Plant Physiol. Drug Metab Dispos
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online February 26, 2004; 10.1104/pp.103.037382

Plant Physiology 134:1227-1239 (2004)
© 2004 American Society of Plant Biologists

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
134/3/1227    most recent
pp.103.037382v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (28)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hicks, G. R.
Right arrow Articles by Raikhel, N. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hicks, G. R.
Right arrow Articles by Raikhel, N. V.
Agricola
Right arrow Articles by Hicks, G. R.
Right arrow Articles by Raikhel, N. V.
CELL BIOLOGY AND SIGNAL TRANSDUCTION

Geminating Pollen Has Tubular Vacuoles, Displays Highly Dynamic Vacuole Biogenesis, and Requires VACUOLESS1 for Proper Function1,[w]

Glenn R. Hicks, Enrique Rojo2, Seho Hong3, David G. Carter and Natasha V. Raikhel*

Center for Plant Cell Biology and Department of Botany and Plant Sciences, University of California, Riverside, Riverside, California 92521


    ABSTRACT
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Vacuoles perform multiple functions in plants, and VCL1 (VACUOLESS1) is essential for biogenesis with loss of expression in the vcl1 mutant leading to lethality. Vacuole biogenesis plays a prominent role in gametophytes, yet is poorly understood. Given the importance of VCL1, we asked if it contributes to vacuole biogenesis during pollen germination. To address this question, it was essential to first understand the dynamics of vacuoles. A tonoplast marker, {delta}-TIP::GFP, under a pollen-specific promoter permitted the examination of vacuole morphology in germinating pollen of Arabidopsis. Our results demonstrate that germination involves a complex, yet definable, progression of vacuole biogenesis. Pollen vacuoles are extremely dynamic with remarkable features such as elongated (tubular) vacuoles and highly mobile cytoplasmic invaginations. Surprisingly, vcl1 did not adversely impact vacuole morphology in pollen germinated in vitro. To focus further on VCL1 in pollen, reciprocal backcrosses demonstrated reduced transmission of vcl1 through male gametophytes, indicating that vcl1 was expressive after germination. Interestingly, vcl1 affected the fertility of female gametophytes that undergo similarly complex vacuole biogenesis. Our results indicate that vcl1 is lethal in the sporophyte but is not fully expressive in the gametophytes. They also point to the complexity of pollen vacuoles and suggest that the mechanism of vacuole biogenesis in pollen may differ from that in other plant tissues.


Vacuoles perform numerous functions in plant cells such as the storage and degradation of proteins and other cellular components, osmoregulation, and the modulation of turgor during growth (Bassham and Raikhel, 2000Go; De, 2000Go).

These diverse roles are reflected in the fact that there are several distinct types of vacuoles: lytic vacuoles and protein storage vacuoles (Bassham and Raikhel, 2000Go). One distinguishing feature of vacuoles is the presence of tonoplast intrinsic proteins (TIPs) in their membranes (Juah et al., 1999Go). Thus, the expression of gene fusions between TIPs and reporter proteins such as green fluorescent protein (GFP) provide a sensitive and specific means of detecting vacuole dynamics in vivo (Cutler et al., 2000Go; Avila et al., 2003Go).

The large central vacuoles characteristic of many plant cells are thought to arise via fusion of lytic and storage vacuoles (Vitale and Raikhel, 1999Go). These and other membrane fusion events are mediated by SNAREs and several other families of factors. The availability of the Arabidopsis genome sequence has facilitated the identification of many components of the membrane fusion machinery in plants (Sanderfoot et al., 2000Go). However, only recently have components been described that are necessary for vacuole biogenesis.

The Arabidopsis gene VCL1 (VACUOLESS1) is essential for vacuole biogenesis (Rojo et al., 2001Go), and the effects of homozygous VCL1 inactivation have been examined in the T-DNA mutant known as vcl1. This mutant is blocked in vacuole formation in the embryo, displays altered development, and accumulates small vesicles and autophagosomes. The defects lead to aberrant suspensor development, growth arrest, and lethality at the torpedo stage of embryogenesis, clearly indicating that proper vacuole biogenesis is essential for plant viability. In Arabidopsis, VCL1 appears to be a single gene with no known homologs. In addition to other evidence indicating that this protein is involved in vacuole biogenesis (Rojo et al., 2001Go), VCL1 shares significant protein identity (24% overall) and structural similarity with yeast (Saccharomyces cerevisiae) Vps16p, which is part of the Class C-Vsp (C-Vps) complex that facilitates both homotypic vacuole fusion and Golgi-derived vesicle fusion with the tonoplast in yeast (Sato et al., 2000Go). An analogous complex (AtC-VSP complex) has been localized to the Arabidopsis tonoplast and prevacuolar compartments and has been shown to include AtVPS11 and AtVPS33, which are homologs of their respective yeast proteins (Rojo et al., 2003Go). Other syntaxins (SYP21 and SYP22) are associated with the complex and may play a role in membrane fusion. The similarity between yeast and plants not withstanding, VCL1 is essential in plants, whereas Vps16 is not essential in yeast (Horazdovsky and Emr, 1993Go).

Vacuole biogenesis during gametogenesis is poorly understood yet plays a prominent role in the development of male and female gametophytes. During microspore development, small dispersed vacuoles undergo fusion, leading to a highly vacuolated microspore. After the first pollen mitosis in Arabidopsis, the large vegetative cell vacuole of bicellular pollen undergoes fission. The mature tricellular pollen that results after the second mitosis once more contains many dispersed vacuoles (Van Aelst et al., 1993Go; Kuang and Musgrave, 1996Go; Twell et al., 1998Go; Yamamoto et al., 2003Go). Such morphological changes in vacuoles are apparent throughout pollen germination and lead to the formation of a large central vacuole in the pollen grain and numerous vacuoles in the rapidly growing pollen tube (Derksen et al., 2002Go). Organelles have been observed to move rapidly and bidirectionally in the pollen tube in a pattern described as reverse fountain streaming (Pierson and Cresti, 1992Go; for review, see Hepler et al., 2001Go). As the pollen tube elongates, callose plugs are formed at intervals starting at the base of the tube such that the metabolically active cytoplasm is maintained at the growing tip (for example, see Laitiainen et al., 2002Go). It has been speculated that these highly dynamic events in vacuole biogenesis are important or even essential for pollen function by providing a motive force for turgor-driven growth and, as a part of the endomembrane system, by facilitating cell wall biosynthesis (Hepler et al., 2001Go; Lord and Russell, 2002Go). Female gametophytes undergo similarly complex developmental events during megagametogenesis including vacuole biogenesis (Drews and Yadegari, 2002Go). Female gametophytic mutants of Arabidopsis have been described that display decreased inheritance through female gametophytes or through male and female gametophytes. Several of the mutants are affected in vacuole morphology (Christensen et al., 1998Go; Drews et al., 1998Go). Because male and female gametophytes are haploid, expressed genes, even those that may be recessive in the sporophyte, can exert an influence on ovule or pollen development and function.

Given the importance of vacuole biogenesis in plant development, we asked if VCL1, which is essential for vacuole formation during embryogenesis, plays a role in Arabidopsis gametophyte function. Pollen is a particularly attractive tissue because it can be examined as an organism free of the sporophyte, and germination can be examined in vitro. Beyond our first steps toward defining the role of VCL1 in pollen, there is little or no basic knowledge about the dynamics of vacuoles during pollen development and germination in particular. Thus, it was also critical to focus on this foundation upon which we can build our understanding of the mechanistic details of endomembrane trafficking in gametophytes within the context of trafficking in other plant tissues.

