|
|
||||||||
|
First published online January 22, 2004; 10.1104/pp.103.031518 Plant Physiology 134:595-604 (2004) © 2004 American Society of Plant Biologists Plant and Bacterial Symbiotic Mutants Define Three Transcriptionally Distinct Stages in the Development of the Medicago truncatula/Sinorhizobium meliloti Symbiosis1Department of Biological Sciences, Stanford University, Stanford, California 94305
In the Medicago truncatula/Sinorhizobium meliloti symbiosis, the plant undergoes a series of developmental changes simultaneously, creating a root nodule and allowing bacterial entry and differentiation. Our studies of plant genes reveal novel transcriptional regulation during the establishment of the symbiosis and identify molecular markers that distinguish classes of plant and bacterial symbiotic mutants. We have identified three symbiotically regulated plant genes encoding a ,13 endoglucanase (MtBGLU1), a lectin (MtLEC4), and a cysteine-containing protein (MtN31). MtBGLU1 is down-regulated in the plant 24 h after exposure to the bacterial signal, Nod factor. The non-nodulating plant mutant dmi1 is defective in the ability to down-regulate MtBGLU1. MtLEC4 and MtN31 are induced 1 and 2 weeks after bacterial inoculation, respectively. We examined the regulation of these two genes and three previously identified genes (MtCAM1, ENOD2, and MtLB1) in plant symbiotic mutants and wild-type plants inoculated with bacterial symbiotic mutants. Plant (bit1, rit1, and Mtsym1) and bacterial (exoA and exoH) mutants with defects in the initial stages of invasion are unable to induce MtLEC4, MtN31, MtCAM1, ENOD2, and MtLB1. Bacterial mutants (fixJ and nifD) and a subset of plant mutants (dnf2, dnf3, dnf4, dnf6, and dnf7) defective for nitrogen fixation induce the above genes. The bacA bacterial mutant, which senesces upon deposition into plant cells, and two plant mutants with defects in nitrogen fixation (dnf1 and dnf5) induce MtLEC4 and ENOD2 but not MtN31, MtCAM1, or MtLB1. These data suggest the presence of at least three transcriptionally distinct developmental stages during invasion of M. truncatula by S. meliloti.
The two partners in the legume-Rhizobium symbiosis navigate a complex developmental pathway, resulting in the formation of a plant-derived root nodule in which bacteria reside and reduce molecular nitrogen for use by the plant. Nodulation initiates with chemical signaling between the plant and the bacteria; the plant secretes flavonoid molecules into the rhizosphere, and the bacteria respond with lipochitooligosaccharide signaling molecules termed Nod factors (Long, 1996
Bacterial mutants have revealed distinct developmental signals and stages in the progression of the symbiosis. Bacterial mutants that cannot provoke the cell divisions necessary for nodule formation (Nod) have defects in the genes required for Nod factor synthesis (Spaink, 2000
Four broad classes of plant symbiotic mutants have been identified: mutants that cannot make nodules (Nod), mutants with defects in infection, mutants that make nodules that cannot fix nitrogen (Fix), and mutants that make an excessive number of nodules (supernodulator; Bénaben et al., 1995
The characterization of symbiotically required and regulated genes provides insight into the molecular events in the symbiosis. In some cases, plant genes responsible for symbiotic defects have been shown to be symbiotically regulated (Schauser et al., 1999
We have studied symbiotically regulated genes to gain clues about the initial physiological events of the plant in the establishment of the symbiosis and to distinguish Fix plant mutants that appeared phenotypically indistinguishable. We report the identification of one gene suppressed early in the symbiosis, encoding a
Identification of Three Symbiotically Regulated M. truncatula Genes
We used two approaches to identify plant genes that are differentially regulated in the symbiosis and, thus, act as markers for distinct developmental stages. First, we used subtractive hybridization (Diatchenko et al., 1999
Second, we employed a bioinformatics approach, taking advantage of the publicly available M. truncatula EST database to identify induced genes (see "Materials and Methods"). At The Institute of Genomic Research, M. truncatula ESTs are compiled into longer tentative consensus sequences (TCs) based on regions of overlap (Quackenbush et al., 2001
The bacterial signaling molecule, Nod factor, elicits many nodulation responses in M. truncatula including the modulation of gene expression (Journet et al., 1994 To determine whether Nod factor was sufficient to down-regulate MtBGLU1 expression, we treated plants with 100 pM Nod factor (Fig. 2). Expression of MtBGLU1 was suppressed at both 24 (2.5- ± 1.0-fold) and 48 (2.1- ± 0.6-fold) h posttreatment. Under these conditions, RIP1 was induced 2.2- ± 0.9-fold at 24 h and 2.5- ± 0.5-fold at 48 h postinoculation. These results suggest that Nod factor is the bacterial signal that triggers suppression of MtBGLU1.
