Plant Physiol. Illumina
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online January 22, 2004; 10.1104/pp.103.031518

Plant Physiology 134:595-604 (2004)
© 2004 American Society of Plant Biologists

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
134/2/595    most recent
pp.103.031518v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (27)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mitra, R. M.
Right arrow Articles by Long, S. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mitra, R. M.
Right arrow Articles by Long, S. R.
Agricola
Right arrow Articles by Mitra, R. M.
Right arrow Articles by Long, S. R.
PLANTS INTERACTING WITH OTHER ORGANISMS

Plant and Bacterial Symbiotic Mutants Define Three Transcriptionally Distinct Stages in the Development of the Medicago truncatula/Sinorhizobium meliloti Symbiosis1

Raka Mustaphi Mitra and Sharon Rugel Long*

Department of Biological Sciences, Stanford University, Stanford, California 94305


    ABSTRACT
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
In the Medicago truncatula/Sinorhizobium meliloti symbiosis, the plant undergoes a series of developmental changes simultaneously, creating a root nodule and allowing bacterial entry and differentiation. Our studies of plant genes reveal novel transcriptional regulation during the establishment of the symbiosis and identify molecular markers that distinguish classes of plant and bacterial symbiotic mutants. We have identified three symbiotically regulated plant genes encoding a {beta},1–3 endoglucanase (MtBGLU1), a lectin (MtLEC4), and a cysteine-containing protein (MtN31). MtBGLU1 is down-regulated in the plant 24 h after exposure to the bacterial signal, Nod factor. The non-nodulating plant mutant dmi1 is defective in the ability to down-regulate MtBGLU1. MtLEC4 and MtN31 are induced 1 and 2 weeks after bacterial inoculation, respectively. We examined the regulation of these two genes and three previously identified genes (MtCAM1, ENOD2, and MtLB1) in plant symbiotic mutants and wild-type plants inoculated with bacterial symbiotic mutants. Plant (bit1, rit1, and Mtsym1) and bacterial (exoA and exoH) mutants with defects in the initial stages of invasion are unable to induce MtLEC4, MtN31, MtCAM1, ENOD2, and MtLB1. Bacterial mutants (fixJ and nifD) and a subset of plant mutants (dnf2, dnf3, dnf4, dnf6, and dnf7) defective for nitrogen fixation induce the above genes. The bacA bacterial mutant, which senesces upon deposition into plant cells, and two plant mutants with defects in nitrogen fixation (dnf1 and dnf5) induce MtLEC4 and ENOD2 but not MtN31, MtCAM1, or MtLB1. These data suggest the presence of at least three transcriptionally distinct developmental stages during invasion of M. truncatula by S. meliloti.


The two partners in the legume-Rhizobium symbiosis navigate a complex developmental pathway, resulting in the formation of a plant-derived root nodule in which bacteria reside and reduce molecular nitrogen for use by the plant. Nodulation initiates with chemical signaling between the plant and the bacteria; the plant secretes flavonoid molecules into the rhizosphere, and the bacteria respond with lipochitooligosaccharide signaling molecules termed Nod factors (Long, 1996Go). The plant responds to bacterial Nod factors by initiating cortical cell divisions to build the nodule. Rhizobia enter the plant through a tubular plant-derived structure constructed in the root hair termed the infection thread (Bauer, 1981Go). Once the infection thread reaches the inner cortical cells of the plant, the bacteria are released into the plant cell, encapsulated in plant membranes. Within these symbiosomes, the bacteria differentiate into bacteroids that in the presence of low oxygen tension express the proteins necessary to reduce molecular nitrogen into ammonia for transport to the plant (Oke and Long, 1999bGo).

Bacterial mutants have revealed distinct developmental signals and stages in the progression of the symbiosis. Bacterial mutants that cannot provoke the cell divisions necessary for nodule formation (Nod) have defects in the genes required for Nod factor synthesis (Spaink, 2000Go). Bacterial mutants with defects in cell surface polysaccharides are unable to successfully infect the plant (Gonzalez et al., 1996Go). The bacA bacterial mutant, which has a defect in a putative peptide antibiotic transporter and compromised membrane integrity, senesces upon deposition into plant cells, suggesting an environmental change from infection thread to symbiosome (Glazebrook et al., 1993Go; Ichige and Walker, 1997Go). In addition, bacterial mutants that can successfully invade the plant, begin bacteroid development, but cannot fix nitrogen have defects in the signaling or enzymatic components necessary for the reduction of molecular nitrogen into ammonia (Ruvkun et al., 1982Go; David et al., 1988Go).

Four broad classes of plant symbiotic mutants have been identified: mutants that cannot make nodules (Nod), mutants with defects in infection, mutants that make nodules that cannot fix nitrogen (Fix), and mutants that make an excessive number of nodules (supernodulator; Bénaben et al., 1995Go; Penmetsa and Cook, 1997Go; Catoira et al., 2000Go, 2001Go; Penmetsa et al., 2003Go; C.C. Starker, L. Smith, G.E.D. Oldroyd, J. Doll, and S.R. Long, unpublished data). The Nod mutants of Medicago truncatula have been characterized for cell signaling responses, cell growth, and transcriptional responses to bacterial signals. For example, the Nod plant mutant dmi1 perceives Nod factor, showing a calcium flux and root hair swelling, but is unable to mount a calcium spiking response or initiate the expression of genes normally induced in the symbiosis (Catoira et al., 2000Go; Wais et al., 2000Go; Shaw and Long, 2003aGo). In contrast to the Nod mutants, few infection or Fix mutants of M. truncatula have been characterized. The Mtsym1 mutant forms two classes of nodules when infected with Sinorhizobium meliloti: small, round nodules in which the infection aborts in the outer cortical cells of the root and elongated nodules in which bacteria are released but are unable to differentiate into nitrogen fixing bacteroids (Bénaben et al., 1995Go). The ratio of nodule classes is dependent on the bacterial strain with which the plants are inoculated; 70% of the nodules induced by Rm2011 versus 30% of those induced by CC169 are small and round. A recent genetic screen in M. truncatula has identified two new infection mutants and a panel of seven Fix mutants (C.G. Starker, L. Smith, G.E.D. Oldroyd, J. Dal, and S.L. Long, unpublished data). When inoculated, the mutants with infection defects, rit1 and bit1, induce small bumps on the root surface and infection threads that abort in the epidermis or outer cortex of the root. Unlike the infection mutants, the Fix mutants (dnf [defective in nitrogen fixation] mutants) form infection threads that proceed through the cortical cells and produce limited nodule-like structures. Based on light microscopy, the infection threads of these Fix mutants are indistinguishable from those of wild-type plants. Although broad categories of infection and fixation mutants have been established, in general, the nature of the mutations responsible for the defects is unclear.

The characterization of symbiotically required and regulated genes provides insight into the molecular events in the symbiosis. In some cases, plant genes responsible for symbiotic defects have been shown to be symbiotically regulated (Schauser et al., 1999Go; Krusell et al., 2002Go; Nishimura et al., 2002Go). In M. truncatula, several genes induced during nodulation, termed "nodulins" or "enods" (early nodulins), have been identified. RIP1 encodes a peroxidase that is induced preceding infection of the plant (Cook et al., 1995Go) and may have a role in protection of the plant from oxidative damage (Ramu et al., 2002Go). ENOD2, an early nodulin, is induced during infection (Dickstein et al., 1988Go) and has been successfully used as a marker for nodule organogenesis. Leghemoglobin, a protein that is necessary to maintain low oxygen levels within the nodule, is induced in mature nodules (Gallusci et al., 1991Go). More recently, with the accumulation of M. truncatula expressed sequence tags (ESTs), bioinformatics approaches have allowed for screening of regulated genes based on expression levels in different libraries (Fedorova et al., 2002Go; Journet et al., 2002Go) and the identification of novel nodulins, such as a nodule-specific calmodulin-like protein. To date, genes that are suppressed early in the symbiosis have not been described.