To understand the role of VCL1, it was necessary to first understand the basic progression of vacuole biogenesis in germinating pollen. We describe the use of a tonoplast-specific marker, {delta}-TIP::GFP, under the control of the pollen-specific LAT52 promoter that permitted the examination of vacuole morphology in germinating pollen of Arabidopsis. We observed that {delta}-TIP::GFP-containing vacuoles were extremely dynamic in pollen tubes and displayed several remarkable structures. When pollen from plants harboring vcl1 was examined, there was no obvious defect in vacuole morphology or dynamics. Although not essential for vacuole formation, vcl1 nevertheless did impair pollen function. This was supported by several genetic approaches that demonstrated that the presence of vcl1 resulted in reduced inheritance through both male and female gametophytes. Thus, the mechanism of vacuole biogenesis in pollen appears to be complex and may differ from that in other plant tissues.


    RESULTS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

VCL1 Is Expressed in Mature Pollen

To determine if VCL1 was expressed in pollen, total RNA from mature pollen of Arabidopsis plants was examined for the presence of VCL1 mRNA using reverse transcriptase (RT)-PCR. Primers were designed to detect the VCL1 mRNA specifically. A major gel band was obtained that corresponded to the expected length of the RT-PCR product from the mature mRNA (Fig. 1, RNA lane, arrow). The product was confirmed by DNA sequencing to correspond to the predicted region of the VCL1 mRNA (data not shown). For comparison, a PCR product was obtained from Arabidopsis genomic DNA that corresponded to the expected product length that included several introns (Fig. 1, gDNA lane). These results indicated that VCL1 mRNA, and probably protein, was expressed from the gene in mature pollen.



View larger version (89K):
[in this window]
[in a new window]
 
Figure 1. The VCL1 gene is expressed in mature pollen. RNA lane, Major 444-bp product of RT-PCR was from the VCL1 mRNA. Several minor PCR products were also detected in pollen RNA. Note that the bands appear more abundant upon duplication of the image. The largest product was confirmed by sequencing to be derived from genomic DNA contamination (data not shown). The shorter product was presumed to be nonspecific. gDNA lane, 722-bp PCR product from Arabidopsis genomic DNA using same primers as in RNA lane. MW, Lambda HindII, EcoRI molecular mass marker. Masses as follows from top to bottom: 2.0 kb, 1.6 kb, 1.4 kb, 950 bp, 830 bp, and 560 bp (faint).

 


{delta}-TIP::GFP as a Reporter for Vacuole Biogenesis in Pollen

Given that VCL1 was expressed in mature pollen, a key question was whether or not the presence of the vcl1 T-DNA gene knockout would affect vacuole morphology in germinating pollen. To address this question, the vcl1 mutant was transformed with a construct in which the tonoplast-specific marker {delta}-TIP was fused to GFP. The reporter was under the control of the pollen-specific promoter LAT52, which displays enhanced expression in mature pollen and throughout germination (Eady et al., 1995Go; Eyal et al., 1995Go). Self-crosses led to the identification of T3 lines that were: (a) homozygous for both {delta}-TIP::GFP and functional VCL1 as a control (VCL1/VCL1) or (b) homozygous for {delta}-TIP::GFP and heterozygous for vcl1 (vcl1/VCL1). Because the homozygous defect leads to embryo lethality, vcl1 was maintained as a heterozygote. To study the effects of vcl1 on the morphology and dynamics of vacuoles, the most straightforward approach was to examine pollen collected from mutant and control lines germinated in vitro.

We germinated our pollen in 30-µL drops directly on coated microscope slides that were then inverted. The pollen sank to the liquid-air interface, providing sufficient gas exchange to support germination (Fig. 2, A and B). The germination rates were highly variable between flowers. However, pollen in different stages of germination could be prepared easily for microscopy by placing a microscope coverslip over the drop. The method was useful for other reasons as well (see "Discussion"). When the VCL1/VCL1 control line was viewed by LSCM, numerous intracellular structures were highlighted in grains and elongating pollen tubes, indicating that the {delta}-TIP::GFP reporter was expressed in pollen (Fig. 2, C–E). No fluorescence was detected in control pollen not expressing {delta}-TIP::GFP using the same instrument settings (data not shown). These results indicated that germination in hanging drops was a useful approach and that the {delta}-TIP::GFP tonoplast reporter was functioning in pollen.



View larger version (96K):
[in this window]
[in a new window]
 
Figure 2. Germination of {delta}-TIP::GFP expressing pollen in vitro. A, Pollen germinated in an inverted 30-µL drop of germination medium on a coated microscope slide. Bar = 320 µm. B, Pollen tubes of different lengths are present in germinating pollen. Bar = 193 µm. C, Control pollen viewed by laser scanning confocal microscopy (LSCM). Vesicles and vacuoles are apparent. Bar = 20 µm. D, Corresponding transmitted image to C shown for comparison. 1, Hydrated pollen grain; 2, early pollen germination; 3, pollen tube in mid growth. Arrow, Position of sperm cells. Bar = 20 µm. E, Control pollen viewed by LSCM. Bar = 40 µm. F, Corresponding transmitted image to E. Pollen is at a more mature stage (4). Bar = 40 µm. All pollen viewed after 3 h of incubation in germination medium.

 


Vacuole Morphology in Germinating Pollen

Germinating pollen from the control line was examined to understand the basic morphology and dynamics of the tonoplast and vacuoles and to serve as a baseline for comparison to pollen from the vcl1/VCL1 line. Because the dynamics of vacuole biogenesis in living germinating pollen are poorly characterized, germination in vitro was divided for convenience into several stages as follows (see Fig. 2, D–F): (a) hydrated pollen grains (no visible tube), (b) early germination (tube length < 20 µm), (c) tubes in early growth (tube length 20–100 µm; occasional callose plug), and (d) tubes in more advanced growth that had at least one callose plug (typically >100 µm in length).

Hydrated pollen (stage 1) was first examined for {delta}-TIP::GFP by LSCM and found to have a granular appearance suggestive of the presence of dispersed vacuoles (Figs. 2, C and D, and 3, A and B). To define these structures more carefully, higher resolution images were obtained. The images clearly described the vesicular morphology within the hydrated pollen grain (Fig. 3C), and this was consistent with electron microscopy (EM) images of both mature and hydrated Arabidopsis pollen showing the presence of small dispersed vacuoles (Van Aelst et al., 1993Go; Kuang and Musgrave, 1996Go; see also Park et al., 1998Go). Other aspects of pollen morphology were apparent. For example, sperm cells could be seen in transmitted images (Fig. 2D, arrow), and dark regions presumed to be sperm cells were seen within hydrated pollen grains (Fig. 3A). The presence of chromatin within the sperm cell nuclei was confirmed by staining with the DNA dye DAPI and viewed in Z sections along with {delta}-TIP::GFP. In Figure 3D, both dispersed vacuoles and two sperm cell nuclei are visible in overlays of confocal (Fig. 3D) and transmitted (Fig. 3E) images.



View larger version (64K):
[in this window]
[in a new window]
 
Figure 3. Vacuole biogenesis in Arabidopsis pollen germinated in vitro. A, Optical sections showing the granular appearance of the {delta}-TIP::GFP. The dark regions (arrow) correspond to the two sperm cell nuclei in the tricellular pollen grain. Bar = 20 µm. B, Corresponding transmitted image for comparison with A. Bar = 20 µm. C, Higher resolution image of pollen grain showing the presence of dispersed vacuoles. A maximum intensity series using four-line averaging and 60x water immersion objective is shown. Bar = 8.0 µm. D, Sequential scanning of {delta}-TIP::GFP (green) and 4',6-diamidino-2 phenylindole (DAPI; red) in overlay showing the presence of two sperm cell nuclei. Note that the vegetative nucleus was detected with DAPI but was at a different optical plane and not visible in this image. Bar = 8.0 µm. E, {delta}-TIP::GFP and DAPI images from D layered onto their corresponding transmitted image. Bar = 8.0 µm. F, Optical section through a pollen grain in early germination highlighting the presence of larger vacuoles and extended or tube-like tonoplast. Bar = 8.0 µm. G, Transmitted image corresponding to F for comparison. Bar = 8.0 µm. H, Optical section through several pollen grains during early pollen tube growth showing the presence of small vacuoles. Dark region of tube on left was due to curvature of the tube out of the focal plane. Bar = 20 µm. I, Transmitted image corresponding to H. Bar = 20 µm. J, Optical section of a pollen grain showing increased vacuolation in the grain. Note the tubular appearance of tonoplast in the growing tube (arrow) and the lack of GFP signal in the tip region. The background contains a more mature pollen tube that is highly vacuolated. Bar = 20 µm. K, Transmitted image corresponding to J. Note the lack of material in the tip region (arrow). The background contains a more mature pollen tube that is highly vacuolated. Bar = 20 µm. L, Higher resolution image of a pollen tube in early growth showing the presence tubular vacuoles. The pollen tube tip (not visible) is toward the upper left of the image. Bar = 8.0 µm. M, Optical section of pollen at a more advance stage of tube growth showing increased vacuolation of the grain and tube and tubular vacuoles near the tip. Bar = 40 µm. Inset, Magnification of the grain and plug. Arrow, Bright {delta}-TIP::GFP structures (see text). Bar = 8.0 µm. N, Transmitted image corresponding to M. The sperm cell nuclei are visible within the pollen tube (arrow). Bar = 40 µm. Inset, Magnified overlay image of the grain and plug. Bar = 8.0 µm. The plug is clearly visible between areas of {delta}-TIP::GFP fluorescence. O, Overlay image of {delta}-TIP::GFP (green) and DAPI (red). Overlap of GFP and DAPI signals results in the orange appearance of the nuclei (arrow). Bar = 40 µm. P, Transmitted image corresponding to O. Bar = 40 µm. All images shown are of pollen incubated for 3 h in germination medium before viewing by LSCM.

 

In pollen at early germination (stage 2), somewhat larger vacuoles could be detected frequently in addition to the tonoplast, which had an extended or tubular morphology (Fig. 3, F and G). This morphology was noted later in germination (see below) and, along with vacuoles, developed presumably via the coalescence of the smaller dispersed vacuoles. As germination progressed into early growth of the pollen tube (stage 3), numerous small vacuoles could be seen in both the pollen grain and in the elongating tube, again resulting in a granular appearance (Fig. 3, H and I). In general, as pollen tube growth proceeded, larger vacuoles were observed, particularly in the pollen grain (Fig. 3, J and K). In addition, the vacuoles in the tube at times appeared to be extended in appearance. This is apparent in Figure 3J (arrowhead). To investigate the unusual vacuoles in more detail, higher resolution maximum intensity images of a Z series were obtained, and they indicated that the vacuoles assumed a tubular morphology (Fig. 3L). It has been observed generally for pollen tubes that the tip region is devoid of vacuoles (Lord and Russell, 2002Go). This is apparent in transmitted images that lack vesicular material in this area (Fig. 3K, asterisk) and is further evidenced by a corresponding lack of {delta}-TIP::GFP fluorescence at the tip (Fig. 3J).

Pollen at a more advanced stage of germination (stage 4) was characterized by the presence of a large central vacuole in the grain and more extensive vacuolation in the tube, except in the region toward the tip that frequently contained dispersed or tubular vacuoles presumably necessary for growth (Fig. 3, M and N). Another feature was callose plugs. The plugs formed at the base of the pollen tube and were apparent in LSCM as a region devoid of {delta}-TIP::GFP fluorescence (Fig. 3M). The plug was also visible in the corresponding transmitted image (Fig. 3N) and an overlay image (Fig. 3N, inset). Additional callose plugs were observed at more distal regions of the pollen tube (data not shown). Sperm cells migrating toward the growing tip could be seen in transmitted images (Fig. 3N, arrow), indicating that pollen germinated in vitro retained this function. To confirm the presence of chromatin within the sperm cell nuclei, germinating pollen at a similar stage was stained with DAPI and viewed in Z sections along with {delta}-TIP::GFP. In Figure 3O (arrow), sperm cell DNA was visualized in the pollen tube.

These results indicated that vacuole morphology was ordered throughout germination. Germination rates were highly variable between grains; however, there was a general progression from dispersed vacuoles in hydrated grains and tubes in early germination to more extensive vacuoles in more mature pollen tubes. During this transition, an unusual feature was observed: the presence of tubular vacuoles in early germination in regions of the pollen tube proximal to the tip. This region was presumed to be important for rapid elongation. The range of morphologies observed suggested that vacuoles in germinating pollen were undergoing rapid biogenesis.


The Vacuoles in Germinating Pollen Are Highly Dynamic

Having observed vacuole morphology in static images, we investigated the dynamics of vacuole biogenesis during germination. Pollen with tubes in early growth (stage 3) before callose plug formation was examined over time after 3 h of incubation in germination medium. The morphology of the vacuoles changed significantly even within 1 h; there were altered arrangements of large vacuoles in the grain and smaller vacuoles in the pollen tube. Tubular appearing vacuoles were also present. To capture these dynamics, a timed series of images were produced over a period of 1.3 h. Several remarkable aspects of germination were captured in the movie (supplemental Fig. S1, available in the online version of this article at http://www.plantphysiol.org). These included: (a) the rapid movement of large vacuoles in the pollen grain with the streaming of tonoplast toward the growing tube, (b) the rapid movement of tonoplast toward and away from the region of the tube tip in a reverse fountain pattern, (c) a lack of tonoplast flow into the extreme apex of the tube, (d) the presence of sperm cell nuclei in the tube and their movement, (e) the presence of mobile strand-like (tubular) vacuoles, and (f) the presence of unusual bright regions of {delta}-TIP::GFP fluorescence in the tonoplast of large vacuoles in the grain and similar bright structures within the pollen tube that were highly mobile. Some of these features were apparent in a static image from the timed series (Fig. 4A). Both large vacuoles (arrow) and tubular vacuoles (arrowhead) were present in the grain and throughout the tube, respectively. A dark region near the tip (bracket) corresponded to the sperm cells. As described above, the tip region is mostly devoid of tonoplast, and this is particularly apparent when compared with the corresponding transmitted image (Fig. 4B, asterisk). These data indicated that the germinating pollen possessed vacuoles that were extremely dynamic and formed structures that were unusual in morphology and fluorescence.



View larger version (54K):
[in this window]
[in a new window]
 
Figure 4. The vacuoles in germinating pollen are highly dynamic. A, Image of pollen grain in early growth from a time series (Fig. 1S). The arrow indicates a large vacuole and the position of an associated region of bright {delta}-TIP::GFP fluorescence. Note that bright structures are found throughout the pollen tube. The arrowhead indicates the position of some tubular vacuoles. The dark region near the tip (bracket) indicates the position of the sperm cells. Bar = 16 µm. B, Transmitted image corresponding to C. Arrow indicates the tip regions lacking {delta}-TIP::GFP fluorescence. Bar = 16 µm.

 


Germinating Pollen Contains Mobile Cytoplasmic Invaginations

The unusual bright regions in the tonoplast of large vacuoles were obvious in many pollen tubes, particularly in the pollen grain shown (Fig. 4A, arrow), as were other bright structures that were widely distributed throughout the tube. There were several possible explanations for these regions (see "Discussion"). To determine the nature of the structures, additional pollen tubes were viewed in more detail in images from a time series over a period of 30 min. Selected images showing details of interest are presented (Fig. 5). In Figure 5A (circled area), a bright ring structure and a bright semicircle were captured. In progressive images, the ring appeared to fuse with another region of tonoplast, and the semicircle folds inward, forming a nearly complete circle (Fig. 5B, circled area). The nearly complete circle then reopened (Fig. 5C, circle). Similar structures formed in other regions of the pollen tube (Fig. 5D, circled area), at times forming what appeared to be complete circles. Similar structures also were seen in other regions of the images. The highly fluorescent structures described including lines, arcs, and circles are very similar to double tonoplast cytoplasmic invaginations into vacuoles that have been described in leaves and cotyledons of Arabidopsis (Saito et al., 2002Go) and are termed bulbs. The complete time series over a period of 30 min is shown as a movie in supplemental Figure S2 and demonstrates the extreme activity of vacuoles and cytoplasmic invaginations in the pollen tube. An examination of pollen at different stages of germination revealed the presence of localized bright regions that were probably cytoplasmic invaginations (see Figs. 2C; 3, F, J, and M, inset, arrow). These results provided the reasonable explanation that the highly fluorescent structures were rapidly changing cytoplasmic invaginations. Overall, our examination of vacuole morphology in control pollen provided details of vacuole dynamics and a solid basis for comparison to pollen containing the defective vcl1 gene.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 5. Brightly fluorescent regions are cytoplasmic invaginations. Selected images are from a time series of a pollen tube at a more advanced stage in germination. The complete series (Fig. 2S) was produced over a period of 30 min. The images were produced at the following times after the beginning of the series: A, 90 s; B, 100 s; C, 420 s; and D, 1,640 s. Circled areas indicate the positions of several semicircles and rings of tonoplast. Pollen tube tip (not visible) is toward the top of the image. All bars shown = 8.0 µm.

 


Effect of vcl1 on Pollen Morphology

To ask if VCL1 was necessary for vacuole biogenesis or pollen germination, we investigated pollen from a heterozygous vcl1/VCL1 line. Because vcl1 is embryo lethal when homozygous, pollen containing the vcl1 gene knockout could be collected only from influorescences of vcl1/VCL1 plants. One-half of the pollen from heterozygotes was predicted to contain vcl1 in the haploid complement and would not express the gene. Given the essential nature of VCL1, lack of expression in even a proportion of the pollen would be expected to lead to a population that is distinct and defective in vacuole morphology or other aspect of germination. Pollen from vcl1/VCL1 plants was examined thoroughly at all stages of germination using the approaches described for the control pollen. In all, four independent experiments were done, totaling a minimum of 1,600 pollen grains examined from vcl1/VCL1 plants at all stages described for the control pollen. In addition, at least 650 freshly collected pollen grains from vcl1/VCL1 plants was examined for altered vacuole morphology (data not shown). Overall, our detailed analysis detected no defects in vacuole biogenesis in pollen from vcl1/VCL1 plants compared with pollen from control plants (data not shown).

Because in principle 50% of pollen from vcl1/VCL1 plants harbored vcl1, it was possible that the mutant pollen germinated at a lower frequency than VCL1 pollen. To address this possibility, pollen from vcl1/VCL1 and control plants was germinated in vitro and quantified. The frequencies for pollen germinated in liquid were statistically the same for the mutant and control. Pollen from vcl1/VCL1 yielded a frequency of 21.0% ± 1.3% (2,739 grains scored) compared with the control frequency of 22.9% ± 1.1% (2,618 grains scored). We also compared the germination frequency of pollen on solid medium (Fan et al., 2001Go), which resulted in a greater overall rate of germination. Pollen from vcl1/VCL1 yielded a frequency of 50.9% ± 5.2% (3,846 grains scored) compared with the control frequency of 43.5% ± 5.2% (3,655 grains scored). Again, this indicated no statistical difference in germination frequencies. Within the limits of our assays, which may not detect subtle differences in germination, our results indicated that vcl1 does not significantly reduce germination and supports the conclusion that vcl1 and VCL1 pollen share similar vacuole morphologies.

The lack of obvious defects in vacuole biogenesis in vcl1 pollen was surprising because VCL1 is essential and there are no known homologs in the Arabidopsis genome (Rojo et al., 2002). This raised the interesting question of how vacuole biogenesis occurred at all in pollen harboring the vcl1 defect (see "Discussion"). The effect of vcl1 on pollen vacuoles was either too subtle to detect using our methods, which was unlikely in the case of vcl1, or was at a different stage of development or fertilization. Thus, rather than focus further on morphology, we decided to ask if vcl1 pollen was affected functionally in vivo.


Male and female vcl1 Gametophytes Are Defective

As a functional assay, we used genetics to examine the fertility of vcl1 gametophytes. This approach was both sensitive and quantitative compared with the morphological approach. First, progeny of self-crosses of vcl1/VCL1 T3 plants were evaluated for transmission of the vcl1 defect. Seedling DNA from the progeny was examined for the presence of the vcl1 defect via PCR to detect the characterized single T-DNA insertion within the VCL1 gene (Rojo et al., 2002). Because vcl1 homozygous embryos did not survive, the expected ratio of vcl1/VCL1 to VCL1/VCL1 progeny was 2 to 1. The observed ratio was 1.1 to 1. This was a highly significant result, having a {chi}2 P value of 0.0031 (Table I) and indicated reduced transmission of the vcl1 gene to the progeny through the male or female gametophytes, or both. To determine which gametophytes were affected by vcl1, reciprocal backcrosses were done between vcl1/VCL1 and VCL1/VCL1 plants, and the progeny were scored by PCR. In these crosses, the expected ratio of vcl1/VCL1 to VCL1/VCL1 progeny was 1 to 1. When the pollen donor was vcl1/VCL1, the observed ratio was 0.45 to 1, which was highly significant by {chi}2 test having a P value of 0.0093 (Table I). This strongly indicated that vcl1 transmission was suppressed in male gametophytes. When the pollen donor was VCL1/VCL1, the observed ratio of vcl1/VCL1 to VCL1/VCL1 progeny was only 0.53 to 1. Again, this was a significant result having a P value of 0.0218 (Table I). Interestingly, this indicated that vcl1 also affected transmission through the female, indicating that VCL1 is important for the function of male and female gametophytes. The results of the genetics also indicate that homozygous vcl1 is lethal at the sporophyte stage; however, at the haploid gametophyte stage, it is not fully expressive.


View this table:
[in this window]
[in a new window]
 
Table I. Genetic analysis of vcl1 gametophytes Individuals inheriting the vcl1 mutation were scored by PCR and then subjected to a {chi}2 test. All {chi}2 parameters are indicated, as are the expected and observed results. P was calculated using GraphPad Quickcalcs (free online at http://www.GraphPad.com). n, Sample size; DF, degrees of freedom; P, statistical significance.

 


    DISCUSSION
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Overall, our results demonstrate that pollen germination involves a complex, yet definable, progression of vacuole biogenesis. Vacuole biogenesis in germinating pollen is extremely dynamic, and several unusual features such as tubular vacuoles and cytoplasmic invaginations were identified. Surprisingly, the vcl1 defect did not adversely impact vacuole biogenesis in pollen germinated in vitro. Nevertheless, it was firmly established that vcl1 does in fact lead to a functional defect in fertility. Furthermore, this defect affects both male and female gametophytes that undergo complex vacuole biogenesis.

To begin to examine the mechanisms of vacuole biogenesis and trafficking in pollen, it was essential to first understand the dynamics of vacuole biogenesis during germination. Although descriptive, it is critical information on a poorly studied topic and permits us to move forward in dissecting molecular details. We were able to successfully apply {delta}-TIP::GFP as a reporter to observe the morphology and dynamics of Arabidopsis pollen. A method has been reported for the germination of Arabidopsis pollen on solid medium that resulted in rates of germination up to 80% with pollen tubes having a maximum length of about 350 µm after 12 h of incubation (Fan et al., 2001Go). We were able to achieve similar germination rates (up to 74%) on solid medium; however, germination in liquid medium in inverted drops was useful for several reasons. Compared with microscope slides, agar surfaces can be uneven, which complicates LSCM viewing, and removing pollen from agar is difficult because of adhesion of the pollen tubes. In contrast, pollen germinated on slides can be viewed by placing a coverslip on the drop. This is potentially useful for immunolocalization because pollen germinated on coated microscope slides can be centrifuged directly onto the slide and fixed (G.R. Hicks and N.V. Raikhel, unpublished data).

The rate of pollen tube growth in liquid or on solid medium was highly variable even among pollen grains collected from the same flower. However, pollen tubes of 400 µm were not uncommon in liquid by 3 h indicating, a growth rate of up to 2.2 µm min-1 (G.R. Hicks and N.V. Raikhel, unpublished data). Pollen as a free living organism is subject to natural selection, and it has been suggested that variation in pollen growth rates could have a selective advantage (Mulcahy et al., 1996Go). The successful germination of Arabidopsis pollen in liquid has been reported recently by Steinebrunner et al. (2003Go). Given the active growth at shorter incubation times and the desire to minimize the possibility of artifacts in morphology at longer times, we focused our analysis on pollen incubated in germination medium for 3 h. In terms of methods for pollen germination, as we approach an age of automated LSCM screening (Avila et al., 2003Go), methods for rapid and easy pollen germination may be useful for conventional or chemical genetic screens for altered intracellular morphologies.

In our experiments, {delta}-TIP::GFP was used as a reporter for the tonoplast. This marker (for examples of labeled vacuoles from cotyledons, hypocotyls, and roots, see Avila et al., 2003Go) and {gamma}-TIP::GFP (Saito et al., 2002Go) are reported to be specific for vacuoles. Other lines of evidence also point to the specificity of our reporter. Reports of dispersed vacuoles in hydrated pollen (Van Aelst et al., 1993Go; Kuang and Musgrave, 1996Go), central vacuoles and extensive vacuolation in the tubes later in germination, and elongated vacuoles in tubes (Derksen at al., 2002Go) are all consistent with the morphology of vacuoles highlighted by {delta}-TIP::GFP fluorescence. Also, consistent with the labeling of vacuoles was the lack of fluorescence in the growing tip, a region rich in secretory and endocytotic vesicles. The specificity of {delta}-TIP::GFP was examined directly as well by adding the vacuole-specific dye FM 4-64 (Kuriyama, 1999Go) to germinating pollen tubes. The dye penetrated the pollen tube wall slowly but showed colabeling of {delta}-TIP::GFP labeled membranes by LSCM (G.R. Hicks and N.V. Raikhel, unpublished data). Therefore, the morphology and dynamics reported are behaviors of authentic tonoplast.

There are surprisingly few studies describing the germination of Arabidopsis pollen at the intracellular level. In hydrated pollen grains, the presence of numerous and dispersed vacuoles and other organelles such a dispersed lipid bodes has been observed by EM in Arabidopsis (Van Aelst et al., 1993Go; Kuang and Musgrave, 1996Go; Yamamoto et al., 2003Go). This is consistent with the dispersed vacuoles that we have observed by LSCM and suggests the relevance of our results using {delta}-TIP::GFP. Although the tubular vacuole morphology is discernable by LSCM, Derksen et al. (2002Go) used EM to examine Arabidopsis pollen germinated for 8 h and reported "extended vacuoles" in the pollen tubes that are similar in cross section to tubular vacuoles. This indicates that the tubular vacuoles are biologically relevant and not the result of {delta}-TIP::GFP expression by the pollen-specific promoter. Consistent with their results, we find a lack of these or other vacuoles in the tip of the pollen tube.

In evaluating pollen during germination, several overall trends were observed and can be integrated into the stages of germination in vitro discussed previously. Hydrated pollen grains (stage 1) and pollen in early germination (stage 2) are characterized by the presence of widely dispersed small vacuoles. As pollen tubes progress into early growth (stage 3), fusion events lead to the biogenesis of larger vacuoles in the pollen grain. The pollen tube is highly dynamic with the rapid streaming of tonoplast toward and away from the pollen tube tip. During rapid growth, tubular vacuoles form in the tube cytoplasm. It is reasonable to speculate that the tubular vacuoles are present in regions of the pollen tube involved in high rates of vesicular trafficking. Also, during periods of rapid endomembrane trafficking, mobile cytoplasmic invaginations into the vacuoles are present. Interestingly, invaginations are seen by EM on one side of large vacuoles of developing microspores. The vacuoles have been hypothesized to disperse via the progression of the invaginations from one side of the vacuole toward the opposite side (Yamamoto et al., 2003Go). Thus, mobile invaginations may be present in developing microspores and germinating pollen. Saito et al. (2002Go) reported mobile invaginations in cotyledon and hypocotyl tissues. Our findings indicate mobile invaginations are probably a widespread feature of actively growing tissues.

Pollen in more advanced growth (stage 4) possess at least one callose plug and are characterized by the presence of a large central vacuole in the grain and more extensive vacuoles in the tube. However, near the tip, the vacuoles are often more dispersed or tubular, suggestive of vesicle trafficking. The mechanism of rapid tonoplast movement is yet to be determined but may be the result of associations with the cytoskeleton (Derksen et al., 2002Go; Laitiainen et al., 2002Go). Treatment with disruptive drugs and colocalization studies would be useful steps in examining this connection.

Another unusual feature in germinating pollen was the presence of brightly fluorescent regions of {delta}-TIP::GFP that were associated with large vacuoles and were highly mobile. It is likely that these regions are tonoplast in origin for several reasons: (a) They are characterized by {delta}-TIP::GFP, a tonoplast-specific marker; (b) high-resolution time series indicate the similarity of these structures to the bright mobile double membrane tonoplast invaginations reported by Saito et al. (2002Go), who used a different tonoplast marker ({gamma}-TIP); and (c) in the time series presented (supplemental Figure S1), careful examination of the bright regions in the vicinity of the vacuoles in the pollen grain reveals movement from this region into the pollen tube. Other structures that are characterized by enhanced GFP fluorescence known as endoplasmic reticulum (ER) bodies have been described recently (Matsushima et al., 2003Go). These distinct spindle-shaped bodies (approximately 10 x 1 µm) are associated with ribosomes and have been detected using GFP fused to an ER retention signal. However, given that they are associated with a different compartment and our evidence in favor of mobile invaginations, it seems unlikely that the regions we describe are ER bodies. Although they do not appear to have increased fluorescence, transvacuolar strands of cytoplasm have been visualized with {delta}-TIP::GFP in vacuole-defective mutants (Avila et al., 2003Go) and could account for some of the strand-like regions observed in germinating pollen.

Having characterized the morphology of vacuoles during germination, we could then focus on the main question of the role of VCL1 in gametophyte function. The apparently normal biogenesis of vacuoles in pollen harboring the vcl1 defect is very intriguing. It is possible that there is a defect that cannot be detected using {delta}-TIP::GFP. This argues that the defect in pollen is subtle in contrast to the fact that VCL1 is required for vacuole biogenesis in embryos. Furthermore, vcl1 pollen is capable of germination because 45% of backcross progeny transmitted the defect indicating only partial expressivity. How do we rationalize the observation of vacuole biogenesis in the presence of vcl1 in haploid pollen? One possibility is a redundant gene that performs the function of VCL1 in pollen specifically. However, a search has been done, and no close homologs have been identified in Arabidopsis (Rojo et al., 2001Go). Interestingly, homologs of yeast Vps41 (At1g08190) and Vps39 (At4g36630) are expressed in Arabidopsis pollen (Honys and Twell, 2003Go). The yeast homolog of VCL1, Vps16, interacts with several factors, including Vps41, Vps39, Vps11, and Vsp33 as part of the C-Vps complex that functions during vacuole and vesicle fusion (Peterson and Emr, 2001Go). Arabidopsis AtVPS11, AtVSP33, and VCL1 are found in diverse plant tissues and interact as part of a similar complex in plants (Rojo et al., 2002), which probably includes AtVPS41 and AtVPS39. This suggests that C-Vps-like complexes operate throughout the plant and VCL1 functions in vacuole biogenesis in pollen. Alternatively, it is conceivable that several distantly related proteins could share at least partial redundancy in their functions.

Another speculation is that there is sufficient preexisting VCL1 protein or mRNA present in the mature pollen grain to support germination. During pollen development, the sporophyte contributes to the microspore, resulting in a vegetative cell (and pollen tube) cytoplasm of sporophyte origin. Immunolocalization in pollen harboring the vcl1 defect is the most direct way of addressing the presence of VCL1. However, attempts at localization have not been successful thus far (G.R. Hicks and N.V. Raikhel, unpublished data).

Given that pollen germination appeared normal in the presence of vcl1, it was possible that the defect might affect pollen at a later stage of development. Thus, a genetic approach was taken using fertility as a functional criterion. This approach had the advantage of being quantitative and sensitive for effects that might not be fully expressive in the gametophytes. Reciprocal backcrosses clearly demonstrated that, normal vacuole morphology in the presence of vcl1 not withstanding, there was a defect in pollen fertility due to the presence of vcl1. The results also indicate that the defect in pollen function occurs at a stage after pollen germination. This will be examined in future experiments to track pollen tube growth in vivo. The results of the genetics also indicated that female gametophytes were affected by vcl1. Thus, vcl1 is a general gametophytic mutant.

Given the complex development of vacuoles that also exists in ovules (Drews and Yadegari, 2002Go), this result is perhaps not surprising. Numerous mutants have been identified in female gametophyte development (Drews and Yadegari, 2002Go). Several female gametophyte mutants (gfa3 and gfa7) have been mapped to a position near that of VCL1 on chromosome 2 (Feldmann et al., 1998). Their identities have yet to be reported and, thus, could be VCL1. However, given that there are well over 100 such mutants with many T-DNA mutants still to be characterized (Drews and Yadegari, 2002Go), it is likely that other candidate female gametophytic mutants will be identified in the proximity of the VCL1 locus.

It is interesting to note that Vsp16 in yeast is critical for proper vacuole sorting, yet it is not an essential gene (Horazdovsky and Emr, 1993Go). In plants, VCL1 is clearly essential for embryo development, yet our results indicate that this is not the case in pollen. Thus, homozygous vcl1 is lethal at the sporophytic stage but is not fully expressive in the gametophytes. By analogy, pollen may permit the dissection of vacuole biogenesis in a system without the lethality associated with vacuole defects in the sporophyte.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Nucleic Acid Preparation and RT-PCR

The RNA from mature pollen was a generous gift from Drs. Mark Johnson and Daphne Preuss (University of Chicago). Pollen was collected (Mayfield et al., 2001Go) from the Arabidopsis qrt (quartet) mutant, which has no detectable impact on pollen function (Preuss et al., 1994Go). Message-specific primers were designed to complement sequences within exons 11 and 14 (Rojo et al., 2001Go). The intervening gene sequences included exons 12 and 13 and introns 12 through 14. A gel band of 444 bp was obtained that corresponded to the expected length of the RT-PCR product from the mature mRNA minus introns 12 through 14. For comparison, a PCR product of 722 bp was obtained from Arabidopsis genomic DNA that corresponded to the expected product length, which included the introns. RT-PCR was performed using the Superscript II Reverse Transcriptase System (Invitrogen, Carlsbad, CA) according to the manufacturer. Genomic DNA was extracted from Arabidopsis Columbia-0 using the cetyl-trimethylammonium bromide method (Rogers and Bendich, 1985Go). The following gene-specific primers were used to amplify a region of the VCL1 gene diagnostic for either the mRNA or the gene containing introns 5' CATGGGATATGGGGAAAAA 3' and CAGATGAGAAAGCGGAAGCT 3'. The conditions for PCR were as follows: 94°C for 5 min followed by 30 cycles of amplification (94°C for 1 min, 61°C for 1 min, and 72°C for 1 min). Products were fractionated by 1% (w/v) agarose gel electrophoresis.


Construction and Transformation of {delta}-TIP::GFP Reporter

For construction of the LAT52 promoter-{delta}-TIP::GFP, the 35S promoter was removed from pEGAD (Cutler et al., 2000Go) as an SstI/Age I fragment. This was replaced by blunt-end ligation with an XbaI/HindIII fragment from pUC19-LAT52::GFP (a generous gift from Zhenbiao Yang, University of California, Riverside) containing the LAT52 promoter. The LAT52 promoter was originally from the laboratory of Sheila McCormick (Plant Gene Expression Center, University of California, Berkeley). The resulting construct pLAT52-{delta}-TIP::GFP was transformed into Argobacterium tumefaciens and introduced into plants heterozygous for vcl1 by floral dipping (Clough and Bent, 1998Go). The vcl1 mutant (Rojo et al., 2001Go) has a single T-DNA insertion in the VCL1 gene in Arabidopsis Columbia-0. Plants harboring pLAT52-{delta}-TIP::GFP were selected on BASTA, and heterozygous (vcl1/VCL1) plants were identified by PCR using NPTII gene-specific primers (see below) to identify the T-DNA insertion. Several resistant vcl1/VCL1 T2 plants were self-crossed, and progeny were analyzed for the vcl1 defect. Among the genotyped T3 progeny were plants homozygous for {delta}-TIP::GFP and heterozygous for the vcl1 defect. One such line, LGT4-28, was used in this study. This line will be available from the Arabidopsis Biological Resource Center (Ohio State University, Columbus).


Genotyping and Pollen Germination in Vitro

Seeds from self crosses of LGT4-28 were sterilized in 70% (v/v) ethanol and 0.05% (v/v) Triton X-100 and germinated on Murashige and Skoog Minimal Organics medium (Life Technologies/Gibco-BRL, Cleveland), then transferred to soil after the appearance of four true leaves. After about 2 weeks, one or several rosette leaves were removed for the preparation of DNA using Plant DNAzol Reagent (Invitrogen) according to the manufacturer's instructions. The final DNA product was dissolved in 15 to 30 µL of water for PCR. Because homozygous vcl1 is embryo lethal, it was maintained as a heterozygote in LGT 4-28. For all genotyping, vcl1/VCL1 plants were identified from those that were VCL1/VCL1 by using NPTII-specific primers to identify the T-DNA insertion in vcl1 (forward, 5' CCGGTACCTGCCCATTC 3'; and reverse, 5' GCGATAGAAGGCGATGCG 3'). The conditions for PCR were as follows: 94°C for 3 min, 28 to 30 cycles of amplification (94°C for 45 s, 45°C for 30 s, and 72°C for 2 min). The NPTII product of approximately 400 bp was fractionated by 1.2% (w/v) agarose gel electrophoresis. As a positive control, all PCR reactions included primers to the gene for the large subunit ADP Glc pyrophosphorylase (APL), which resulted in a product of approximately 700 bp. For germination in drops in vitro, pollen from vcl1/VCL1 or VCL1/VCL1 control plants was collected from flowers that were fully or nearly fully open with anthers that were freshly dehiscent. Flowers were air-dried for 2 to 4 h, then gently dabbed onto the surface of a 30-µL drop of Germination Medium 1C [10% (w/v) Suc, 0.01% (w/v) boric acid, 1 mM CaCl2, 1 mM Ca(NO3)2, and 1 mM MgSO4, pH adjusted to 6.5 with KOH) on a coated microscope slide (Cytoslide, Thermo Shandon, Pittsburgh, PA). Pollen from one flower was typically examined per drop; however, pollen from multiple flowers could be pooled and germinated. The slide was then inverted and incubated for 3 to 15 h at 23 C and 100% humidity. For germination on agar, 2 mL of Germination Medium (Fan et al., 2001Go) was applied to the surface of a microscope slide and allowed to solidify. Pollen from individual flowers was then dabbed onto the agar, which was then incubated for 12 to 15 h at 100% humidity. To quantify germination in drops or on agar medium, pollen from individual flowers was germinated for 12 to 15 h and 50 to 150 (drops) or 100 to 200 (agar) grains were scored per flower. A minimum of 27 vcl1/VCL1 or VCL1/VCL1 flowers each were scored in liquid or on solid medium. In all cases, the frequencies reported plus or minus SE were derived from three independent experiments. For examination by LSCM, a 24-x 60-mm coverslip was gently lowered onto the drop containing the germinating pollen. The DNA dye DAPI was added directly to the drop before coverslip addition at a final concentration of 2 µg/mL.


Microscopy

Germinating pollen was viewed using a Leica TCS SP2/UV Confocal Microscope (Leica Microsystems, Wetzlar, Germany) and either 20x or 63x water immersion objectives. For GFP and DAPI viewing, manufacturer settings were used. The sequential scanning function was used to eliminate the detection of {delta}-TIP::GFP in the DAPI channel and vice versa when producing merged images. For all static images, 2x line averaging was used. For detailed images as indicated, maximum intensity images were produced from a Z series with 4x line averaging using Leica Lite software (Leica Microsystems). For movies, images were taken at the rates indicated with no line averaging. To further reduce bleaching of {delta}-TIP::GFP fluorescence due to repeated scanning, the pinhole was widened to 150 µm from the usual setting of 100 µm used for static images.


Genetics

For segregation analysis of heterozygotes, LGT 4-28 plants were used that were allowed to self-pollinate. The seed was collected, sterilized, germinated on plates, and then transferred to soil. After about 2 weeks, DNA was prepared from rosette leaves, and plants were genotyped as described above. For analysis of reciprocal back crosses of vcl1/VCL1 plants by VCL1/VCL1 plants, approximately 30 independent reciprocal crosses were done. Seeds were collected and pooled for VCL1/VCL1 (female) by vcl1/VCL1 (male) crosses and for vcl1/VCL1 (female) by VCL1/VC1 (male) crosses. After sterilization and germination on plates, DNA was extracted as above at the appearance of the fourth true leaf. Progeny were genotyped for the presence of the vcl1 by PCR. {chi}2 P and other values are indicated. P values were calculated using GraphPad Quickcalcs (free on-line at GraphPad.com).


    ACKNOWLEDGMENTS
 
The authors would like to thank Abigail Cano (University of California, Riverside) for assistance with DNA preparation and Theresa Vu for assistance with crosses. We also thank Drs. Ueli Grossniklaus (University of Zurich), Sebastian Bednarek (University of Wisconsin, Madison), and Gary Drews (University of Utah, Salt Lake City) for helpful comments and Jocelyn Brimo (University of California, Riverside) for graphic arts. We would particularly like to thank Drs. Elizabeth Lord (University of California, Riverside) and Zhenbiao Yang (University of California, Riverside) for critical discussions and advice and members of Dr. Yang's laboratory for advice on pollen germination methods.

Received December 9, 2003; returned for revision January 2, 2004; accepted January 28, 2004.


    FOOTNOTES
 
Article, publication date, and citation information can be found at http://www.plantphysiol.org/cgi/doi/10.1104/pp.103.037382.

1 This work was supported by the Department of Energy (grant no. DE–FG03–02ER15295/A000 to N.V.R.). Back

[w] The online version of this article contains Web-only data. Back

2 Present address: Departamento de Genetica Molecular de Plantas, Centro Nacional de Biotecnologia, Consejo Superior de Investigaciones Cientifas, E–28049 Madrid, Spain. Back

3 Present address: Department of Biological Sciences, KAISTYu-song Gu, Daejon, Republic of Korea. Back

* Corresponding author; e-mail natasha.raikhel{at}ucr.edu; fax 909–787–4437.


    LITERATURE CITED
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Avila E, Zouhar J, Agee A, Carter D, Raikhel NV (2003) Tools to study plant organelle biogenesis: point mutation lines with disrupted vacuoles, and high-speed confocal screening of GFP tagged organelles. Plant Physiol (in press)

Bassham DC, Raikhel NV (2000) Unique features of the plant vacuolar sorting machinery. Curr Opin Cell Biol 12: 491-495[CrossRef][Web of Science][Medline]

Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735-743[CrossRef][Web of Science][Medline]

Cutler SR, Ehrhardt DW, Griffitts JS, Somerville CR (2000) Random GFP::cDNA fusions enable visualization of subcellular structures in cells of Arabidopsis at a high frequency. Proc Natl Acad Sci USA 97: 3718-3723[Abstract/Free Full Text]

Christensen CA, Subramanian S, Drews GN (1998) Identification of gametophytic mutations affecting female gametophyte development in Arabidopsis. Dev Biol 202: 136-151[CrossRef][Web of Science][Medline]

De DN (2000) Plant Cell Vacuoles: An Introduction. Csiro Publishing, Collingwood, Victoria, Australia

Derksen J, Knuiman B, Hoedemaekers K, Guyan A, Bonhomme S, Pierson E (2002) Growth and cellular organization of Arabidopsis pollen tubes in vitro. Sex Plant Reprod 15: 133-139[CrossRef]

Drews GN, Lee D, Christensen CA (1998) Genetic analysis of female gametophyte development and function. Plant Cell 10: 5-17[Abstract/Free Full Text]

Drews GN, Yadegari R (2002) Development and function of the angiosperm female gametophyte. Annu Rev Genet 36: 99-124[CrossRef][Web of Science][Medline]

Eady C, Lindsey k, Twell D (1995) Differential activation and conserved vegetative cell-specific activity of a late pollen promoter in species with bicellular and tricellular pollen. Plant J 5: 543-550

Eyal Y, Curie C, McCormick S (1995) Pollen specificity elements reside in 30 bp of the proximal promoters of two pollen-expressed genes. Plant Cell 7: 373-384[Abstract]

Fan L-M, Wang Y-F, Wang H, Wu W-H (2001) In vitro pollen germination and characterization of the inward potassium currents in Arabidopsis pollen grain protoplasts. J Exp Bot 52: 1603-1614[Abstract/Free Full Text]

Feldmann KA, Coury DA, Christianson ML (1997) Exeptional segregation of a selectable marker (KanR) in Arabidopsis indentifies genes important for gametophytic growth and development. Genetics 147: 1411-1422[Abstract]

Hepler PK, Vidali L, Cheung AY (2001) Polarized cell growth in higher plants. Annu Rev Cell Dev Biol 17: 159-187[CrossRef][Web of Science][Medline]

Honys D, Twell D (2003) Comparative analysis of the Arabidopsis pollen transcriptome. Plant Physiol 132: 640-652[Abstract/Free Full Text]

Horazdovsky B, Emr S (1993) The VPS16 gene product associates with a sedimentable protein complex and is essential for vacuolar protein sorting in yeast. J Biol Chem 268: 4953-4962[Abstract/Free Full Text]

Juah GY, Phillips TE, Rogers RL (1999) Tonoplast intrinsic protein isoforms as markers for vacuolar functions. Plant Cell 11: 1867-1882[Abstract/Free Full Text]

Kuang A, Musgrave ME (1996) Dynamics of vegetative cytoplasm during generative cell formation and pollen maturation in Arabidopsis thaliana. Protoplasma 194: 81-90[CrossRef][Web of Science][Medline]

Kuriyama H (1999) Loss of tonoplast integrity programmed in tracheary element differentiation. Plant Physiol 121: 763-774[Abstract/Free Full Text]

Laitiainen E, Nieminen KM, Vihinen H, Raudaskoski M (2002) Movement of generative cell and vegetative nucleus in tobacco pollen tubes is dependent on microtubule cytoskeleton but independent of the synthesis of callose plugs. Sex Plant Reprod 15: 195-204[CrossRef]

Lord EM, Russell SD (2002) The mechanisms of pollination and fertilization in plants. Annu Rev Cell Dev Biol 18: 81-105[CrossRef][Web of Science][Medline]

Matsushima R, Hayashi Y, Yamada K, Shimada T, Nishimura M, Hara-Nishimura I (2003) The ER body, a novel endoplasmic reticulum-derived structure in Arabidopsis. Plant Cell Physiol 447: 661-666

Mayfield JA, Fiebig A, Johnston SE, Preuss D (2001) Gene families from the Arabidopsis thaliana pollen coat proteome. Science 292: 2482-2485[Abstract/Free Full Text]

Mulcahy DI, Sari-Goria M, Mulcahy GB (1996) Pollen selection: past, present and future. Sex Plant Reprod 9: 353-356[CrossRef]

Park SK, Howden R, Twell D (1998) The Arabidopsis thaliana gametophytic mutation gemini pollen 1 disrupts microspore polarity, division asymmetry and pollen cell fate. Dev 125: 3789-3799[Abstract]

Peterson MR, Emr SD (2001) The class C Vps complex functions at multiple stages of the vacuolar transport pathway. Traffic 2: 476-486[CrossRef][Web of Science][Medline]

Pierson ES, Cresti M (1992) Cytoskeleton and cytoplasmic organization of pollen and pollen tubes. Int Rev Cytol 140: 73-125

Preuss D, Rhee SY, Davis RW (1994) Tetrad analysis possible in Arabidopsis with mutation of the QUARTET (QRT) genes. Science 264: 1458-1460[Abstract/Free Full Text]

Rogers SO, Bendich AJ (1985) Extraction of DNA from milligram amounts of fresh, herbarium and mummified plant tissues. Plant Mol Biol 5: 69-76

Rojo E, Guillmor CS, Kovaleva V, Somerville CR, Raikhel NV (2001) VACUOLESS1 is an essential gene required for vacuole formation and morphogenesis in Arabidopsis. Dev Cell 1: 303-310[CrossRef][Web of Science][Medline]

Rojo E, Zouhar J, Kovaleva V, Hong S, Raikhel NV (2003) The AtC-VPS protein complex is localized to the tonoplast and the prevacuolar compartment in Arabidopsis. Mol Biol Cell 14: 361-363[Abstract/Free Full Text]

Saito C, Ueda T, Abe H, Wada Y, Kuroiwa T, Hisada A, Furuya M, Nakano A (2002) A complex and mobile structure forms a distinct subregion-within the continuous vacuolar membrane in young cotyledons of Arabidopsis. Plant J 29: 245-255[CrossRef][Web of Science][Medline]

Sanderfoot AA, Assaad FF, Raikhel NV (2000) The Arabidopsis Genome: an abundance of soluble N-ethylmaleimide-sensitive factor adaptor protein receptors. Plant Physiol 124: 1558-1569[Abstract/Free Full Text]

Sato TK, Rehling P, Peterson MR, Emr SD (2000) Class C Vps protein complex regulates vacuolar SNARE pairing and is required for vesicle docking/fusion. Mol Cell 6: 661-671[CrossRef][Web of Science][Medline]

Steinebrunner I, Wu J, Corbett A, Roux SJ (2003) Disruption of apyrases inhibits pollen germination in Arabidopsis. Plant Physiol 131: 1638-1647[Abstract/Free Full Text]

Twell D, Park SK, Lalanne E (1998) Asymmetric division and cell fate determination in developing pollen. Trends Plant Sci 3: 305-310

Van Aelst AC, Pierson ES, Van Went JL, Cresti M (1993) Ultrastructural changes of Arabidopsis thaliana pollen during final maturation and rehydration. Zygote 1: 173-179[Medline]

Vitale A, Raikhel NV (1999) What do proteins need to reach different vacuoles? Trends Plant Sci 4: 149-155[CrossRef][Web of Science][Medline]

Yamamoto Y, Nishimura M, Hara-Nishimura I, Noguchi T (2003) Behavior of vacuoles during microspore and pollen development in Arabidopsis thaliana. Plant Cell Physiol 44: 1192-1201[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Plant Cell PhysiolHome page
Y. Oda, A. Hirata, T. Sano, T. Fujita, Y. Hiwatashi, Y. Sato, A. Kadota, M. Hasebe, and S. Hasezawa
Microtubules Regulate Dynamic Organization of Vacuoles in Physcomitrella patens
Plant Cell Physiol., April 1, 2009; 50(4): 855 - 868.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
S. Han, L. Green, and D. J. Schnell
The Signal Peptide Peptidase Is Required for Pollen Function in Arabidopsis
Plant Physiology, March 1, 2009; 149(3): 1289 - 1301.
[Abstract] [Full Text] [PDF]


Home page
Mol PlantHome page
N. Q. Phan, S.-J. Kim, and D. C. Bassham
Overexpression of Arabidopsis Sorting Nexin AtSNX2b Inhibits Endocytic Trafficking to the Vacuole
Mol Plant, November 1, 2008; 1(6): 961 - 976.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
D. Zhang, D. Wengier, B. Shuai, C.-P. Gui, J. Muschietti, S. McCormick, and W.-H. Tang
The Pollen Receptor Kinase LePRK2 Mediates Growth-Promoting Signals and Positively Regulates Pollen Germination and Tube Growth
Plant Physiology, November 1, 2008; 148(3): 1368 - 1379.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
Y. Lee, E.-S. Kim, Y. Choi, I. Hwang, C. J. Staiger, Y.-Y. Chung, and Y. Lee
The Arabidopsis Phosphatidylinositol 3-Kinase Is Important for Pollen Development
Plant Physiology, August 1, 2008; 147(4): 1886 - 1897.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
F. Delmas, M. Seveno, J. G. B. Northey, M. Hernould, P. Lerouge, P. McCourt, and C. Chevalier
The synthesis of the rhamnogalacturonan II component 3-deoxy-D-manno-2-octulosonic acid (Kdo) is required for pollen tube growth and elongation
J. Exp. Bot., July 1, 2008; 59(10): 2639 - 2647.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
T. Higaki, T. Goh, T. Hayashi, N. Kutsuna, Y. Kadota, S. Hasezawa, T. Sano, and K. Kuchitsu
Elicitor-Induced Cytoskeletal Rearrangement Relates to Vacuolar Dynamics and Execution of Cell Death: In Vivo Imaging of Hypersensitive Cell Death in Tobacco BY-2 Cells
Plant Cell Physiol., October 1, 2007; 48(10): 1414 - 1425.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
Y. Fujiki, K. Yoshimoto, and Y. Ohsumi
An Arabidopsis Homolog of Yeast ATG6/VPS30 Is Essential for Pollen Germination
Plant Physiology, March 1, 2007; 143(3): 1132 - 1139.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
A. