lateral root cap initials and their immediate daughter cells (Fig. 1E), where no expression in the wild type could be detected. Other meristematic tissues of wild-type and rcb plants were analyzed to see whether the effect of rcb mutation was root specific.

Wild-type shoot apical meristem and emerging leaf primordia expressed CYCB1;1::uidA strongly (Fig. 1F). In young wild-type leaf primordia, the basipetal gradient of cell division activity could be observed (Fig. 1G; see also Donnelly et al., 1999Go). During the wild-type stomata development, the expression was restricted to the meristemoids (Fig. 1H; see also Serna and Fenoll, 1997Go). In rcb, the meristematic cells in the shoot apex, leaf primordia, and young leaves had no CYCB1;1::uidA promoter activity (Fig. 1I). Instead, in rcb, strong expression was present in the area of hydathodes (Fig. 1J) and ectopically induced in the palisade parenchyma cells beneath each developing stomatum (Fig. 1K).

Also, in rcb flowers, an altered CYCB1;1::uidA expression was observed. In the flowers of wild-type plants, CYCB1;1::uidA expression was strong in developing pistil, excluding the stigma and nectaries (Fig. 1, L and M). In contrast, in the rcb mutant line, no GUS staining was detected in the pistil, whereas the nectaries were strongly stained (Fig. 1, N and O).

Thus, in different tissues and organs of the rcb mutant, a shift in CYCB1;1::uidA localization takes place in comparison with the wild type. Both in the root and shoot apical meristems, the strong meristematic CYCB1;1::uidA expression was lost in rcb, whereas an ectopic expression was induced in tissues that usually have no mitotic activity. In addition, the semidominant nature of the rcb mutant indicates that RCB could encode a dose-dependent activator of the CYCB1;1 promoter in meristematic tissues and perhaps a repressor outside the meristems.


Root Cap Maturation in rcb

In the rcb roots, the CYCB1;1::uidA expression was affected in a cell type-specific manner, namely ectopically induced in the lateral root cap initial cells. We analyzed the CYCB1;1::uidA expression in more detail in wild-type and rcb roots at different stages of root cap development: In rcb, it characteristically changed during root cap development, whereas in wild-type plants, it was high in the developing lateral root primordia (Fig. 2A) until starch accumulated in the newly forming root cap cells (Fig. 2B). Upon differentiation of statocyte layers in the columella, the CYCB1;1::uidA expression diminished (Fig. 2C), and in mature wild-type root caps, it was undetectable (Fig. 2D). In contrast, in rcb, the CYCB1;1::uidA expression followed an opposite pattern and appeared to be tightly linked with the development of the statocyte tissues. In young lateral root primordia (before development of the statocytes), CYCB1;1::uidA was not expressed (Fig. 2, E and F). The CYCB1;1::uidA expression in lateral root caps of rcb appeared with the maturation of the statocytes in the columella (Fig. 2G). At the time the statocyte layers in the columella were fully developed, the lateral root cap cells showed strong GUS staining, whereas the columella remained unstained (Fig. 2H).



View larger version (66K):
[in this window]
[in a new window]
 
Figure 2. Comparative analysis of CYCB1;1::uidA expression during lateral root development and de novo root cap formation under dark-field stereoscopy. A to D, Young lateral root primordia, emerging lateral roots, outgrowing lateral roots, and lateral root with fully developed root caps in wild type, respectively. E to H, Young lateral root primordia, emerging lateral roots, outgrowing lateral roots, and lateral root with fully developed root caps in rcb mutant, respectively. F, Statoliths (arrow) become refractive under dark-field optics. G, CYCB1;1::uidA is only expressed (arrow) in rcb at the moment statocyte organization starts to appear. I and J, CYCB1;1::uidA expression in 2,4-dichlorophenoxyacetic acid-treated seedling roots of wild type and rcb, respectively. Bars = 1 mm (A-H), 200 µm (I and J).

 

In rcb mutants, the CYCB1;1::uidA expression was absent from the root apical meristem and was exclusively associated with the root cap-specified zone. We tested two conditions under which the size and cell patterning of root meristems were severely altered. Treatment with the auxin transport inhibitor naphthylphthalamic acid is known to cause spanning of tissue with root cap identity upwards from the root tip (Sabatini et al., 1999Go). In the rcb mutant, the treatment with 10-5 M naphthylphthalamic acid led to expansion of the root cap with the characteristic CYCB1;1::uidA expression for rcb (data not shown). Furthermore, synthetic auxin 2,4-dichlorophenoxyacetic acid was used to induce ectopic cell division in the meristem. In both wild-type and rcb plants, treatment with 2,4-dichlorophenoxyacetic acid increased the meristematic tissue in both plant types and induced a strong expression of CYCB1;1::uidA in the expanded meristem of wild-type plants (Fig. 2I) but not in the rcb root. In the mutant, the typically restricted pattern of CYCB1;1::uidA expression was observed (Fig. 2J).


Shoot Phenotype

To analyze the shoot-specific growth phenotypes of rcb, the mutant and CYCB1;1::uidA wild-type plants (C24 ecotype) and the CYCB1;1 knockout line from the Versailles T-DNA collection and the corresponding wild-type plants (Wassilewskija [Ws] ecotype) were grown under short- (8 h/16 h) and long- (16 h/8 h) day light conditions. Growth was analyzed by comparing the number and size of rosette leaves, number of rosette and lateral branches, plant height, flowering time, and flower development. Observations were made on 40 plants in at least three replicates for the growth conditions. Although under constant light conditions no consistent growth phenotypes were detected, under short- and long-day conditions, the growth of rcb plants was considerably altered when compared with that of the wild-type controls (Table I). The growth of rcb plants was repressed at the stage of inflorescence stem development, which were approximately 25% shorter in height and more rigid than the wild-type plants (Fig. 3A). Flowering time in rcb was delayed by approximately 6 d. Rosette leaf growth was similar to that of wild-type controls, without any significant difference in leaf development and leaf number. Rosette branch development was reduced, whereas lateral branches developed as those of control plants. The growth of the CYCB1;1 knockout plants was comparable with that of the wild-type plants, with only a significantly reduced number of leaves and rosette branches in the mutant plants (Table I).


View this table:
[in this window]
[in a new window]
 
Table I. Phenotypic measurements of wild-type C24 and rcb mutants under short-day conditions 11 weeks after sowing Values were averaged from five sections for each sample. Observations were made on 40 plants in at least three different replicates.

 


View larger version (91K):
[in this window]
[in a new window]
 
Figure 3. Shoot phenotype. A, Wild-type and rcb plants grown under long-day conditions. B and C, Hand sections of 5- to 6-week-old wild-type C24 and rcb plants, respectively. D and E, Transverse section of the basal part of the stem showing a vascular bundle of wild type and rcb, respectively. F and G, Transverse section of the basal part of the stem showing the interfascicular region of wild type and rcb, respectively. C, cortex; E, epidermis; iV, interfascicular region; P, phloem; Pt, pith; V, vascular bundle; X, xylem. Bars = 0.5 mm (B), 1 mm (C), and 10 µm (D-G).

 

In rcb, the silique length and diameter were significantly shorter (40%) and larger than those of wild-type plants, respectively (Table I). Furthermore, under both long- and short-day conditions, the stem diameter increased significantly in rcb plants from the basis of the rosette when the flowering stem was 2 d old (1-cm total height) until the end of the development. An increase in diameter of the lateral branches of rcb was similarly observed.

To identify the origin of the stem diameter increase, the stems were sectioned at different positions, starting from 1 cm above the rosette (below any lateral branches) and at approximately 10 cm from the rosette. The rcb stem sections were larger but had a normal radial symmetry consisting of an epidermal layer, four to five layers of chlorenchyme, a layer of alternating vascular bundles and intervascular fibers, and a central zone. In control plants, the average number of vascular strands in the stem sections was nine, instead of an average of 11 in rcb plants (Fig. 3, B and C). The structure of the vascular strands in rcb differed from that of control plants by larger vascular bundles at the base of the stem and at one-third of the overall stem height. The difference in shape of the vascular bundles appears to be due to an increase in cell size both in the phloem and in the xylem regions (Fig. 3, D and E). Also, the cells between the vascular bundles were enlarged, contributing to the overall expansion of the stem diameter (Fig. 3, F and G). The number of cells in the inflorescence stem was estimated by calculating the number of cells from 10 images taken of sections cut 1 cm above the rosette. Although the cell numbers did not change in the cortex, in the central stele, and especially in the interfascicular zone, considerably more cells were present in rcb than in the wild type (Table I).

Kinematic analysis of root growth from germination until 2 weeks of age, quantification of the number of lateral roots, and flow cytometric analysis of root and leaf tissues did not reveal any differences between rcb and wild-type plants (data not shown).


rcb Down-Regulates a Set of Mitotic Genes in Arabidopsis

To test whether the rcb mutation affected other cell cycle genes, transcript levels of CYCA2;1, CYCB1;1, CYCB2;1, CDKA;1, and CDKB1;1 were analyzed by semiquantitative RT-PCR as described previously by Himanen et al. (2002Go). One week after germination, seedlings were used for RNA extraction. The mutant had reduced CYCB1;1 transcript levels when compared with those of wild-type plants, in agreement with the reduced GUS activity. In addition to down-regulation of CYCB1;1, other G2-to-M and M phase-specific genes, such as CYCB2;1 and CDKB1;1, also showed similarly reduced transcript levels (Fig. 4A). Markers of the G1-to-S cell cycle phase, such as CYCA2;1 and CDKA;1, were not affected by the mutation. To further confirm the reduced endogenous transcript levels of CYCB1;1, in situ hybridization was performed on shoot apices from wild-type and mutant plants grown under conditions described by Corbesier et al. (1996Go). In the rcb shoot apical meristem, no signal of CYCB1;1 mRNA could be detected with antisense or sense probes (Fig. 4, B and C). In wild-type plants, the localization of CYCB1;1 mRNA was patchy when hybridized with antisense probes, whereas the sense probes gave no signal (Fig. 4, D and E).



View larger version (80K):
[in this window]
[in a new window]
 
Figure 4. Reverse transcription (RT)-PCR gel blot. A, Transcript level of the cell cycle regulatory genes (CYCB1;1, CYCB2;1, CYCA2;1, CDKA;1, CDKB1;1, and ACTIN-2) in 1-week-old wild-type and rcb seedlings. B to E, In situ hybridization of CYCB1;1 mRNA on shoot apical meristem tissue of rcb mutant and wild-type plants. B, rcb CYCB1;1 sense probe. C, rcb hybridized with CYCB1;1 antisense probe. D, Wild type hybridized with CYCB1;1 sense probe. D, Wild type hybridized with CYCB1;1 antisense probe.

 


    DISCUSSION
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 RT-PCR
 LITERATURE CITED
 

rcb Shows an "Inverse" Development of the CYCB1;1::uidA Expression Pattern during Root Cap Maturation Compared with the Wild Type

The most striking phenotype of the rcb mutant was the ectopic expression of CYCB1;1::uidA observed in the root cap where wild-type plants do not show any expression. Our results indicate that the CYCB1;1::uidA expression pattern is strictly localized in specific cell types, depending on the developmental stage of the particular organ. In the wild-type root apical meristem, the CYCB1;1::uidA is expressed in the dividing cortical and epidermal cell files, whereas in the rcb, no expression is detected. However, during the lateral root development in rcb, the CYCB1;1::uidA expression is only induced upon root cap maturation and becomes restricted to the lateral root cap cells, whereas it is not expressed in the mature root cap of the wild type. In pea (Pisum sativum), the root cap meristem is regulated independently from the primary root apical meristem and is programmed to produce a species-specific amount of root cap cells (Hawes et al., 1998Go). When the organ reaches a certain size, cell production ceases. The cells differentiate progressively through a series of developmental stages until the cells at the periphery of the root cap separate as border cells. The separation of these metabolically active cells depends on the environmental conditions, such as water potential. When incubated in water with gentle agitation, the border cells respond immediately by expansion and release from the root cap, whereas under dry conditions, they remain attached to the root. When the border cells are still attached to a mature root cap, the root cap meristem arrests in the G1 phase of the cell cycle (Brigham et al., 1998Go). As a sign of the G1 arrest, the mature root cap cells fail to express the histone H2 gene (Tanimoto et al., 1993Go). However, upon removal of the border cells, a cell division marker gene is induced within 15 min (Woo and Hawes, 1997Go).

In Arabidopsis, the border cells appear to be tightly associated with the root cap and are not released during water agitation treatment (Hawes et al., 1998Go). The slow growth rate of the root cap indicates that the cell division activity is generally low. This conclusion is supported by lack of CYCB1;1::uidA (our observations) and CYCA2;1 expression, as well as by thymidine labeling in wild-type root caps (Burssens et al., 2000aGo). In rcb, an opposite development is observed, because the marker gene for mitotic activity, CYCB1;1:uidA, is ectopically induced in the lateral root cap cells. However, no differences in the root cap size or structure are observed in the mutants, indicating that the ectopic CYCB1;1::uidA expression alone is not adequate to drive additional cell divisions in these cells.


In rcb Inflorescence, Meristem Activity Is Affected But Not Organ Initiation

Based on the phenotypic analysis of the rcb mutant, we conclude that in addition to the regulation of CYCB1;1 tissue specificity in roots, RCB is necessary for inflorescence meristem activity. Plant development is generally due to a balance between cell division in meristematic tissues to produce organs and cell growth and differentiation to allow organ growth and maturation. The stem phenotype appeared rather late, during rosette and inflorescence growth, namely at the onset of inflorescence stem growth. Because the number of lateral organs remained unaltered, the size and the early functioning of the shoot apical meristem were probably not strongly affected. However, the meristem function may be modified at a later stage, perhaps by affecting the cell production rate in the meristem responsible for inflorescence stem growth. Furthermore, increased number of cells in the transverse sections of the inflorescence stems was detected, suggesting that these growth activities are regulated independently from each other.

In the flower organs of wild-type plants, CYCB1;1::uidA expression was found in the young tip of the pistil where actively dividing cells are present (Liu et al., 1997Go; Broadhvest et al., 2000Go). In rcb, the CYCB1;1::uidA expression pattern is different because it is shifted from the pistil to the stamen. The siliques of rcb were also significantly shorter and wider than those of the wild-type lines, indicating that RCB was necessary to maintain CYCB1;1 gene expression in pistils of the wild-type plants, and lack of CYCB1;1 expression in rcb pistils repressed the mature silique length.


Redundancy in Plant Cell Cycle

The rcb mutation affected various organs. In roots and leaves, where changes in CYCB1;1::uidA expression were detected, no growth phenotypes were observed. On the other hand, the inflorescence stem had a strong growth phenotype probably because of the effect of the rcb mutation on the expression of CYCB1;1 in the shoot apex. In addition, a similar response was observed in the siliques, which remained shorter but broader than in wild type. Interestingly, the phenotype of a CYCB1;1 knockout mutant differed from that observed in rcb, showing a decrease in number of rosette leaves and rosette branches. These observations indicate that the tissue specificity of CYCB1;1 expression and CYCB1;1 knockout had a different effect on the shoot apical meristem activity.

In addition to the down-regulation of CYCB1;1, the rcb mutation also down-regulated the M phase-specific genes (CYCB2;1, and CDKB1;1) at the transcriptional level. The fact that the rcb mutant was still able to grow indicated that the functions of these genes have probably been taken over by other genes. These data suggest a high level of redundancy for cell cycle genes in plants. Similar situations are found in yeast with three G1 cyclins (Cln1, Cln2, and Cln3). Only loss-of-function of the Cln3 delays slightly entry into S phase; however, cells that are double mutants for certain combinations of these genes have a more severe cell cycle delay than the single mutants (Thomas, 1993Go). Also, the four mitotic B-type cyclins of yeast (Clb1, Clb2, Clb3, and Clb4) are highly redundant (Tjandra et al., 1998Go). Only deletion of Clb2 retards mitosis, whereas any of the other three mitotic cyclins can be deleted without noticeable phenotypes (Amon et al., 1993Go). Nevertheless, only deletion of the three other genes can create a Clb2-dependent genetic background. In addition, the yeast cyclins appear to be capable of complementing each other's functions, despite the cell cycle phase in which they normally function. In yeast, two additional B-type cyclins, Clb5 and Clb6, are produced at the onset of the S phase, but they still display functional redundancy with the other four B-type cyclins (Segal et al., 1998Go).

In mammals, such flexibility does not seem to exist. In mice (Mus musculus), deletion of one of the two B-type cyclins (CycB1) is lethal, although the function of the other, CycB2, can be compensated (Brandeis et al., 1998Go). In animal systems, transcriptional up-regulation of the B-type cyclins have been shown to play a central role in regulating the entry into mitosis (Murray and Kirschner, 1989Go; Nurse, 1990Go). In plants, CYCB1;1 has been suggested to be the main mitotic cyclin (Doerner et al., 1996Go). Ectopic expression of CYCB1;1 stimulates cell division activity in root apical meristems, indicating that the level of CYCB1;1 is a limiting factor for the entry into mitosis. However, the absence of severe growth phenotypes in rcb argues against this conclusion. Clearly, reduced levels of CYCB1;1, CYCB2;1, and CDKB1;1 had no dramatic effects on cell cycle progression. Other B-type, or even A-type, cyclins probably take over the role of cyclins with defective function.

Not much is known about the redundancy between plant cyclins. Immunolocalization studies in maize (Zea mays) have revealed different subcellular localizations for several closely related plant cyclins (Mews et al., 1997Go, 2000Go), and strictly localized patterns also have been reported for the D-type cyclins in the floral meristems of snapdragon (Antirrhinum majus; Gaudin et al., 2000Go). In addition, we have shown strictly tissue-specific expression patterns for CYCB1;1::uidA in the cortical and epidermal cells in wild-type root apical meristems. However, based on database information of Arabidopsis, at least 30 cyclins are predicted (Vandepoele et al., 2002Go). Such a high number of cyclins is more than that reported for any other organism to date. The actual function of all the cyclins still remains to be studied, but plant-specific features of growth (no cell migration) and development (postembryonic organ development) may require special regulation of the cell cycle. To what extent these numerous plant cyclins can confer functional redundancy between each other still remains to be elucidated.


RCB May Have a Dual Function in Regulating the Tissue Specificity of the CYCB1;1 Expression

We aimed at identifying direct regulators of CYCB1;1 promoter activities. In the rcb mutant, identified from the screen of ethyl methanesulfonate-mutagenized CYCB1;1::uidA plants, a shift in tissue specificity of GUS activity was encountered, indicating that RCB itself may be situated upstream of the CYCB1;1 promoter regulation. Based on the CYCB1;1::uidA expression patterns in wild-type and rcb mutants, we propose a model for the function of RCB. In this model, RCB plays a dual role both as a positive regulator for CYCB1;1 promoter activation in the outer layers of the root apical meristem and as a repressor in lateral root cap cells (Fig. 5A). This conclusion derives from the observed loss of CYCB1;1::uidA expression in the root apical meristem and, on the other hand, on the gain-of-expression in the lateral root cap in rcb (Fig. 5B). Further support for the model comes from the analysis of the heterozygous mutants in which the meristematic expression has been reduced to an intermediate level in combination with a gain-of-expression in the root cap (Fig. 5C). It is interesting that a similar change in CYCB1;1::uidA expression patterns has been observed in the shoot of rcb. The typically strong expression pattern of wild-type plants in the shoot apical meristem is absent in rcb; instead, a shift to parenchyma cells beneath the developing stomata is observed. It is tempting to speculate that RCB encodes a trans-acting factor that would act both as an activator and a repressor, depending on the interaction with other proteins. The existence of trans-acting factors, which act both positively and negatively on the expression of cell cycle genes, is not unprecedented. In animals, the heterotrimeric transcription factor NFY has been shown to transcriptionally inhibit CycB1, CycB2, and Cdc25 promoters upon DNA damage-induced G2 arrest (Manni et al., 2001Go). In addition to negative regulation, CCAAT-binding transcription factors also mediate positive regulation of cell cycle phase-specific CycB1 expression (Katula et al., 1997Go; Sciortino et al., 2001Go). Together with other transcription factors, NFYs appear to mediate balancing between activation and repression of genes in a tissue-specific manner (Gilthorpe et al., 2002Go).



View larger version (46K):
[in this window]
[in a new window]
 
Figure 5. Model for the putative role of the wild-type RCB and the effects of homozygous and heterozygous rcb mutations. A, RCB activator for CYCB1;1 genes in the root apical meristem and repressor for the same gene in the lateral root cap tissues in wild type. B, In the homozygous rcb mutant, lack of CYCB1;1 expression in the root apical meristem and ectopical induction in the lateral root cap. C, In the heterozygous mutant, induction of intermediate CYCB1;1 expression in the root apical meristem and in the root cap cells.

 


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 RT-PCR
 LITERATURE CITED
 

Plant Material

The transgenic Arabidopsis line CYCB1;1::uidA (Ferreira et al., 1994bGo) was in the genetic background of the C24 ecotype. For in vitro culture, seeds were sterilized and sown on K1 germination media (Valvekens et al., 1988Go) without vitamins. Plants were grown in a growth chamber with continuous light (110 µE m-1 s-1 photosynthetically active radiation supplied by cool-white fluorescent tubes) held at 22°C. Plants were grown on square plates (Greiner Labortechnik, Frickenhausen, Germany) in a vertical position to facilitate the accessibility to the root system. Material was collected at various time points depending on the requirements of each experiment. For phenotypic characterization, seedlings were used 36 h, 4 d, 1 week, or 2 weeks after germination. After 3 weeks of sterile culture, plants were transferred to a mixture of soil and vermiculite (1:3 [w/v]) for self-fertilization under the same growth conditions.


Mutagenesis

The Arabidopsis CYCB1;1::uidA promoter fusion line was chemically mutagenized with ethyl methanesulfonate. Treatment with 0.3% (w/v) ethyl methanesulfonate was performed for 12 h, after which the seeds were extensively washed with water. M1 plants were germinated on K1 medium and transferred to soil after 2 weeks of growth for self-fertilization. M2 progenies were analyzed in a GUS assay-based mutant screening. From each line, 25 seeds were germinated together with wild-type controls. Root cuttings were collected for the GUS assay after 1 week of growth. The lines were screened for alterations in the pattern or intensity of the CYCB1;1::uidA expression. The selected putative mutant lines were self-fertilized, and the M3 plants were subjected to three successive backcrosses with the starter line before phenotypic analysis. Intactness of the CYCB1;1::uidA promoter fusion in the mutants was controlled by sequencing. The promoters from both wild type and rcb were isolated by standard PCR amplification with Pfu (Promega, Madison, WI). Primers were designed to hybridize with the flanking sequences on each side of the actual CYCB1;1 promoter in the CYCB1;1::uidA construct and inside the promoter (5'CGCGATCCAGACTGAATGCCCACAGGCCG with 5'CGTGCCACGCGCTACAGACCACGCCC and 5'GGGCGTGGTCTGTAGCGCGTGGCACG with 5'GCCTGGGGTGCCTAATGAGTGAGAATTGACGG). PCR products were run on 0.9% (w/v) agarose gels, purified with Qiaquick Gel Extraction Kit (Qiagen, Hilden, Germany), and sequenced. Sequences from three replicate samples were compared with the promoter from the mutant starter line in multiple alignments (GCG Wisconsin Package; Accelrys, San Diego, CA).


Genetic Analysis

For mapping of the rcb mutant, an AFLP mapping system was used (Vos et al., 1995Go). Homozygous mutant plants from the M3 population were crossed with the parental line of the wild-type Col-0 ecotype, for which AFLP markers were available. The F1 plants were self-fertilized, and the segregating F2 progenies were screened by GUS assay to select mutant individuals for mapping. AFLP reactions were performed on total genomic DNA isolated from 40 mutant plants, four wild-type individuals, and the two parental lines with the DNeasy protocol (Qiagen). The mutant DNA samples were pooled in bulks of eight and were subjected to digestion with SacI and MseI enzymes, together with the wild-type and parental samples. Pre-amplification reactions were done using SacI and MseI primers without selective nucleotides, and the AFLP fingerprints were generated with two selective nucleotides added to each primer. Adaptors and primers were obtained from Genset (Paris). The SacI primers were 33P-labeled for visualization of the fragments by autoradiography. The AFLP banding patterns from 16 primer combinations were scored for presence or absence of bands representing polymorphic markers between Col-0 and C24 ecotypes. The map position was deduced based on linkage and non-linkage of the markers for the mutation. The chromosomal location of the uidA T-DNA was determined from markers that were present in the mutant pools but absent from the four wild-type individuals. The marker analysis was performed by standard PCR as described by Bell and Ecker (1994Go).


In Situ Hybridization

For in situ hybridization, the plant material was grown according to the method of Corbesier et al. (1996Go). Longitudinal sections of shoot apices from 2-month-old plants were hybridized as described by Segers et al. (1996Go). The CYCB1;1 [35S]UTP-labeled antisense and sense probes were prepared from the linearized pGEMCYC1At vector using SP6 and T7 RNA polymerase, respectively.


Histochemical GUS Assays

For histochemical GUS assays, complete seedlings or root cuttings were stained in multiwell plates (Falcon, Becton-Dickinson, Bedford, MA). GUS assays were performed as described by Beeckman and Engler (1994Go). Samples mounted in Tris-saline buffer or lactic acid were observed and photographed with a stereoscope (Stemi SV11, Zeiss, Jena, Germany) or with differential contrast optics on a standard light microscope (Leica, Wien, Austria).


Microscopy

For anatomical sections, samples from the GUS assays were fixed overnight in 1% (v/v) glutaraldehyde and 4% (w/v) paraformaldehyde in 50 mM phosphate buffer. Samples were dehydrated and embedded in Technovit 7100 resin (Heraeus Kulzer, Wehrheim, Germany) according to the manufacturer's instructions. For proper orientation of the samples, transparent strips were used to facilitate alignment of the tissues (Beeckman and Viane, 2000Go). Sections of 5-µm were cut with a microtome (Minot 1212, Leitz, Wetzlar, Germany), dried on object glasses, counterstained for cell walls with 0.05% (w/v) ruthenium red (Fluka Chemical, Buchs, Switzerland) in tap water for 30 s, mounted in DePex, and covered with coverslips for analysis and photography.


Whole-Plant Analysis, Anatomical Sections, and Microscopy

Plants were grown at 20°C in small pots on soil in the greenhouse under long-day conditions (16 h of light/8 h of darkness) with sodium lamps and at 15°C under short-day conditions (8 h of light/16 h of darkness) conditions with cool-white lights (75-100 µE m-2, Philips, Eindhoven, The Netherlands). Stem samples taken at 1 and 10 cm above the rosette were sectioned manually. Tissues samples were treated 20 min in 50% (v/v) sodium hypochlorite, washed in water for 30 min, fixed for 5 min in acetic acid, stained for 5 min in 0.1% (w/v) toluidine blue, and washed in tap water. Samples were examined through a Wild M3 Microscope (Leica) and photographed under bright field. Data were collected and analyzed with Optimas 6.0 (MediaCybernetics, http://www.optimas.com/optimas.htm).


    RT-PCR
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 RT-PCR
 LITERATURE CITED
 
Endogenous transcript levels of a set of cell cycle regulatory genes were analyzed by semiquantitative RT-PCR as described by Burssens et al. (2000bGo) and Himanen et al. (2002Go). For the cDNA synthesis, total RNA was prepared with RNeasy reagents (Qiagen) from 1-week-old wild-type and rcb seedlings. The cDNA was prepared from three independent RNA samples, and 15, 20, and 25 cycles of PCR were tested to verify the exponential phase of the amplification.


    ACKNOWLEDGMENTS
 
The authors acknowledge Christiane Genetello for the effort in maintaining the mutant lines during the project, Janny Peters and Tom Gerats for help in determining the map position of the RCB locus, Katia Belcram for her technical contribution in the identification and analysis of shoot phenotypes, Nathalie Detry for in situ hybridizations, Rebecca Verbanck for artwork, Jan Zethof for INDEL primers, Meeta Mistry for critical reading of the manuscript, and Martine De Cock for help in preparing it.

Received May 21, 2003; returned for revision June 25, 2003; accepted September 9, 2003.


    FOOTNOTES
 
1 This work was supported by the Interuniversity Poles of Attraction Program (Belgian State, Prime Minister's Office, Federal Office for Scientific, Technical, and Cultural Affairs, grant no. P5/13), by the Academy of Finland (fellowship to K.H.), and by the Finnish Cultural Foundation for fellowships (fellowship to K.H.). Back

2 Present address: Laboratory of Plant Molecular Biology, Rockefeller University, 1230 York Avenue, New York, NY 10021. Back

3 Present address: University of East Anglia, Norwich NR4 7TJ, UK. Back

Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.103.027128.

* Corresponding author; e-mail dirk.inze{at}psb.ugent.be; fax 32-9-3313809.


    LITERATURE CITED
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 RT-PCR
 LITERATURE CITED
 
Amon A, Tyers M, Futcher B, Nasmyth K (1993) Mechanisms that help the yeast cell cycle clock tick: G2 cyclins transcriptionally activate G2 cyclins and repress G1 cyclins. Cell 74: 993-1007[CrossRef][Web of Science][Medline]

Beeckman T, Burssens S, Inzé D (2001) The peri-cell-cycle in Arabidopsis. J Exp Bot 52: 403-411[Abstract/Free Full Text]

Beeckman T, Engler G (1994) An easy technique for the clearing of histochemically stained plant tissue. Plant Mol Biol Rep 12: 37-42

Beeckman T, Viane R (2000) Embedding of thin plant specimens for oriented sectioning. Biotechnol Histochem 75: 23-26

Bell CJ, Ecker JR (1994) Assignment of 30 microsatellite loci to the linkage map of Arabidopsis. Genomics 19: 137-144[CrossRef][Web of Science][Medline]

Brandeis M, Rosewell I, Carrington M, Crompton T, Jacobs MA, Kirk J, Gannon J, Hunt T (1998) Cyclin B2-null mice develop normally and are fertile whereas cyclin B1-null mice die in utero. Proc Natl Acad Sci USA 95: 4344-4349[Abstract/Free Full Text]

Brigham LA, Woo H-H, Wen F, Hawes MC (1998) Meristem-specific suppression of mitosis and a global switch in gene expression in the root cap of pea by endogenous signals. Plant Physiol 118: 1223-1231[Abstract/Free Full Text]

Broadhvest J, Baker SC, Gasser CS (2000) SHORT INTEGUMENTS 2 promotes growth during Arabidopsis reproductive development. Genetics 155: 899-907[Abstract/Free Full Text]

Burssens S, de Almeida Engler J, Beeckman T, Richard C, Shaul O, Ferreira P, Van Montagu M, Inzé D (2000a) Developmental expression of the Arabidopsis thaliana CycA2;1 gene. Planta 211: 623-631[CrossRef][Web of Science][Medline]

Burssens S, Himanen K, van de Cotte B, Beeckman T, Van Montagu M, Inzé D, Verbruggen N (2000b) Expression of cell cycle regulatory genes and morphological alterations in response to salt stress in Arabidopsis thaliana. Planta 211: 632-640[CrossRef][Web of Science][Medline]

Colón-Carmona A, You R, Haimovitch-Gal T, Doerner P (1999) Spatiotemporal analysis of mitotic activity with a labile cyclin-GUS fusion protein. Plant J 20: 503-508[CrossRef][Web of Science][Medline]

Corbesier L, Gadisseur I, Silvestre G, Jacqmard A, Bernier G (1996) Design in Arabidopsis thaliana of a synchronous system of floral induction by one long day. Plant J 9: 947-952[CrossRef][Web of Science][Medline]

Criqui MC, Parmentier Y, Derevier A, Shen W-H, Dong A, Genschik P (2000) Cell cycle-dependent proteolysis and ectopic overexpression of cyclin B1 in tobacco BY2 cells. Plant J 24: 763-773[CrossRef][Web of Science][Medline]

Criqui MC, Weingartner M, Capron A, Parmentier Y, Shen W-H, Heberle- Bors E, Bögre L, Genschik P (2001) Sub-cellular localisation of GFP-tagged tobacco mitotic cyclins during the cell cycle and after spindle checkpoint activation. Plant J 28: 569-581[CrossRef][Web of Science][Medline]

de Almeida Engler J, De Vleesschauwer V, Burssens S, Celenza JL Jr, Inzé D, Van Montagu M, Engler G, Gheysen G (1999) Molecular markers and cell cycle inhibitors show the importance of cell cycle progression in nematode-induced galls and syncytia. Plant Cell 11: 793-808[Abstract/Free Full Text]

Doerner P, Jørgensen J-E, You R, Steppuhn J, Lamb C (1996) Control of root growth and development by cyclin expression. Nature 380: 520-523[CrossRef][Medline]

Donnelly PM, Bonetta D, Tsukaya H, Dengler RE, Dengler NG (1999) Cell cycling and cell enlargement in developing leaves of Arabidopsis. Dev Biol 215: 407-419[CrossRef][Web of Science][Medline]

Ferreira P, Hemerly A, de Almeida Engler J, Bergounioux C, Burssens S, Van Montagu M, Engler G, Inzé D (1994a) Three discrete classes of Arabidopsis cyclins are expressed during different intervals of the cell cycle. Proc Natl Acad Sci USA 91: 11313-11317[Abstract/Free Full Text]

Ferreira PCG, Hemerly AS, de Almeida Engler J, Van Montagu M, Engler G, Inzé D (1994b) Developmental expression of the Arabidopsis cyclin gene cyc1At. Plant Cell 6: 1763-1774[Abstract/Free Full Text]

Fuerst R, Soni R, Murray J, Lindsey K (1996) Modulation of cyclin transcript levels in cultured cells of Arabidopsis thaliana. Plant Physiol 112: 1023-1233[Abstract]

Gaudin V, Lunness PA, Fobert PR, Towers M, Riou-Khamlichi C, Murray JAH, Coen E, Doonan J (2000) The expression of D-cyclin genes defines distinct developmental zones in snapdragon apical meristems and is locally regulated by the cycloidea gene. Plant Physiol 122: 1137-1148[Abstract/Free Full Text]

Gilthorpe J, Vandromme M, Brend T, Gutman A, Summerbell D, Totty N, Rigby PWJ (2002) Spatially specific expression of Hoxb4 is dependent on the ubiquitous transcription factor NFY. Development 129: 3887-3899

Hawes M, Brigham L, Wen F, Woo H, Zhu Y (1998) Function of root border cells in plant health: pioneers in the rhizosphere. Annu Rev Phytopathol 36: 311-327[CrossRef][Web of Science][Medline]

Himanen K, Boucheron E, Vanneste S, de Almeida Engler J, Inzé D, Beeckman T (2002) Auxin-mediated cell cycle activation during early lateral root initiation. Plant Cell 14: 2339-2351[Abstract/Free Full Text]

Ito M, Araki S, Matsunaga S, Itoh T, Nishihama R, Machida Y, Doonan JH, Watanabe A (2001) G2/M-phase-specific transcription during the plant cell cycle is mediated by c-Myb-like transcription factors. Plant Cell 13: 1891-1905[Abstract/Free Full Text]

Ito M, Iwase M, Kodama H, Lavisse P, Komamine A, Nishihama R, Machida Y, Watanabe A (1998) A novel cis-acting element in promoters of plant B-type cyclin genes activates M phase-specific transcription. Plant Cell 10: 331-341[Abstract/Free Full Text]

Joubès J, Chevalier C, Dudits D, Heberle-Bors E, Inzé D, Umeda M, Renaudin J-P (2000) CDK-related protein kinases in plants. Plant Mol Biol 43: 607-620[CrossRef][Web of Science][Medline]

Katula KS, Wright KL, Paul H, Surman DR, Nuckolls FJ, Smith JW, Ting JP, Yates J, Cogswell JP (1997) Cyclin-dependent kinase activation and S-phase induction of the B1 cyclin gene are linked through the CCAAT elements. Cell Growth Diff 8: 811-820[Abstract]

Liu J-q, Seul U, Thompson R (1997) Cloning and characterization of a pollen-specific cDNA encoding a glutamic-acid-rich protein (GARP) from potato Solanum berthaultii. Plant Mol Biol 33: 291-300[CrossRef][Web of Science][Medline]

Manni I, Mazzaro G, Gurtner A, Mantovani R, Haugwitz U, Krause K, Engeland K, Sacchi A, Soddu S, Piaggio G (2001) NF-Y mediates the transcriptional inhibition of the cyclin B1, cyclin B2 and cdc25C promoters upon induced G2 arrest. J Biol Chem 276: 5570-5576[Abstract/Free Full Text]

Menges M, Murray JAH (2002) Synchronous Arabidopsis suspension cultures for analysis of cell-cycle gene activity. Plant J 20: 203-212

Mews M, Sek FJ, Moore R, Volkmann D, Gunning BES, John PCL (1997) Mitotic cyclin distribution during maize cell division: implications for the sequence diversity and function of cyclins in plants. Protoplasma 200: 128-145[CrossRef]

Mews M, Sek FJ, Volkmann D, John PCL (2000) Immunodetection of four mitotic cyclins and the Cdc2a protein kinase in the maize root: their distribution in cell development and dedifferentiation. Protoplasma 212: 236-249[CrossRef]

Mironov V, De Veylder L, Van Montagu M, Inzé D (1999) Cyclin-dependent kinases and cell division in higher plants: the nexus. Plant Cell 11: 509-521[Free Full Text]

Murray AW, Kirschner MW (1989) Cyclin synthesis drives the early embryonic cell cycle. Nature 339: 275-280[CrossRef][Medline]

Nurse P (1990) Universal control mechanism regulating onset of M-phase. Nature 344: 503-508[CrossRef][Medline]

Peters JL, Constandt H, Neyt P, Cnops G, Zethof J, Zabeau M, Gerats T (2001) A physical amplified-fragment length polymorphism map of Arabidopsis. Plant Physiol 127: 1579-1589[Abstract/Free Full Text]

Planchais S, Perennes C, Glab N, Mironov V, Inzé D, Bergounioux C (2002) Characterisation of cis-acting element involved in cell cycle phase-independent activation of Arath;CycB1;1 transcription and identification of putative regulatory proteins. Plant Mol Biol 50: 109-125[CrossRef]

Porceddu A, Stals H, Reichheld J-P, Segers G, De Veylder L, De Pinho Barrôco R, Casteels P, Van Montagu M, Inzé D, Mironov V (2001) A plant-specific cyclin-dependent kinase is involved in the control of G2/M progression in plants. J Biol Chem 276: 36354-36360[Abstract/Free Full Text]

Richard C, Lescot M, Inzé D, De Veylder L (2002) Effect of auxin, cytokinin, and sucrose on cell cycle gene expression in Arabidopsis thaliana cell suspension cultures. Plant Tissue Organ Cult 69: 167-176[CrossRef]

Sabatini S, Beis D, Wolkenfelt H, Murfett J, Guilfoyle T, Malamy J, Benfey P, Leyser O, Bechtold N, Weisbeek P et al. (1999) An auxin-dependent distal organizer of pattern and polarity in the Arabidopsis root. Cell 99: 463-472[CrossRef][Web of Science][Medline]

Sciortino S, Gurtner A, Manni I, Fontemaggi G, Dey A, Sacchi A, Ozato K, Piaggio G (2001) The cyclin B1 gene is actively transcribed during mitosis in HeLa cells. EMBO Rep 2: 1018-1023[CrossRef][Web of Science][Medline]

Segal M, Clarke DJ, Reed SI (1998) Clb5-associated kinase activity is required early in the spindle pathway for correct preanaphase nuclear positioning in Saccharomyces cerevisiae. J Cell Biol 143: 135-145[Abstract/Free Full Text]

Segers G, Gadisseur I, Bergounioux C, de Almeida Engler J, Jacqmard A, Van Montagu M, Inzé D (1996) The Arabidopsis cyclin-dependent kinase gene cdc2bAt is preferentially expressed during S and G2 phases of the cell cycle. Plant J 10: 601-612[CrossRef][Web of Science][Medline]

Serna L, Fenoll C (1997) Tracing the ontogeny of stomatal clusters in Arabidopsis with molecular markers. Plant J 12: 747-755[CrossRef][Web of Science][Medline]

Shaul O, Mironov V, Burssens S, Van Montagu M, Inzé D (1996) Two Arabidopsis cyclin promoters mediate distinctive transcriptional oscillation in synchronized tobacco BY-2 cells. Proc Natl Acad Sci USA 93: 4868-4872[Abstract/Free Full Text]

Soni R, Carmichael J, Shah Z, Murray J (1995) A family of cyclin D homologs from plants differentially controlled by growth regulators and containing the conserved retinoblastoma protein interaction motif. Plant Cell 7: 85-103[Abstract]

Stals H, Inzé D (2001) When plant cells decide to divide. Trends Plant Sci 6: 359-364[CrossRef][Web of Science][Medline]

Tanimoto EY, Rost TL, Comai L (1993) DNA replication-dependent histone H2A mRNA expression in pea root tips. Plant Physiol 103: 1291-1297[Abstract]

Thomas JH (1993) Thinking about genetic redundancy. Trends Genet 9: 395-398[CrossRef][Web of Science][Medline]

Tjandra H, Compton J, Kellogg D (1998) Control of mitotic events by the Cdc42 GTPase, the Clb2 cyclin and a member of the PAK kinase family. Curr Biol 8: 991-1000[CrossRef][Web of Science][Medline]

Tréhin C, Glab N, Perennes C, Planchais S, Bergounioux C (1999) M phase-specific activation of the Nicotiana sylvestris Cyclin B1 promoter involves multiple regulatory elements. Plant J 17: 263-273[CrossRef]

Valvekens D, Van Montagu M, Van Lijsebettens M (1988) Agrobacterium tumefaciens-mediated transformation of Arabidopsis thaliana root explants by using kanamycin selection. Proc Natl Acad Sci USA 85: 5536-5540[Abstract/Free Full Text]

Vandepoele K, Raes J, De Veylder L, Rouzé P, Rombauts S, Inzé D (2002) Genome-wide analysis of core cell cycle genes in Arabidopsis. Plant Cell 14: 903-916[Abstract/Free Full Text]

Vos P, Hogers R, Bleeker M, Reijans M, van de Lee T, Hornes M, Frijters A, Pot J, Peleman J, Kuiper M et al. (1995) AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res 23: 4407-4414[Abstract/Free Full Text]

Woo H-H, Hawes MC (1997) Cloning of genes whose expression is correlated with mitosis and localized in dividing cells in root caps of Pisum sativum L. Plant Mol Biol 35: 1045-1051[CrossRef][Medline]




This article has been cited by other articles:


Home page
J Exp BotHome page
K. Petroni, G. Falasca, V. Calvenzani, D. Allegra, C. Stolfi, L. Fabrizi, M. M. Altamura, and C. Tonelli
The AtMYB11 gene from Arabidopsis is expressed in meristematic cells and modulates growth in planta and organogenesis in vitro
J. Exp. Bot., April 1, 2008; 59(6): 1201 - 1213.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via ISI Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Himanen, K.
Right arrow Articles by Inzé, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Himanen, K.
Right arrow Articles by Inzé, D.
Agricola
Right arrow Articles by Himanen, K.
Right arrow Articles by Inzé, D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY® THE PLANT CELL
Copyright © 2003 by the American Society of Plant Biologists