We have studied symbiotically regulated genes to gain clues about the initial physiological events of the plant in the establishment of the symbiosis and to distinguish Fix plant mutants that appeared phenotypically indistinguishable. We report the identification of one gene suppressed early in the symbiosis, encoding a {beta}, 1–3 endoglucanase, and two genes induced later in the symbiosis: a lectin and a novel gene. Using the expression of these two genes and three previously identified nodulins, we were able to distinguish between infection and fixation mutants of both the plant and bacteria, defining three transcriptionally distinct developmental stages in the symbiosis.


    RESULTS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Identification of Three Symbiotically Regulated M. truncatula Genes

We used two approaches to identify plant genes that are differentially regulated in the symbiosis and, thus, act as markers for distinct developmental stages. First, we used subtractive hybridization (Diatchenko et al., 1999Go) in an attempt to produce a library enriched for symbiotically induced plant genes (see "Materials and Methods"). This screen did not yield any reliably up-regulated genes; however, northern-blot analysis of 45 library clones identified a clone (no. 108) that was weakly suppressed 24 to 48 h after plants were flood inoculated with S. meliloti (Fig. 1A). Although subtracted libraries enrich for differentially regulated genes, factors such as transcript abundance result in the representation of randomly amplified genes in the library (Ji et al., 2002Go). Clone 108 was suppressed 2.9- ± 1.1-fold at 24 h and 3.2- ± 1.2-fold at 48 h postinoculation with S. meliloti (n >= 5, Fig. 1A). Under the same conditions, the positive control RIP1 was induced 4.5- ± 2.7-fold at 24 h and 6.4- ± 2.6-fold at 48 h postinoculation (n >= 4, Fig. 1A). We used the BLASTX algorithm to determine homology of newly identified genes to previously described proteins (http://www.ncbi.nlm.nih.gov/BLAST/). The full-length sequence containing the identified clone (TC78899) shows homology to the glucan endo-1,3-{beta}-glucosidases GL153 (E value = e-101) and PR2 (E value = 5e-98) from tobacco (Nicotiana tabacum), which are members of the pathogenesis-related protein 2 (PR2) family of genes. These genes are rapidly induced in leaves upon exposure to pathogens (Ward et al., 1991Go). Based on homology to {beta}-glucosidases, we refer to this gene as MtBGLU1.



View larger version (48K):
[in this window]
[in a new window]
 
Figure 1. Identification of symbiotically regulated M. truncatula genes. a, Clone 108 (MtBGLU1) is suppressed early in the symbiosis. A representative northern blot is shown of RNA from roots exposed to buffer, wild-type S. meliloti (Rm1021), or the SL44 bacterial mutant which is unable to make Nod factor. Plants were harvested 6, 24, or 48 h after inoculation. Experiments were repeated at least four times. Blots were serially probed for clone 108 (top), RIP1 (middle), or Actin (lower). b, Representative northern blots showing induction of TC77066 (MtLEC4), TC86036 (MtN31), MtCAM1, ENOD2, and MtLB1 during nodulation. Plants were harvested 0, 4, 7, 14, or 28 d after inoculation with wild-type S. meliloti. Experiments were repeated three times. The upper blot was serially probed with TC77066 (top), TC86036 (upper middle), MsENOD2 (lower middle), or Actin (lower) probes. The lower blot was serially probed with MtCAM1 (top), MtLB1 (middle), or Actin (lower) probes.

 

Second, we employed a bioinformatics approach, taking advantage of the publicly available M. truncatula EST database to identify induced genes (see "Materials and Methods"). At The Institute of Genomic Research, M. truncatula ESTs are compiled into longer tentative consensus sequences (TCs) based on regions of overlap (Quackenbush et al., 2001Go). By comparing the representation of TCs in libraries from uninoculated and S. meliloti-inoculated roots, we identified nine candidates for further analysis. Using northern blotting to assess transcript abundance, we identified two transcripts strongly expressed in nodules but not roots: TC77066 and TC86036. TC77066 is induced 7 d postinoculation, and TC86036 is induced 2 weeks postinoculation with S. meliloti (Fig. 1B). In addition, we examined the expression of a recently identified nodule specific calmodulin-like protein (herein referred to as MtCAM1, Gen Bank accession no. AF494212; Fedorova et al., 2002Go), which shows induction at 2 weeks postinoculation. Under these conditions, ENOD2 and Leghemoglobin 1 (MtLB1), two previously characterized nodulins, are induced at 1 and 2 weeks postinoculation, respectively. TC77066 encodes a legume-specific lectin with closest homology (E value = 2e-65) to bark lectins of Robinia pseudoacacia (Van Damme et al., 1995Go). Lectins are carbohydrate-binding proteins that have been suggested to have roles in storage of nutrients, defense against pathogen attack, and rhizobial recognition (Van Damme et al., 1998Go). Although TC77066 does not have significant homology with previously identified nodule-specific M. truncatula lectins (Bauchrowitz et al., 1992Go), we refer to it as MtLEC4 using the previously established naming system for M. truncatula. TC86036 has weak homology (E value = 2e-06) to a nodule-specific protein from Galega orientalis (GenBank accession no. CAB51773 Kaijalainen et al., 2002Go) and putatively encodes a Cys-containing protein (CCP) with a conserved signal peptide and nodule-enhanced expression (Fedorova et al., 2002Go; Mergaert et al., 2003Go). We refer to this transcript as MtN31 (M. truncatula nodulin 31) according to previously established nomenclature (Gamas et al., 1996Go). This transcript is synonymous with the gene product designated as NCR 158 (for Nodule-specific Cys-rich protein) by Mergaert et al. (2003Go).


Nod Factor Is Necessary and Sufficient to Suppress the Expression of MtBGLU1

The bacterial signaling molecule, Nod factor, elicits many nodulation responses in M. truncatula including the modulation of gene expression (Journet et al., 1994Go; Cook et al., 1995Go; De Carvalho-Niebel et al., 1998Go). To determine whether the presence of Nod factor is necessary to down-regulate MtBGLU1 expression or whether transcriptional down-regulation is dependent upon another bacterial signal, we inoculated plants with the bacterial mutant SL44, which has a deletion in the nodD1-nodABC region, rendering it unable to synthesize the N-acetyl-glucosamine backbone of Nod factor (Fisher et al., 1988Go). As a consequence, the mutant does not elicit early signaling responses (Wais et al., 2002Go) or induce nodule formation on the plant (S.R. Long., unpublished data). The SL44 bacterial mutant did not suppress the expression of MtBGLU1 (Fig. 1A), indicating the importance of Nod factor for the regulation of this gene.

To determine whether Nod factor was sufficient to down-regulate MtBGLU1 expression, we treated plants with 100 pM Nod factor (Fig. 2). Expression of MtBGLU1 was suppressed at both 24 (2.5- ± 1.0-fold) and 48 (2.1- ± 0.6-fold) h posttreatment. Under these conditions, RIP1 was induced 2.2- ± 0.9-fold at 24 h and 2.5- ± 0.5-fold at 48 h postinoculation. These results suggest that Nod factor is the bacterial signal that triggers suppression of MtBGLU1.



View larger version (97K):
[in this window]
[in a new window]
 
Figure 2. Nod factor is sufficient to down-regulate MtBGLU1. Shown is a representative northern blot of RNA from plants exposed to 100 pM Nod factor or to buffer for 24 or 48 h. Experiments were repeated five times. The same blot was serially probed with an MtBGLU1 (top), RIP1 (middle), or Actin (lower) probe.

 


The Nod Plant Mutant, dmi1, Is Defective for MtBGLU1 Suppression

To further validate the importance of Nod factor for suppression of MtBGLU1, we tested the expression of this gene in a plant mutant defective in Nod factor signaling. The dmi1 mutant responds to Nod factor but cannot initiate calcium spiking, gene expression, or nodule morphogenesis (Catoira et al., 2000Go; Wais et al., 2000Go; Shaw and Long, 2003aGo). In the mutant, MtBGLU1 transcript levels differed from the wild type (1.3- ± 0.8-fold), and RIP1 transcript levels were unchanged (0.7- ± 0.4-fold) 48 h postinoculation (n = 5, Fig. 3). This result suggests that dmi1 is defective in the ability to completely suppress MtBGLU1. Previous studies showed a slight induction of RIP1 in dmi1 mutants indicating possible leakiness of the mutation or an inability to sustain early gene expression changes in the mutant (Catoira et al., 2000Go). Our data are consistent with the theory that down-regulation of MtBGLU1 expression is part of a pathway leading to successful bacterial invasion and nodulation.



View larger version (121K):
[in this window]
[in a new window]
 
Figure 3. dmi1 is defective in the ability to suppress MtBGLU1. Shown is a representative northern blot of RNA from wild-type or dmi1-2 plants exposed to S. meliloti (Rm1021) for 48 h. Experiments were repeated at least three times. The blot was serially hybridized to an MtBGLU1 (top), RIP1 (middle), or Actin (lower) probe.

 


Nodulins Show Altered Expression in Response to Bacterial Mutants with Defects in Alfalfa (Medicago sativa) Infection or Nitrogen Fixation

The timing of MtLEC4 and MtN31 expression suggests that they are induced later in the symbiosis, perhaps in response to bacterial invasion or nitrogen fixation. To test this hypothesis, we inoculated wild-type plants with S. meliloti mutants with known defects in infection of alfalfa or nitrogen fixation. Two mutants, exoA (Rm7031) and exoH (DW223), have defects in infection of alfalfa and exopolysaccharide biosynthesis (Finan et al., 1985Go; Leigh et al., 1985Go, 1987Go). We expect exoA mutants have a similar invasion defect as exoY mutants, which are blocked for the exopolysaccharide biosynthetic step preceding that which requires exoA (Reuber and Walker, 1993Go). exoY and exoH bacterial mutants induce infection threads that abort in the root hair cell (Fig. 4; Cheng and Walker, 1998Go). The bacA bacterial mutant can invade alfalfa, is deposited into plant cells, but senesces before developing into mature bacteroids (Fig. 4; Glazebrook et al., 1993Go). Both fixJ and nifD mutant bacteria, which cannot make nitrogenase, are released into alfalfa cells and can differentiate into elongate bacteroids, but the bacteria typically degenerate and the nodule prematurely senesces (Fig. 4; Ruvkun and Ausubel, 1981Go; Hirsch et al., 1982Go; Ruvkun et al., 1982Go; Batut et al., 1985Go; David et al., 1988Go; Vasse et al., 1990Go).



View larger version (24K):
[in this window]
[in a new window]
 
Figure 4. Model of infection and fixation defects. Bacterial (blue lettering) and plant mutants (black lettering) define distinct developmental blocks in the symbiosis. Bacterial invasion of plants (blue) can be arrested at one of three points: before inner cortical cell penetration (upper), after release into plant cells (upper middle), and after differentiation into bacteroids (lower middle). These phases can be transcriptionally separated using the expression patterns of MtLEC4, ENOD2, MtN31, MtCAM1, and MtLB1.

 

Both MtLEC4 and MtN31 showed altered expression in aberrant nodules formed by the bacterial mutants tested. The exoA and exoH mutants failed to induce expression of either MtLEC4 or MtN31 (Fig. 5A). The bacA mutant induced MtLEC4 but not MtN31. Both the fixJ and nifD mutants induced MtLEC4 to normal levels and MtN31 to reduced levels when compared with wild-type bacteria (Fig. 5A). The previously identified nodulins MtCAM1, ENOD2, and MtLB1 also exhibited altered expression in response to bacterial mutants (Fig. 5A). ENOD2 and MtLEC4 show similar expression patterns with no induction by exoA and exoH and induction by bacA, fixJ, and nifD mutants. This result contrasts with previous studies of alfalfa in which ENOD2 expression was induced by bacteria with defects in exopolysaccharide production (Dickstein et al., 1988Go, 1991Go). MtLB1 and MtCAM1 showed expression patterns similar to MtN31 (Fig. 5A). Both were induced by fixJ and nifD bacteria to reduced levels as compared with the wild type, and neither was induced by any other mutant strains tested. Acetylene reduction of fixJ and nifD mutants showed that all were unable to fix nitrogen, confirming the mutant phenotype of the bacteria throughout nodulation (n > 30 for each mutant; data not shown).



View larger version (86K):
[in this window]
[in a new window]
 
Figure 5. MtLEC4, MtN31, MtCAM1, ENOD2, and MtLB1 exhibit altered expression in response to bacterial mutants. a, Representative northern blots of RNA from M. truncatula plants exposed to bacterial mutants: exoA (Rm7031), exoH (DW223), bacA (VO2119), fixJ (VO2683), and nifD (VO2746) or to wild-type bacteria (Rm1021) for 4 weeks. Experiments were repeated at least three times. The upper blot was serially hybridized to an MtLEC4, MtN31, or actin probe. The lower blot was serially hybridized to an MtCAM1, MsENOD2, Actin, or MtLB1 probe. b, Representative photographs of M. truncatula root sections inoculated with each bacterial mutant. All photographs are at the same magnification. Scale bar = 0.5 mm.

 

Photographs of M. truncatula nodules at the developmental stage used for transcript analysis illustrate the morphology of nodules induced by bacterial mutants (Fig. 5B). Although alfalfa makes large nodule-like structures in response to bacterial mutants with exopolysaccharide defects (Yang et al., 1992Go), we noted that M. truncatula inoculated with exoA or exoH mutants produces bumps that are much smaller than the nodules induced by the other bacterial mutants tested (Fig. 5B). It is not known whether bacterial infection arrests in the same manner in both M. truncatula and alfalfa, nor whether bacA, fixJ, or nifD bacterial mutants exhibit the same infection defects in M. truncatula as in alfalfa. However, if the developmental blocks are similar in both organisms, then these data suggest that the induction of MtLEC4 and ENOD2 in M. truncatula correlates with sustained plant infection, cell divisions, or cell expansion, whereas the initial induction of MtN31, MtCAM1, and MtLB1 correlates with the presence of elongate bacteroids within the plant cells of the nodule (Fig. 4).


Nodulins Show Altered Expression in Plants Mutant for Bacterial Entry or Nitrogen Fixation

Because the late nodulins distinguish three transcriptionally distinct classes of bacterial mutants, we tested whether they also distinguish classes of plant mutants that appear otherwise phenotypically similar. We examined the expression of these genes in 11 plant mutants with defects in infection or nitrogen fixation. Three infection mutants, rit1, bit1, and Mtsym1, have defects in the ability of the infection thread to penetrate past the outer cortical cells of the plant (Fig. 4; Bénaben et al., 1995Go; C.G. Starker, L. Smith, G.E.D. Oldroyd, J. Doll, and S.L. Long, unpublished data). Although Mtsym1 can induce either small or elongate nodules, in our conditions, with the bacterial strain Rm1021, elongate nodules were never observed (data not shown). Seven M. truncatula mutants, dnf1 to dnf7, have defects in nitrogen fixation. Although infection threads in these mutants are indistinguishable from the wild type based on light microscopy, it is unknown whether bacteria can differentiate into bacteroids (Starker et al., unpublished data).

As observed with bacterial infection mutants, the plant mutant bit1, which has defects in early infection, never induced MtLEC4, MtN31, MtCAM1, ENOD2, or MtLB1 (Fig. 6). In most cases, these genes were not induced in Mtsym1 and rit1, although for each mutant in one of four northern blots, weak expression of MtLEC4 (Mtsym1) or MtLEC4 and MtN31 (rit1) was observed. This result may indicate that the mutations responsible for the infection defects are leaky. Two of the Fix plant mutants, dnf1 and dnf5, showed gene expression similar to that observed when wild-type plants were inoculated with bacA bacterial mutant; only MtLEC4 and ENOD2 were induced in these mutants. In contrast, the remaining Fix mutants induced all the genes tested (Fig. 6). These data suggest the presence of at least three distinct transcriptional phases in the symbiosis that can be correlated with phenotypes of both plant and bacterial mutants (Fig. 4).



View larger version (105K):
[in this window]
[in a new window]
 
Figure 6. MtLEC4, MtN31, MtCAM1, ENOD2, and MtLB1 exhibit altered expression in plant mutants. Shown are representative northern blots of RNA from M. truncatula plant mutants exposed to wild-type bacteria (Rm1021) for 4 weeks. Experiments were repeated at least three times. The upper blot was serially hybridized to an MtLEC4, MtN31, MsENOD2, or Actin probe. The lower blot was serially hybridized to an MtCAM1, MtLB1 or Actin probe.

 


    DISCUSSION
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
We report the identification of three genes regulated in the legume-Rhizobium symbiosis and use them in concert with three previously identified nodulins to study plant and bacterial symbiotic mutants.

Although several symbiotically induced plant genes have been identified previously (Cook et al., 1995Go; Gamas et al., 1996Go; De Carvalho-Niebel et al., 1998Go), this study contains the first report, to our knowledge, of a gene, MtBGLU1, which is suppressed early in the symbiosis. Our results suggest that the same signal that induces expression of early nodulins, the bacterial signal Nod factor, is also sufficient to suppress MtBGLU1. This suppression is part of a Nod factor signaling pathway downstream of Nod factor recognition because the Nod factor signaling plant mutant dmi1 is defective in the ability to down-regulate MtBGLU1. This finding adds evidence to the theory that bacterial recognition can trigger suppression of plant pathways (Shaw and Long, 2003bGo), although the mechanism for concurrent induction and suppression is unclear. Perhaps the Nod factor signal transduction machinery can function both in an inhibitory and activating manner toward different promoters. Alternately, a branch point in the transduction of the Nod factor signal may allow the activation of different sets of molecular machines to either induce or suppress genes.

Based on homology, MtBGLU1 encodes a {beta},1–3 endoglucanase with high homology to pathogenesis-induced proteins, GL153 and PR2. Although it is unclear whether these proteins exhibit antifungal activity (Sela-Buurlage et al., 1993Go), they are markers indicating the initiation of a plant defense response to pathogens (Ward et al., 1991Go). Because the PR2 class of genes is induced as part of plant defense to pathogens, the suppression of MtGBLU1 we observe in response to a symbiont may indicate a suppression of plant defenses. Preliminary studies indicate that MtBGLU1 is not induced by a benzothiadiazole derivative (data not shown), which can normally induce plant defense responses in the salycilic acid pathway (Friedrich et al., 1996Go); however, recent work using fungal elicitors provides evidence for the suppression of defenses early in nodulation. Fungal oligosaccharide elicitors trigger a rapid oxidative burst in M. truncatula roots (Shaw and Long, 2003bGo). Nod factor suppresses this oxidative burst in wild-type plants; however, it is unable to do so in the Nod plant mutant nfp. These data suggest a direct link between Nod factor suppression of defenses and induction of nodulation.

Although our in silico examination of nodulins identified two nodulins, MtLEC4 and MtN31, not all candidates tested showed differential expression. Previous studies validating expression patterns of 91 predicted nodule-enhanced TCs using macroarray hybridizations showed that TCs specified by five or more ESTs were reliably induced in nodules (Fedorova et al., 2002Go). Under our conditions, this was not the case. For example, the expression pattern, TC32071, comprised of 32 ESTs from inoculated and nodule libraries and no ESTs from uninoculated root libraries, was validated using macroarrays (Fedorova et al., 2002Go). Using northern blotting, we were unable to confirm differential expression of this TC. The discrepancy in the validation of in silico predictions may be explained by the technique used, differences in the growth conditions, nodulation kinetics, or the bacterial strain used.

MtN31 belongs to a large family of nodule-specific CCPs (Fedorova et al., 2002Go; Mergaert et al., 2003Go). CCP gene family members have only been identified to date in galegoid legumes forming indeterminate nodules (Mergaert et al., 2003Go). These genes are transcriptionally up-regulated in nodules, although the initiation of gene induction can vary between 7 and 13 d after inoculation (Mergaert et al., 2003Go). Previous macroarray hybridization studies of gene expression of 14 CCPs under a series of conditions yielded parallel observations as those we report for MtN31 (Mergaert et al., 2003Go). As observed with MtN31, the 14 CCPs are induced by a bacterial mutant defective in nitrogen fixation (fixG; Mergaert et al., 2003Go). Although induction of the 14 CCPs is greatly reduced in plants inoculated with bacterial mutants defective in exopolysaccharide production (exoB) or with a mutation in bacA, the authors note a limited plant transcriptional response to these mutants (Mergaert et al., 2003Go). We never observed induction of MtN31in response to exoA or bacA bacterial mutants; this difference can be attributed to the sensitivity or fidelity of the assay used.

The developmental blocks defined by five bacterial mutants and 11 plant mutants fell into three classes (Fig. 4). The first class, including bacterial (exoA and exoH) and plant (bit1, rit1, and Mtsym1) mutants defective in infection, was unable to induce any of the nodulins tested, and inoculation resulted in the formation of small bumps on the surface of the root. Previous studies using alfalfa (Dickstein et al., 1988Go) showed that bacterial mutants with defects in exopolysaccharide biosynthesis or nitrogen fixation could induce ENOD2 expression and large nodule-like structures that lack a persistent meristem (Yang et al., 1992Go). Under our conditions, alfalfa constructs larger nodule-like structures than M. truncatula when inoculated with exoA or exoH bacterial mutants (data not shown). In addition, alfalfa, unlike M. truncatula, can induce nodule formation in the absence of Rhizobia (Truchet et al., 1989Go) and allow effective nodulation by lpsB bacterial mutants (Niehaus et al., 1998Go). These data suggest that the development of the symbiosis is more tightly controlled in M. truncatula than in alfalfa and that the induction of ENOD2 and MTLEC4 requires that the symbiosis progress past the developmental block induced by early infection mutants.

The second class of bacterial (bacA) and plant (dnf1 and dnf5) mutants, which showed infection of the inner cortex, induced ENOD2 and MtLEC4 and created larger nodule-like structures than those induced by early infection mutants (Fig. 4). MtLEC4 has homology to bark lectins. The role of lectins in the legume-Rhizobium symbiosis has been well studied (Hirsch, 1999Go). Most research has focused on the role of lectins in Nod factor recognition or bacterial attachment. The heterologous expression of a pea (Pisum sativum) lectin in alfalfa enhances nodule formation by non-host bacteria that generate host-specific Nod factor (van Rhijn et al., 2001Go). In Dolichos biflorus, a Nod factor-binding lectin with apyrase activity is localized to root hairs (Etzler et al., 1999Go; Kalsi and Etzler, 2000Go). Lectins have been found in nodules of several species (VandenBosch et al., 1994Go; Bauchrowitz et al., 1996Go; Kardailsky et al., 1996Go), and alfalfa plants expressing antisense versions of nodule-enhanced lectins show severe developmental defects (Brill et al., 2001Go). Previously studied lectins should be assessed for their induction pattern in plant mutants and in wild-type plants inoculated with bacterial mutants to determine whether they show similar expression patterns to MtLEC4. Although the role of MtLEC4 is unknown, its induction is correlated with bacterial penetration of the root cortex and sustained cell divisions; thus, MtLEC4 may have a role in the formation of a persistent nodule meristem or in the release of bacteria into plant cells. Future studies that biochemically define the lectin substrate may offer clues as to the role of the lectin in the recognition of plant or bacterial carbohydrates.

The final class of bacterial (fixJ and nifD) and plant mutants (dnf2, 3, 4, 6, and 7) induced all the genes tested and created large nodule-like structures but still had defects in nitrogen fixation (Fig. 4). Interestingly, fixJ bacterial mutants could not induce MtN31, MtCAM1, and MtLB1 to the same level as was induced by nifD bacterial mutants (Fig. 5A). Both mutants are unable to fix nitrogen, but the FixJ defect is upstream of the NifD defect and may result in transcriptional misregulation of additional bacterial genes. The differential response of the plant to fixJ and nifD mutant bacteria may suggest that the plant monitors bacterial physiology, bacterial development, or the availability of reduced nitrogen closely after bacteroid differentiation.

The three classes of infection and fixation mutants may indicate the presence of three discrete checkpoints in the progression of nodulation. It will be interesting to determine what signals mediate these potential checkpoints. Our studies of the transcriptional profile of two groups of genes revealed similar developmental arrests induced in plant mutants and in wild-type plants inoculated with bacterial mutants. The identification of correlated phenotypes suggests a complex interplay between the two partners in which they coordinate symbiotic development. Future studies examining the mechanism of this coordination will be useful in determining whether environmental, physiological, metabolic, or signaling components are important for the development of a successful symbiosis.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Plant Growth Conditions

Medicago truncatula [Gaertn.] cv Jemalong A-17 seeds were scarified using concentrated sulfuric acid for 10 to 15 min, rinsed with sterile water, and sterilized in commercial bleach for 3 min. After rinsing to remove residual bleach, seeds were imbibed in sterile water for 4 to 12 h while shaking and were stored under water at 4°C to be used within a week. Mutant seeds were prepared in the same manner except rit1 seeds, which were scarified for 3 min and sterilized for 3 min in a solution of 20% (v/v) commercial bleach and 0.5% (v/v) Tween 20. Seeds were germinated overnight in inverted petri dishes in the dark and plated on buffered nodulation medium (BNM; pH 6.5; Ehrhardt et al., 1992Go) with 1.2% (w/v) agar and 1 mM {alpha}-aminoisobutyric acid (Sigma-Aldrich, St. Louis). Plants were grown at 22°C in a growth room with 14 h of light per day at 110 µE m–2 s–1.


Bacterial Strains and Nod Factor

Sinorhizobium meliloti strain Rm1021 is a streptomycin-resistant derivative of wild-type field isolate SU47 (Meade et al., 1982Go). exoA (Rm7031; Leigh et al., 1985Go), exoH (DW223; Wells and Long, 2002Go), bacA (VO2119; Oke and Long, 1999aGo), fixJ (VO2683; Oke and Long, 1999aGo), and SL44 (Fisher et al., 1988Go) mutant strains were published previously. The nifD mutant (VO2746) was created by transduction of the mutation from Rm1312Sp (Barnett et al., 1998Go) into Rm1021 (V. Oke, unpublished data).

Bacteria were grown in liquid tryptone-yeast extract (Beringer, 1974Go) supplemented with appropriate antibiotics. Antibiotics were used at the following concentrations: 500 µg mL–1 streptomycin, 50 µg mL–1 spectinomycin, and 50 µg mL–1 neomycin. For inoculations, bacteria were pelleted, washed in 0.5x BNM, and then diluted in 0.5x BNM to an approximate OD600 of 0.03 (approximately 3 x 107 cfu mL–1). Plant roots were flood inoculated 5 d after planting with 10 mL of inoculum per plate (245 x 245 x 20 mm, Nalgene Nunc Intl., Naperville, IL). NodRm-IV (Ac and S) was purified previously (Ehrhardt et al., 1996Go) and diluted to 100 pM in 0.5x BNM and applied as above.


RNA Preparation and Northern Hybridizations

RNA was purified with Trizol (Invitrogen, Carlsbad, CA) using the manufacturer's protocol for tissues with high lipid content. Roots were harvested and ground in liquid nitrogen using a mortar and pestle before Trizol addition. If necessary, further homogenization was performed using a Polytron homogenizer (PT 10/35, Brinkman, Westbury, NY). Poly(A+) RNA was purified using the Qiagen Oligotex mRNA Mini kit (Qiagen, Valencia, CA). To verify yield and quality of RNA, samples were subject to spectrophotometric examination (Sambrook et al., 1989Go) and gel electrophoresis. For each preparation, approximately 40 µg of total RNA was isolated from 30 roots. Five to 15 micrograms of total RNA was electrophoresed on a 1.2% (w/v) agarose gel with 6.2% (v/v) formaldehyde in MOPS buffer, and RNA was transferred to a nylon membrane (Hybond N+, Amersham Pharmacia Biotech, Buckinghamshire, UK).

PCR or reverse transcriptase-PCR was used to generate DNA fragments for probing northern blots. Primer pairs and probe lengths used for newly identified genes are: MtBGLU1 (CTTTGATGCCCAATTAGACTCAGTA and TAAAGATTGTCCAACCTCCTAACCT, 449 bp), MtLEC4 (TGAAGTGAAAGACCATGAGTAGATG and CACAGTTATCTTCAACTTTCCCAAG, 675 bp), and MtN31 (ATCAACTTTTTCGAAATCTTACGTG and CCTATTTCATTGAAGTTAACAAAGCA, 505 bp). A 670-bp DNA fragment representing previously published probe sequences was used for pGVN-55I10 (Fedorova et al., 2002Go). A 419-bp fragment of M. truncatula MtLB1 (Gallusci et al., 1991Go), a 419-bp fragment of M. truncatula RIP1 (Cook et al., 1995Go), and a 209-bp fragment of alfalfa (Medicago sativa) ENOD2 (Dickstein et al., 1988Go) were used to represent known nodulins. Actin was used as a loading control (Oldroyd et al., 2001Go). Radiolabeled DNA probes were generated using the Amersham Rediprime II Random Prime Labeling System. Radioactivity on northern blots was quantitated using a phosphor imager to give a calculated signal "volume" (pixel density x area of band) for each band on the blot (Bio-Rad GS-363 Molecular Imager, Bio-Rad, Hercules, CA). For calculations of fold suppression of MtBGLU1, normalized for loading, the following equation was used:

A reciprocal equation was used to calculate fold induction of RIP1. The average fold change and SD of the fold change are calculated for each gene.


Subtractive Hybridization

Subtractive hybridization was performed on 8 µg of Poly(A+) RNA using the PCR-Select subtractive hybridization kit (CLONTECH, Palo Alto, CA). Plant roots were exposed to buffer or S. meliloti for 6 h. In an attempt to enrich for plant genes induced early in the symbiosis, RNA derived from buffer inoculated roots was subtracted from RNA derived from bacterial inoculated roots.


Database Analyses

Excel (Microsoft, Redmond, WA) was used to analyze the M. truncatula Gene Index (MtGI) Release 4.0 (http://www.tigr.org/tdb/mtgi) and identify TCs containing ESTs from Rhizobia-inoculated or nodule libraries. In an attempt to eliminate constitutively expressed genes, TCs that were represented in uninoculated root or leaf libraries were omitted from further analyses. To identify putative Rhizobium-induced genes, the number of ESTs from inoculated or nodule libraries was tallied for each TC. TCs were then sorted based on this factor normalized for library size. Nine genes with interesting homology or with the most extreme nodule-specific representation were examined by northern hybridization. TCs representing these genes were numbered as follows: 28734, 32071, 32103, 35875, 35941, 36232, 39290, 39747, and 39884 and have been renumbered in the current version of MtGI (7.0) as 77713/7714, 85766/85767, 77066, 85309, 86036, 77299, 78239, 77544, and 85172 (TCs that were split into two are indicated by a slash). Four of the renamed TCs (85766/86767, 77066, and 86036) still show inoculation- or nodule-specific representation in MtGI (7.0). In the older version of MtGI (4.0), MtLEC4 and MtN31 were represented by TCs 32103 and 35875, respectively. In the current release of MtGI (7.0), MtBGLU1, MtLEC4, and MtN31are represented by TCs 78899, 77066, and 86036, respectively. DNA for probing northern blots was amplified using reverse transcriptase-PCR on M. truncatula cDNA.


Distribution of Materials

Upon request, all novel materials described in this publication will be made available in a timely manner for noncommercial research purposes, subject to the requisite permission from any third party owners of all or parts of the material. Obtaining any permissions will be the responsibility of the requestor.


    ACKNOWLEDGMENTS
 
We would like to thank Valerie Oke (University of Pittsburgh) for the nifD strain V02746, Harita Veereshlingam and Rebecca Dickstein (University of North Texas, Denton) for providing the plasmid template for the Enod2 probe, and Susan Miller and Carroll Vance (University of Minnesota, St. Paul) for providing pGVN-55I10. Colby Starker generously provided the seed for rit1, bit1, and the dnf mutants and probe for MtLB1. Lucinda Smith (Stanford University, Stanford, CA) produced the seed for the dmi1 mutant. We thank former and current members of the lab, especially Colby Starker (Stanford University, Stanford, CA), Sidney Shaw (Stanford University, Stanford, CA), Giles Oldroyd (John Innes Centre, Norwich, UK), Melicent Peck (Stanford University, Stanford, CA), David Keating (Loyola University Chicago, Maywood, IL) and Robert Fisher (Stanford University, Stanford, CA) for critical reading of the manuscript before publication.

Received August 14, 2003; returned for revision August 27, 2003; accepted October 13, 2003.


    FOOTNOTES
 
Article, publication date, and citation information can be found at http://www.plantphysiol.org/cgi/doi/10.1104/pp.103.031518.

1 This work was supported by the Howard Hughes Medical Institute, by the U.S. Department of Energy (grant no. DE–FG03–90ER20010 to S.R.L.), and by Howard Hughes Medical Institute (Predoctoral Fellowship to R.M.M.). Back

* Corresponding author; e-mail srl{at}stanford.edu; fax 650–725–8309.


    LITERATURE CITED
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Barnett MJ, Swanson JA, Long SR (1998) Multiple genetic controls on Rhizobium meliloti syrA, a regulator of exopolysaccharide abundance. Genetics 148: 19–32[Abstract/Free Full Text]

Batut J, Terzaghi B, Ghérardi M, Huguet M, Terzaghi E, Garnerone A, Boistard P, Huguet T (1985) Localization of a symbiotic fix region on Rhizobium meliloti pSym megaplasmid more than 200 kilobases from the nod-nif region. Mol Gen Genet 199: 232–239[CrossRef]

Bauchrowitz M, Barker D, Truchet G (1996) Lectin genes are expressed throughout root nodule development and during nitrogen-fixation in the Rhizobium-Medicago symbiosis. Plant J 9: 31–43

Bauchrowitz MA, Barker DG, Nadaud I, Rouge P, Lescure B (1992) Lectin genes from the legume Medicago truncatula. Plant Mol Biol 19: 1011–1017[Medline]

Bauer W (1981) Infection of legumes by Rhizobia. Annu Rev Plant Physiol Plant Mol Biol 32: 407–449[Web of Science]

Bénaben V, Duc G, Lefebvre V, Huguet T (1995) TE7, an inefficient symbiotic mutant of Medicago truncatula Gaertn. cv Jemalong. Plant Physiol 107: 53–62[Abstract]

Beringer JE (1974) R factor transfer in Rhizobium leguminosarum. J Gen Microbiol 84: 188–198[Abstract/Free Full Text]

Brill LM, Evans CJ, Hirsch AM (2001) Expression of MsLEC1- and MsLEC2-antisense genes in alfalfa plant lines causes severe embryogenic, developmental and reproductive abnormalities. Plant J 25: 453–461[CrossRef][Medline]

Catoira R, Galera C, de Billy F, Penmetsa RV, Journet EP, Maillet F, Rosenberg C, Cook D, Gough C, Dénarié J (2000) Four genes of Medicago truncatula controlling components of a Nod factor transduction pathway. Plant Cell 12: 1647–1666[Abstract/Free Full Text]

Catoira R, Timmers AC, Maillet F, Galera C, Penmetsa RV, Cook D, Dénarié J, Gough C (2001) The HCL gene of Medicago truncatula controls Rhizobium-induced root hair curling. Development 128: 1507–1518[Abstract]

Cheng HP, Walker GC (1998) Succinoglycan is required for initiation and elongation of infection threads during nodulation of alfalfa by Rhizobium meliloti. J Bacteriol 180: 5183–5191[Abstract/Free Full Text]

Cook D, Dreyer D, Bonnet D, Howell M, Nony E, VandenBosch K (1995) Transient induction of a peroxidase gene in Medicago truncatula precedes infection by Rhizobium meliloti. Plant Cell 7: 43–55[Abstract]

David M, Daveran ML, Batut J, Dedieu A, Domergue O, Ghai J, Hertig C, Boistard P, Kahn D (1988) Cascade regulation of nif gene expression in Rhizobium meliloti. Cell 54: 671–683[CrossRef][Web of Science][Medline]

De Carvalho-Niebel F, Lescure N, Cullimore JV, Gamas P (1998) The Medicago truncatula MtANN1 gene encoding an annexin is induced by Nod factors and during the symbiotic interaction with Rhizobium meliloti. Mol Plant-Microbe Interact 11: 504–513[Web of Science][Medline]

Diatchenko L, Lukyanov S, Lau YF, Siebert PD (1999) Suppression subtractive hybridization: a versatile method for identifying differentially expressed genes. Methods Enzymol 303: 349–380[CrossRef][Web of Science][Medline]

Dickstein R, Bisseling T, Reinhold VN, Ausubel FM (1988) Expression of nodule-specific genes in alfalfa root nodules blocked at an early stage of development. Genes Dev 2: 677–687[Abstract/Free Full Text]

Dickstein R, Scheirer DC, Fowle WH, Ausubel FM (1991) Nodules elicited by Rhizobium meliloti heme mutants are arrested at an early stage of development. Mol Gen Genet 230: 423–432[CrossRef][Medline]

Ehrhardt DW, Atkinson EM, Long SR (1992) Depolarization of alfalfa root hair membrane potential by Rhizobium meliloti Nod factors. Science 256: 998–1000[Abstract/Free Full Text]

Ehrhardt DW, Wais R, Long SR (1996) Calcium spiking in plant root hairs responding to Rhizobium nodulation signals. Cell 85: 673–681[CrossRef][Web of Science][Medline]

Etzler ME, Kalsi G, Ewing NN, Roberts NJ, Day RB, Murphy JB (1999) A Nod factor binding lectin with apyrase activity from legume roots. Proc Natl Acad Sci USA 96: 5856–5861[Abstract/Free Full Text]

Fedorova M, Van De Mortel J, Matsumoto PA, Cho J, Town CD, VandenBosch KA, Gantt JS, Vance CP (2002) Genome-wide identification of nodule-specific transcripts in the model legume Medicago truncatula. Plant Physiol 130: 519–537[Abstract/Free Full Text]

Finan TM, Hirsch AM, Leigh JA, Johansen E, Kuldau GA, Deegan S, Walker GC, Signer ER (1985) Symbiotic mutants of Rhizobium meliloti that uncouple plant from bacterial differentiation. Cell 40: 869–877[CrossRef][Medline]

Fisher RF, Egelhoff TT, Mulligan JT, Long SR (1988) Specific binding of proteins from Rhizobium meliloti cell-free extracts containing NodD to DNA sequences upstream of inducible nodulation genes. Genes Dev 2: 282–293[Abstract/Free Full Text]

Friedrich L, Lawton K, Reuss W, Masner P, Specker N, Gut Rella M, Meier B, Dincher S, Staub T, Uknes S et al. (1996) A benzothiadiazole derivative induces systemic acquired resistance in tobacco. Plant J 10: 61–70[CrossRef][Web of Science]

Gallusci P, Dedieu A, Journet EP, Huguet T, Barker DG (1991) Synchronous expression of leghaemoglobin genes in Medicago truncatula during nitrogen-fixing root nodule development and response to exogenously supplied nitrate. Plant Mol Biol 17: 335–349[CrossRef][Web of Science][Medline]

Gamas P, De Carvalho-Niebel F, Lescure N, Cullimore J (1996) Use of a subtractive hybridization approach to identify new Medicago truncatula genes induced during root nodule development. Mol Plant-Microbe Interact 9: 233–242[Web of Science][Medline]

Glazebrook J, Ichige A, Walker GC (1993) A Rhizobium meliloti homolog of the Escherichia coli peptide-antibiotic transport protein SbmA is essential for bacteroid development. Genes Dev 7: 1485–1497[Abstract/Free Full Text]

Gonzalez JE, York GM, Walker GC (1996) Rhizobium meliloti exopolysaccharides: synthesis and symbiotic function. Gene 179: 141–146[CrossRef][Medline]

Hirsch AM (1999) Role of lectins (and rhizobial exopolysaccharides) in legume nodulation. Curr Opin Plant Biol 2: 320–326[CrossRef][Web of Science][Medline]

Hirsch AM, Long SR, Bang M, Haskins N, Ausubel FM (1982) Structural studies of alfalfa roots infected with nodulation mutants of Rhizobium meliloti. J Bacteriol 151: 411–419[Abstract/Free Full Text]

Ichige A, Walker GC (1997) Genetic analysis of the Rhizobium meliloti bacA gene: functional interchangeability with the Escherichia coli sbmA gene and phenotypes of mutants. J Bacteriol 179: 209–216[Abstract/Free Full Text]

Ji W, Wright MB, Cai L, Flament A, Lindpaintner K (2002) Efficacy of SSH PCR in isolating differentially expressed genes. BioMed Central Genomics 3: 12[CrossRef][Medline]

Journet EP, Pichon M, Dedieu A, de Billy F, Truchet G, Barker DG (1994) Rhizobium meliloti Nod factors elicit cell-specific transcription of the ENOD12 gene in transgenic alfalfa. Plant J 6: 241–249[CrossRef][Web of Science][Medline]

Journet EP, van Tuinen D, Gouzy J, Crespeau H, Carreau V, Farmer MJ, Niebel A, Schiex T, Jaillon O, Chatagnier O et al. (2002) Exploring root symbiotic programs in the model legume Medicago truncatula using EST analysis. Nucleic Acids Res 30: 5579–5592[Abstract/Free Full Text]

Kaijalainen S, Schroda M, Lindstrom K (2002) Cloning of nodule-specific cDNAs of Galega orientalis. Physiol Plant 114: 588–593[CrossRef][Medline]

Kalsi G, Etzler ME (2000) Localization of a Nod factor-binding protein in legume roots and factors influencing its distribution and expression. Plant Physiol 124: 1039–1048[Abstract/Free Full Text]

Kardailsky IV, Sherrier DJ, Brewin NJ (1996) Identification of a new pea gene, PsNlec1, encoding a lectin-like glycoprotein isolated from the symbiosomes of root nodules. Plant Physiol 111: 49–60[Abstract]

Krusell L, Madsen LH, Sato S, Aubert G, Genua A, Szczyglowski K, Duc G, Kaneko T, Tabata S, de Bruijn F et al. (2002) Shoot control of root development and nodulation is mediated by a receptor-like kinase. Nature 420: 422–426[CrossRef][Medline]

Leigh JA, Reed JW, Hanks JF, Hirsch AM, Walker GC (1987) Rhizobium meliloti mutants that fail to succinylate their calcofluor-binding exopolysaccharide are defective in nodule invasion. Cell 51: 579–587[CrossRef][Web of Science][Medline]

Leigh JA, Signer ER, Walker GC (1985) Exopolysaccharide-deficient mutants of Rhizobium meliloti that form ineffective nodules. Proc Natl Acad Sci USA 82: 6231–6235[Abstract/Free Full Text]

Long SR (1996) Rhizobium symbiosis: nod factors in perspective. Plant Cell 8: 1885–1898[CrossRef][Web of Science][Medline]

Meade HM, Long SR, Ruvkun GB, Brown SE, Ausubel FM (1982) Physical and genetic characterization of symbiotic and auxotrophic mutants of Rhizobium meliloti induced by transposon Tn5 mutagenesis. J Bacteriol 149: 114–122[Abstract/Free Full Text]

Mergaert P, Nikovics K, Kelemen Z, Maunoury N, Vaubert D, Kondorosi A, Kondorosi E (2003) A novel family in Medicago truncatula consisting of more than 300 nodule-specific genes coding for small, secreted polypeptides with conserved cysteine motifs. Plant Physiol 132: 161–173[Abstract/Free Full Text]

Niehaus K, Lagares A, Puhler A (1998) A Sinorhizobium meliloti lipopolysaccharide mutant induces effective nodules on the host plant Medicago sativa (alfalfa) but fails to establish a symbiosis with Medicago truncatula. Mol Plant-Microbe Interact 11: 906–914[CrossRef][Web of Science]

Nishimura R, Hayashi M, Wu GJ, Kouchi H, Imaizumi-Anraku H, Murakami Y, Kawasaki S, Akao S, Ohmori M, Nagasawa M et al. (2002) HAR1 mediates systemic regulation of symbiotic organ development. Nature 420: 426–429[CrossRef][Medline]

Oke V, Long SR (1999a) Bacterial genes induced within the nodule during the Rhizobium-legume symbiosis. Mol Microbiol 32: 837–849[CrossRef][Web of Science][Medline]

Oke V, Long SR (1999b) Bacteroid formation in the Rhizobium-legume symbiosis. Curr Opin Microbiol 2: 641–646[CrossRef][Web of Science][Medline]

Oldroyd GE, Engstrom EM, Long SR (2001) Ethylene inhibits the Nod factor signal transduction pathway of Medicago truncatula. Plant Cell 13: 1835–1849[Abstract/Free Full Text]

Penmetsa RV, Cook DR (1997) A legume ethylene-insensitive mutant hyperinfected by its rhizobial symbiont. Science 275: 527–530[Abstract/Free Full Text]

Penmetsa RV, Frugoli JA, Smith LS, Long SR, Cook DR (2003) Dual genetic pathways controlling nodule number in Medicago truncatula. Plant Physiol 131: 998–1008[Abstract/Free Full Text]

Quackenbush J, Cho J, Lee D, Liang F, Holt I, Karamycheva S, Parvizi B, Pertea G, Sultana R, White J (2001) The TIGR Gene Indices: analysis of gene transcript sequences in highly sampled eukaryotic species. Nucleic Acids Res 29: 159–164[Abstract/Free Full Text]

Ramu SK, Peng HM, Cook DR (2002) Nod factor induction of reactive oxygen species production is correlated with expression of the early nodulin gene RIP1 in Medicago truncatula. Mol Plant-Microbe Interact 15: 522–528[Web of Science][Medline]

Reuber TL, Walker GC (1993) Biosynthesis of succinoglycan, a symbiotically important exopolysaccharide of Rhizobium meliloti. Cell 74: 269–280[CrossRef][Web of Science][Medline]

Ruvkun GB, Ausubel FM (1981) A general method for site-directed mutagenesis in prokaryotes. Nature 289: 85–88[CrossRef][Medline]

Ruvkun GB, Sundaresan V, Ausubel FM (1982) Directed transposon Tn5 mutagenesis and complementation analysis of Rhizobium meliloti symbiotic nitrogen fixation genes. Cell 29: 551–559[CrossRef][Medline]

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual, Ed 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY

Schauser L, Roussis A, Stiller J, Stougaard J (1999) A plant regulator controlling development of symbiotic root nodules. Nature 402: 191–195[CrossRef][Medline]

Sela-Buurlage MB, Ponstein AS, Bres-Vloemans SA, Melchers LS, Van Den Elzen P, Cornelissen B (1993) Only specific tobacco (Nicotiana tabacum) chitinases and [beta]-1,3-glucanases exhibit antifungal activity. Plant Physiol 101: 857–863[Abstract]

Shaw SL, Long SR (2003a) Nod factor elicits two separable calcium responses in Medicago truncatula root hair cells. Plant Physiol 131: 976–984[Abstract/Free Full Text]

Shaw SL, Long SR (2003b) Nod factor inhibition of reactive oxygen efflux in a host legume. Plant Physiol 132: 2196–2204[Abstract/Free Full Text]

Spaink HP (2000) Root nodulation and infection factors produced by rhizobial bacteria. Annu Rev Microbiol 54: 257–288[CrossRef][Web of Science][Medline]

Truchet G, Barker DG, Camut S, De Billy F, Vasse J, Huguet T (1989) Alfalfa nodulation in the absence of Rhizobium. Mol Gen Genet 219: 65–68[CrossRef]

Van Damme EJ, Barre A, Smeets K, Torrekens S, Van Leuven F, Rouge P, Peumans WJ (1995) The bark of Robinia pseudoacacia contains a complex mixture of lectins: characterization of the proteins and the cDNA clones. Plant Physiol 107: 833–843[Abstract]

Van Damme EJ, Peumans WJ, Barre A, Rouge P (1998) Plant lectins: a composite of several distinct families of structural and evolutionary related proteins with diverse biological roles. Crit Rev Plant Sci 17: 575–692[CrossRef]

VandenBosch KA, Rodgers LR, Sherrier DJ, Kishinevsky BD (1994) A peanut nodule lectin in infected cells and in vacuoles and the extracellular matrix of nodule parenchyma. Plant Physiol 104: 327–337[Abstract]

van Rhijn P, Fujishige NA, Lim PO, Hirsch AM (2001) Sugar-binding activity of pea lectin enhances heterologous infection of transgenic alfalfa plants by Rhizobium leguminosarum biovar viciae. Plant Physiol 126: 133–144[Abstract/Free Full Text]

Vasse J, de Billy F, Camut S, Truchet G (1990) Correlation between ultra-structural differentiation of bacteroids and nitrogen fixation in alfalfa nodules. J Bacteriol 172: 4295–4306[Abstract/Free Full Text]

Wais RJ, Galera C, Oldroyd G, Catoira R, Penmetsa RV, Cook D, Gough C, Dénarié J, Long SR (2000) Genetic analysis of calcium spiking responses in nodulation mutants of Medicago truncatula. Proc Natl Acad Sci U S A 97: 13407–13412[Abstract/Free Full Text]

Wais RJ, Keating DH, Long SR (2002) Structure-function analysis of Nod factor-induced root hair calcium spiking in Rhizobium-legume symbiosis. Plant Physiol 129: 211–224[Abstract/Free Full Text]

Ward E, Payne G, Moyer M, Williams S, Dincher S, Sharkey K, Beck J, Taylor H, Ahlgoy P, Meins F et al. (1991) Differential regulation of beta-1,3-glucanase messenger-RNAs in response to pathogen infection. Plant Physiol 96: 390–397[Abstract/Free Full Text]

Wells DH, Long SR (2002) The Sinorhizobium meliloti stringent response affects multiple aspects of symbiosis. Mol Microbiol 43: 1115–1127[CrossRef][Medline]

Yang C, Singer ER, Hirsch AM (1992) Nodules initiated by Rhizobium meliloti exopolysaccharide mutants lack a discrete, persistent nodule meristem. Plant Physiol 98: 143–151[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Plant Physiol.Home page
E. Kiss, B. Olah, P. Kalo, M. Morales, A. B. Heckmann, A. Borbola, A. Lozsa, K. Kontar, P. Middleton, J. A. Downie, et al.
LIN, a Novel Type of U-Box/WD40 Protein, Controls Early Infection by Rhizobia in Legumes
Plant Physiology, November 1, 2009; 151(3): 1239 - 1249.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
W. Capoen, J. Den Herder, S. Rombauts, J. De Gussem, A. De Keyser, M. Holsters, and S. Goormachtig
Comparative Transcriptome Analysis Reveals Common and Specific Tags for Root Hair and Crack-Entry Invasion in Sesbania rostrata
Plant Physiology, August 1, 2007; 144(4): 1878 - 1889.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
C. I. Pislariu and R. Dickstein
An IRE-Like AGC Kinase Gene, MtIRE, Has Unique Expression in the Invasion Zone of Developing Root Nodules in Medicago truncatula
Plant Physiology, June 1, 2007; 144(2): 682 - 694.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
J.-P. Combier, T. Vernie, F. de Billy, F. El Yahyaoui, R. Mathis, and P. Gamas
The MtMMPL1 Early Nodulin Is a Novel Member of the Matrix Metalloendoproteinase Family with a Role in Medicago truncatula Infection by Sinorhizobium meliloti
Plant Physiology, June 1, 2007; 144(2): 703 - 716.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
M.-X. Chou, X.-Y. Wei, D.-S. Chen, and J.-C. Zhou
Thirteen nodule-specific or nodule-enhanced genes encoding products homologous to cysteine cluster proteins or plant lipid transfer proteins are identified in Astragalus sinicus L. by suppressive subtractive hybridization
J. Exp. Bot., August 1, 2006; 57(11): 2673 - 2685.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
J. Liu, S. S. Miller, M. Graham, B. Bucciarelli, C. M. Catalano, D. J. Sherrier, D. A. Samac, S. Ivashuta, M. Fedorova, P. Matsumoto, et al.
Recruitment of Novel Calcium-Binding Proteins for Root Nodule Symbiosis in Medicago truncatula
Plant Physiology, May 1, 2006; 141(1): 167 - 177.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
C. G. Starker, A. L. Parra-Colmenares, L. Smith, R. M. Mitra, and S. R. Long
Nitrogen Fixation Mutants of Medicago truncatula Fail to Support Plant and Bacterial Symbiotic Gene Expression
Plant Physiology, February 1, 2006; 140(2): 671 - 680.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
K. A.T. Silverstein, M. A. Graham, T. D. Paape, and K. A. VandenBosch
Genome Organization of More Than 300 Defensin-Like Genes in Arabidopsis
Plant Physiology, June 1, 2005; 138(2): 600 - 610.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
H. Veereshlingam, J. G. Haynes, R. V. Penmetsa, D. R. Cook, D. J. Sherrier, and R. Dickstein
nip, a Symbiotic Medicago truncatula Mutant That Forms Root Nodules with Aberrant Infection Threads and Plant Defense-Like Response
Plant Physiology, November 1, 2004; 136(3): 3692 - 3702.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
K. T. Kuppusamy, G. Endre, R. Prabhu, R. V. Penmetsa, H. Veereshlingam, D. R. Cook, R. Dickstein, and K. A. VandenBosch
LIN, a Medicago truncatula Gene Required for Nodule Differentiation and Persistence of Rhizobial Infections
Plant Physiology, November 1, 2004; 136(3): 3682 - 3691.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. M. Mitra, S. L. Shaw, and S. R. Long
Six nonnodulating plant mutants defective for Nod factor-induced transcriptional changes associated with the legume-rhizobia symbiosis
PNAS, July 6, 2004; 101(27): 10217 - 10222.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
M. A. Graham, K. A.T. Silverstein, S. B. Cannon, and K. A. VandenBosch
Computational Identification and Characterization of Novel Genes from Legumes
Plant Physiology, July 1, 2004; 135(3): 1179 - 1197.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
134/2/595    most recent
pp.103.031518v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (27)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mitra, R. M.
Right arrow Articles by Long, S. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mitra, R. M.
Right arrow Articles by Long, S. R.
Agricola
Right arrow Articles by Mitra, R. M.
Right arrow Articles by Long, S. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY® THE PLANT CELL
Copyright © 2004 by the American Society of Plant Biologists