To further validate the importance of Nod factor for suppression of MtBGLU1, we tested the expression of this gene in a plant mutant defective in Nod factor signaling. The dmi1 mutant responds to Nod factor but cannot initiate calcium spiking, gene expression, or nodule morphogenesis (Catoira et al., 2000
The timing of MtLEC4 and MtN31 expression suggests that they are induced later in the symbiosis, perhaps in response to bacterial invasion or nitrogen fixation. To test this hypothesis, we inoculated wild-type plants with S. meliloti mutants with known defects in infection of alfalfa or nitrogen fixation. Two mutants, exoA (Rm7031) and exoH (DW223), have defects in infection of alfalfa and exopolysaccharide biosynthesis (Finan et al., 1985
Both MtLEC4 and MtN31 showed altered expression in aberrant nodules formed by the bacterial mutants tested. The exoA and exoH mutants failed to induce expression of either MtLEC4 or MtN31 (Fig. 5A). The bacA mutant induced MtLEC4 but not MtN31. Both the fixJ and nifD mutants induced MtLEC4 to normal levels and MtN31 to reduced levels when compared with wild-type bacteria (Fig. 5A). The previously identified nodulins MtCAM1, ENOD2, and MtLB1 also exhibited altered expression in response to bacterial mutants (Fig. 5A). ENOD2 and MtLEC4 show similar expression patterns with no induction by exoA and exoH and induction by bacA, fixJ, and nifD mutants. This result contrasts with previous studies of alfalfa in which ENOD2 expression was induced by bacteria with defects in exopolysaccharide production (Dickstein et al., 1988
Photographs of M. truncatula nodules at the developmental stage used for transcript analysis illustrate the morphology of nodules induced by bacterial mutants (Fig. 5B). Although alfalfa makes large nodule-like structures in response to bacterial mutants with exopolysaccharide defects (Yang et al., 1992
Because the late nodulins distinguish three transcriptionally distinct classes of bacterial mutants, we tested whether they also distinguish classes of plant mutants that appear otherwise phenotypically similar. We examined the expression of these genes in 11 plant mutants with defects in infection or nitrogen fixation. Three infection mutants, rit1, bit1, and Mtsym1, have defects in the ability of the infection thread to penetrate past the outer cortical cells of the plant (Fig. 4; Bénaben et al., 1995 As observed with bacterial infection mutants, the plant mutant bit1, which has defects in early infection, never induced MtLEC4, MtN31, MtCAM1, ENOD2, or MtLB1 (Fig. 6). In most cases, these genes were not induced in Mtsym1 and rit1, although for each mutant in one of four northern blots, weak expression of MtLEC4 (Mtsym1) or MtLEC4 and MtN31 (rit1) was observed. This result may indicate that the mutations responsible for the infection defects are leaky. Two of the Fix plant mutants, dnf1 and dnf5, showed gene expression similar to that observed when wild-type plants were inoculated with bacA bacterial mutant; only MtLEC4 and ENOD2 were induced in these mutants. In contrast, the remaining Fix mutants induced all the genes tested (Fig. 6). These data suggest the presence of at least three distinct transcriptional phases in the symbiosis that can be correlated with phenotypes of both plant and bacterial mutants (Fig. 4).
We report the identification of three genes regulated in the legume-Rhizobium symbiosis and use them in concert with three previously identified nodulins to study plant and bacterial symbiotic mutants.
Although several symbiotically induced plant genes have been identified previously (Cook et al., 1995
Based on homology, MtBGLU1 encodes a
Although our in silico examination of nodulins identified two nodulins, MtLEC4 and MtN31, not all candidates tested showed differential expression. Previous studies validating expression patterns of 91 predicted nodule-enhanced TCs using macroarray hybridizations showed that TCs specified by five or more ESTs were reliably induced in nodules (Fedorova et al., 2002
MtN31 belongs to a large family of nodule-specific CCPs (Fedorova et al., 2002
The developmental blocks defined by five bacterial mutants and 11 plant mutants fell into three classes (Fig. 4). The first class, including bacterial (exoA and exoH) and plant (bit1, rit1, and Mtsym1) mutants defective in infection, was unable to induce any of the nodulins tested, and inoculation resulted in the formation of small bumps on the surface of the root. Previous studies using alfalfa (Dickstein et al., 1988
The second class of bacterial (bacA) and plant (dnf1 and dnf5) mutants, which showed infection of the inner cortex, induced ENOD2 and MtLEC4 and created larger nodule-like structures than those induced by early infection mutants (Fig. 4). MtLEC4 has homology to bark lectins. The role of lectins in the legume-Rhizobium symbiosis has been well studied (Hirsch, 1999 The final class of bacterial (fixJ and nifD) and plant mutants (dnf2, 3, 4, 6, and 7) induced all the genes tested and created large nodule-like structures but still had defects in nitrogen fixation (Fig. 4). Interestingly, fixJ bacterial mutants could not induce MtN31, MtCAM1, and MtLB1 to the same level as was induced by nifD bacterial mutants (Fig. 5A). Both mutants are unable to fix nitrogen, but the FixJ defect is upstream of the NifD defect and may result in transcriptional misregulation of additional bacterial genes. The differential response of the plant to fixJ and nifD mutant bacteria may suggest that the plant monitors bacterial physiology, bacterial development, or the availability of reduced nitrogen closely after bacteroid differentiation. The three classes of infection and fixation mutants may indicate the presence of three discrete checkpoints in the progression of nodulation. It will be interesting to determine what signals mediate these potential checkpoints. Our studies of the transcriptional profile of two groups of genes revealed similar developmental arrests induced in plant mutants and in wild-type plants inoculated with bacterial mutants. The identification of correlated phenotypes suggests a complex interplay between the two partners in which they coordinate symbiotic development. Future studies examining the mechanism of this coordination will be useful in determining whether environmental, physiological, metabolic, or signaling components are important for the development of a successful symbiosis.
Plant Growth Conditions
Medicago truncatula [Gaertn.] cv Jemalong A-17 seeds were scarified using concentrated sulfuric acid for 10 to 15 min, rinsed with sterile water, and sterilized in commercial bleach for 3 min. After rinsing to remove residual bleach, seeds were imbibed in sterile water for 4 to 12 h while shaking and were stored under water at 4°C to be used within a week. Mutant seeds were prepared in the same manner except rit1 seeds, which were scarified for 3 min and sterilized for 3 min in a solution of 20% (v/v) commercial bleach and 0.5% (v/v) Tween 20. Seeds were germinated overnight in inverted petri dishes in the dark and plated on buffered nodulation medium (BNM; pH 6.5; Ehrhardt et al., 1992
Sinorhizobium meliloti strain Rm1021 is a streptomycin-resistant derivative of wild-type field isolate SU47 (Meade et al., 1982
Bacteria were grown in liquid tryptone-yeast extract (Beringer, 1974
RNA was purified with Trizol (Invitrogen, Carlsbad, CA) using the manufacturer's protocol for tissues with high lipid content. Roots were harvested and ground in liquid nitrogen using a mortar and pestle before Trizol addition. If necessary, further homogenization was performed using a Polytron homogenizer (PT 10/35, Brinkman, Westbury, NY). Poly(A+) RNA was purified using the Qiagen Oligotex mRNA Mini kit (Qiagen, Valencia, CA). To verify yield and quality of RNA, samples were subject to spectrophotometric examination (Sambrook et al., 1989
PCR or reverse transcriptase-PCR was used to generate DNA fragments for probing northern blots. Primer pairs and probe lengths used for newly identified genes are: MtBGLU1 (CTTTGATGCCCAATTAGACTCAGTA and TAAAGATTGTCCAACCTCCTAACCT, 449 bp), MtLEC4 (TGAAGTGAAAGACCATGAGTAGATG and CACAGTTATCTTCAACTTTCCCAAG, 675 bp), and MtN31 (ATCAACTTTTTCGAAATCTTACGTG and CCTATTTCATTGAAGTTAACAAAGCA, 505 bp). A 670-bp DNA fragment representing previously published probe sequences was used for pGVN-55I10 (Fedorova et al., 2002
A reciprocal equation was used to calculate fold induction of RIP1. The average fold change and SD of the fold change are calculated for each gene.
Subtractive hybridization was performed on 8 µg of Poly(A+) RNA using the PCR-Select subtractive hybridization kit (CLONTECH, Palo Alto, CA). Plant roots were exposed to buffer or S. meliloti for 6 h. In an attempt to enrich for plant genes induced early in the symbiosis, RNA derived from buffer inoculated roots was subtracted from RNA derived from bacterial inoculated roots.
Excel (Microsoft, Redmond, WA) was used to analyze the M. truncatula Gene Index (MtGI) Release 4.0 (http://www.tigr.org/tdb/mtgi) and identify TCs containing ESTs from Rhizobia-inoculated or nodule libraries. In an attempt to eliminate constitutively expressed genes, TCs that were represented in uninoculated root or leaf libraries were omitted from further analyses. To identify putative Rhizobium-induced genes, the number of ESTs from inoculated or nodule libraries was tallied for each TC. TCs were then sorted based on this factor normalized for library size. Nine genes with interesting homology or with the most extreme nodule-specific representation were examined by northern hybridization. TCs representing these genes were numbered as follows: 28734, 32071, 32103, 35875, 35941, 36232, 39290, 39747, and 39884 and have been renumbered in the current version of MtGI (7.0) as 77713/7714, 85766/85767, 77066, 85309, 86036, 77299, 78239, 77544, and 85172 (TCs that were split into two are indicated by a slash). Four of the renamed TCs (85766/86767, 77066, and 86036) still show inoculation- or nodule-specific representation in MtGI (7.0). In the older version of MtGI (4.0), MtLEC4 and MtN31 were represented by TCs 32103 and 35875, respectively. In the current release of MtGI (7.0), MtBGLU1, MtLEC4, and MtN31are represented by TCs 78899, 77066, and 86036, respectively. DNA for probing northern blots was amplified using reverse transcriptase-PCR on M. truncatula cDNA.
Upon request, all novel materials described in this publication will be made available in a timely manner for noncommercial research purposes, subject to the requisite permission from any third party owners of all or parts of the material. Obtaining any permissions will be the responsibility of the requestor.
We would like to thank Valerie Oke (University of Pittsburgh) for the nifD strain V02746, Harita Veereshlingam and Rebecca Dickstein (University of North Texas, Denton) for providing the plasmid template for the Enod2 probe, and Susan Miller and Carroll Vance (University of Minnesota, St. Paul) for providing pGVN-55I10. Colby Starker generously provided the seed for rit1, bit1, and the dnf mutants and probe for MtLB1. Lucinda Smith (Stanford University, Stanford, CA) produced the seed for the dmi1 mutant. We thank former and current members of the lab, especially Colby Starker (Stanford University, Stanford, CA), Sidney Shaw (Stanford University, Stanford, CA), Giles Oldroyd (John Innes Centre, Norwich, UK), Melicent Peck (Stanford University, Stanford, CA), David Keating (Loyola University Chicago, Maywood, IL) and Robert Fisher (Stanford University, Stanford, CA) for critical reading of the manuscript before publication. Received August 14, 2003; returned for revision August 27, 2003; accepted October 13, 2003.
Article, publication date, and citation information can be found at http://www.plantphysiol.org/cgi/doi/10.1104/pp.103.031518.
1 This work was supported by the Howard Hughes Medical Institute, by the U.S. Department of Energy (grant no. DEFG0390ER20010 to S.R.L.), and by Howard Hughes Medical Institute (Predoctoral Fellowship to R.M.M.). * Corresponding author; e-mail srl{at}stanford.edu; fax 6507258309.
Barnett MJ, Swanson JA, Long SR (1998) Multiple genetic controls on Rhizobium meliloti syrA, a regulator of exopolysaccharide abundance. Genetics 148: 1932 Batut J, Terzaghi B, Ghérardi M, Huguet M, Terzaghi E, Garnerone A, Boistard P, Huguet T (1985) Localization of a symbiotic fix region on Rhizobium meliloti pSym megaplasmid more than 200 kilobases from the nod-nif region. Mol Gen Genet 199: 232239[CrossRef] Bauchrowitz M, Barker D, Truchet G (1996) Lectin genes are expressed throughout root nodule development and during nitrogen-fixation in the Rhizobium-Medicago symbiosis. Plant J 9: 3143 Bauchrowitz MA, Barker DG, Nadaud I, Rouge P, Lescure B (1992) Lectin genes from the legume Medicago truncatula. Plant Mol Biol 19: 10111017[Medline] Bauer W (1981) Infection of legumes by Rhizobia. Annu Rev Plant Physiol Plant Mol Biol 32: 407449[Web of Science] Bénaben V, Duc G, Lefebvre V, Huguet T (1995) TE7, an inefficient symbiotic mutant of Medicago truncatula Gaertn. cv Jemalong. Plant Physiol 107: 5362[Abstract]
Beringer JE (1974) R factor transfer in Rhizobium leguminosarum. J Gen Microbiol 84: 188198 Brill LM, Evans CJ, Hirsch AM (2001) Expression of MsLEC1- and MsLEC2-antisense genes in alfalfa plant lines causes severe embryogenic, developmental and reproductive abnormalities. Plant J 25: 453461[CrossRef][Medline]
Catoira R, Galera C, de Billy F, Penmetsa RV, Journet EP, Maillet F, Rosenberg C, Cook D, Gough C, Dénarié J (2000) Four genes of Medicago truncatula controlling components of a Nod factor transduction pathway. Plant Cell 12: 16471666 Catoira R, Timmers AC, Maillet F, Galera C, Penmetsa RV, Cook D, Dénarié J, Gough C (2001) The HCL gene of Medicago truncatula controls Rhizobium-induced root hair curling. Development 128: 15071518[Abstract]
Cheng HP, Walker GC (1998) Succinoglycan is required for initiation and elongation of infection threads during nodulation of alfalfa by Rhizobium meliloti. J Bacteriol 180: 51835191 Cook D, Dreyer D, Bonnet D, Howell M, Nony E, VandenBosch K (1995) Transient induction of a peroxidase gene in Medicago truncatula precedes infection by Rhizobium meliloti. Plant Cell 7: 4355[Abstract] David M, Daveran ML, Batut J, Dedieu A, Domergue O, Ghai J, Hertig C, Boistard P, Kahn D (1988) Cascade regulation of nif gene expression in Rhizobium meliloti. Cell 54: 671683[CrossRef][Web of Science][Medline] De Carvalho-Niebel F, Lescure N, Cullimore JV, Gamas P (1998) The Medicago truncatula MtANN1 gene encoding an annexin is induced by Nod factors and during the symbiotic interaction with Rhizobium meliloti. Mol Plant-Microbe Interact 11: 504513[Web of Science][Medline] Diatchenko L, Lukyanov S, Lau YF, Siebert PD (1999) Suppression subtractive hybridization: a versatile method for identifying differentially expressed genes. Methods Enzymol 303: 349380[CrossRef][Web of Science][Medline]
Dickstein R, Bisseling T, Reinhold VN, Ausubel FM (1988) Expression of nodule-specific genes in alfalfa root nodules blocked at an early stage of development. Genes Dev 2: 677687 Dickstein R, Scheirer DC, Fowle WH, Ausubel FM (1991) Nodules elicited by Rhizobium meliloti heme mutants are arrested at an early stage of development. Mol Gen Genet 230: 423432[CrossRef][Medline]
Ehrhardt DW, Atkinson EM, Long SR (1992) Depolarization of alfalfa root hair membrane potential by Rhizobium meliloti Nod factors. Science 256: 9981000 Ehrhardt DW, Wais R, Long SR (1996) Calcium spiking in plant root hairs responding to Rhizobium nodulation signals. Cell 85: 673681[CrossRef][Web of Science][Medline]
Etzler ME, Kalsi G, Ewing NN, Roberts NJ, Day RB, Murphy JB (1999) A Nod factor binding lectin with apyrase activity from legume roots. Proc Natl Acad Sci USA 96: 58565861
Fedorova M, Van De Mortel J, Matsumoto PA, Cho J, Town CD, VandenBosch KA, Gantt JS, Vance CP (2002) Genome-wide identification of nodule-specific transcripts in the model legume Medicago truncatula. Plant Physiol 130: 519537 Finan TM, Hirsch AM, Leigh JA, Johansen E, Kuldau GA, Deegan S, Walker GC, Signer ER (1985) Symbiotic mutants of Rhizobium meliloti that uncouple plant from bacterial differentiation. Cell 40: 869877[CrossRef][Medline]
Fisher RF, Egelhoff TT, Mulligan JT, Long SR (1988) Specific binding of proteins from Rhizobium meliloti cell-free extracts containing NodD to DNA sequences upstream of inducible nodulation genes. Genes Dev 2: 282293 Friedrich L, Lawton K, Reuss W, Masner P, Specker N, Gut Rella M, Meier B, Dincher S, Staub T, Uknes S et al. (1996) A benzothiadiazole derivative induces systemic acquired resistance in tobacco. Plant J 10: 6170[CrossRef][Web of Science] Gallusci P, Dedieu A, Journet EP, Huguet T, Barker DG (1991) Synchronous expression of leghaemoglobin genes in Medicago truncatula during nitrogen-fixing root nodule development and response to exogenously supplied nitrate. Plant Mol Biol 17: 335349[CrossRef][Web of Science][Medline] Gamas P, De Carvalho-Niebel F, Lescure N, Cullimore J (1996) Use of a subtractive hybridization approach to identify new Medicago truncatula genes induced during root nodule development. Mol Plant-Microbe Interact 9: 233242[Web of Science][Medline]
Glazebrook J, Ichige A, Walker GC (1993) A Rhizobium meliloti homolog of the Escherichia coli peptide-antibiotic transport protein SbmA is essential for bacteroid development. Genes Dev 7: 14851497 Gonzalez JE, York GM, Walker GC (1996) Rhizobium meliloti exopolysaccharides: synthesis and symbiotic function. Gene 179: 141146[CrossRef][Medline] Hirsch AM (1999) Role of lectins (and rhizobial exopolysaccharides) in legume nodulation. Curr Opin Plant Biol 2: 320326[CrossRef][Web of Science][Medline]
Hirsch AM, Long SR, Bang M, Haskins N, Ausubel FM (1982) Structural studies of alfalfa roots infected with nodulation mutants of Rhizobium meliloti. J Bacteriol 151: 411419
Ichige A, Walker GC (1997) Genetic analysis of the Rhizobium meliloti bacA gene: functional interchangeability with the Escherichia coli sbmA gene and phenotypes of mutants. J Bacteriol 179: 209216 Ji W, Wright MB, Cai L, Flament A, Lindpaintner K (2002) Efficacy of SSH PCR in isolating differentially expressed genes. BioMed Central Genomics 3: 12[CrossRef][Medline] Journet EP, Pichon M, Dedieu A, de Billy F, Truchet G, Barker DG (1994) Rhizobium meliloti Nod factors elicit cell-specific transcription of the ENOD12 gene in transgenic alfalfa. Plant J 6: 241249[CrossRef][Web of Science][Medline]
Journet EP, van Tuinen D, Gouzy J, Crespeau H, Carreau V, Farmer MJ, Niebel A, Schiex T, Jaillon O, Chatagnier O et al. (2002) Exploring root symbiotic programs in the model legume Medicago truncatula using EST analysis. Nucleic Acids Res 30: 55795592 Kaijalainen S, Schroda M, Lindstrom K (2002) Cloning of nodule-specific cDNAs of Galega orientalis. Physiol Plant 114: 588593[CrossRef][Medline]
Kalsi G, Etzler ME (2000) Localization of a Nod factor-binding protein in legume roots and factors influencing its distribution and expression. Plant Physiol 124: 10391048 Kardailsky IV, Sherrier DJ, Brewin NJ (1996) Identification of a new pea gene, PsNlec1, encoding a lectin-like glycoprotein isolated from the symbiosomes of root nodules. Plant Physiol 111: 4960[Abstract] Krusell L, Madsen LH, Sato S, Aubert G, Genua A, Szczyglowski K, Duc G, Kaneko T, Tabata S, de Bruijn F et al. (2002) Shoot control of root development and nodulation is mediated by a receptor-like kinase. Nature 420: 422426[CrossRef][Medline] Leigh JA, Reed JW, Hanks JF, Hirsch AM, Walker GC (1987) Rhizobium meliloti mutants that fail to succinylate their calcofluor-binding exopolysaccharide are defective in nodule invasion. Cell 51: 579587[CrossRef][Web of Science][Medline]
Leigh JA, Signer ER, Walker GC (1985) Exopolysaccharide-deficient mutants of Rhizobium meliloti that form ineffective nodules. Proc Natl Acad Sci USA 82: 62316235 Long SR (1996) Rhizobium symbiosis: nod factors in perspective. Plant Cell 8: 18851898[CrossRef][Web of Science][Medline]
Meade HM, Long SR, Ruvkun GB, Brown SE, Ausubel FM (1982) Physical and genetic characterization of symbiotic and auxotrophic mutants of Rhizobium meliloti induced by transposon Tn5 mutagenesis. J Bacteriol 149: 114122
Mergaert P, Nikovics K, Kelemen Z, Maunoury N, Vaubert D, Kondorosi A, Kondorosi E (2003) A novel family in Medicago truncatula consisting of more than 300 nodule-specific genes coding for small, secreted polypeptides with conserved cysteine motifs. Plant Physiol 132: 161173 Niehaus K, Lagares A, Puhler A (1998) A Sinorhizobium meliloti lipopolysaccharide mutant induces effective nodules on the host plant Medicago sativa (alfalfa) but fails to establish a symbiosis with Medicago truncatula. Mol Plant-Microbe Interact 11: 906914[CrossRef][Web of Science] Nishimura R, Hayashi M, Wu GJ, Kouchi H, Imaizumi-Anraku H, Murakami Y, Kawasaki S, Akao S, Ohmori M, Nagasawa M et al. (2002) HAR1 mediates systemic regulation of symbiotic organ development. Nature 420: 426429[CrossRef][Medline] Oke V, Long SR (1999a) Bacterial genes induced within the nodule during the Rhizobium-legume symbiosis. Mol Microbiol 32: 837849[CrossRef][Web of Science][Medline] Oke V, Long SR (1999b) Bacteroid formation in the Rhizobium-legume symbiosis. Curr Opin Microbiol 2: 641646[CrossRef][Web of Science][Medline]
Oldroyd GE, Engstrom EM, Long SR (2001) Ethylene inhibits the Nod factor signal transduction pathway of Medicago truncatula. Plant Cell 13: 18351849
Penmetsa RV, Cook DR (1997) A legume ethylene-insensitive mutant hyperinfected by its rhizobial symbiont. Science 275: 527530
Penmetsa RV, Frugoli JA, Smith LS, Long SR, Cook DR (2003) Dual genetic pathways controlling nodule number in Medicago truncatula. Plant Physiol 131: 9981008
Quackenbush J, Cho J, Lee D, Liang F, Holt I, Karamycheva S, Parvizi B, Pertea G, Sultana R, White J (2001) The TIGR Gene Indices: analysis of gene transcript sequences in highly sampled eukaryotic species. Nucleic Acids Res 29: 159164 Ramu SK, Peng HM, Cook DR (2002) Nod factor induction of reactive oxygen species production is correlated with expression of the early nodulin gene RIP1 in Medicago truncatula. Mol Plant-Microbe Interact 15: 522528[Web of Science][Medline] Reuber TL, Walker GC (1993) Biosynthesis of succinoglycan, a symbiotically important exopolysaccharide of Rhizobium meliloti. Cell 74: 269280[CrossRef][Web of Science][Medline] Ruvkun GB, Ausubel FM (1981) A general method for site-directed mutagenesis in prokaryotes. Nature 289: 8588[CrossRef][Medline] Ruvkun GB, Sundaresan V, Ausubel FM (1982) Directed transposon Tn5 mutagenesis and complementation analysis of Rhizobium meliloti symbiotic nitrogen fixation genes. Cell 29: 551559[CrossRef][Medline] Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual, Ed 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Schauser L, Roussis A, Stiller J, Stougaard J (1999) A plant regulator controlling development of symbiotic root nodules. Nature 402: 191195[CrossRef][Medline] Sela-Buurlage MB, Ponstein AS, Bres-Vloemans SA, Melchers LS, Van Den Elzen P, Cornelissen B (1993) Only specific tobacco (Nicotiana tabacum) chitinases and [beta]-1,3-glucanases exhibit antifungal activity. Plant Physiol 101: 857863[Abstract]
Shaw SL, Long SR (2003a) Nod factor elicits two separable calcium responses in Medicago truncatula root hair cells. Plant Physiol 131: 976984
Shaw SL, Long SR (2003b) Nod factor inhibition of reactive oxygen efflux in a host legume. Plant Physiol 132: 21962204 Spaink HP (2000) Root nodulation and infection factors produced by rhizobial bacteria. Annu Rev Microbiol 54: 257288[CrossRef][Web of Science][Medline] Truchet G, Barker DG, Camut S, De Billy F, Vasse J, Huguet T (1989) Alfalfa nodulation in the absence of Rhizobium. Mol Gen Genet 219: 6568[CrossRef] Van Damme EJ, Barre A, Smeets K, Torrekens S, Van Leuven F, Rouge P, Peumans WJ (1995) The bark of Robinia pseudoacacia contains a complex mixture of lectins: characterization of the proteins and the cDNA clones. Plant Physiol 107: 833843[Abstract] Van Damme EJ, Peumans WJ, Barre A, Rouge P (1998) Plant lectins: a composite of several distinct families of structural and evolutionary related proteins with diverse biological roles. Crit Rev Plant Sci 17: 575692[CrossRef] VandenBosch KA, Rodgers LR, Sherrier DJ, Kishinevsky BD (1994) A peanut nodule lectin in infected cells and in vacuoles and the extracellular matrix of nodule parenchyma. Plant Physiol 104: 327337[Abstract]
van Rhijn P, Fujishige NA, Lim PO, Hirsch AM (2001) Sugar-binding activity of pea lectin enhances heterologous infection of transgenic alfalfa plants by Rhizobium leguminosarum biovar viciae. Plant Physiol 126: 133144
Vasse J, de Billy F, Camut S, Truchet G (1990) Correlation between ultra-structural differentiation of bacteroids and nitrogen fixation in alfalfa nodules. J Bacteriol 172: 42954306
Wais RJ, Galera C, Oldroyd G, Catoira R, Penmetsa RV, Cook D, Gough C, Dénarié J, Long SR (2000) Genetic analysis of calcium spiking responses in nodulation mutants of Medicago truncatula. Proc Natl Acad Sci U S A 97: 1340713412
Wais RJ, Keating DH, Long SR (2002) Structure-function analysis of Nod factor-induced root hair calcium spiking in Rhizobium-legume symbiosis. Plant Physiol 129: 211224
Ward E, Payne G, Moyer M, Williams S, Dincher S, Sharkey K, Beck J, Taylor H, Ahlgoy P, Meins F et al. (1991) Differential regulation of beta-1,3-glucanase messenger-RNAs in response to pathogen infection. Plant Physiol 96: 390397 Wells DH, Long SR (2002) The Sinorhizobium meliloti stringent response affects multiple aspects of symbiosis. Mol Microbiol 43: 11151127[CrossRef][Medline]
Yang C, Singer ER, Hirsch AM (1992) Nodules initiated by Rhizobium meliloti exopolysaccharide mutants lack a discrete, persistent nodule meristem. Plant Physiol 98: 143151 This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|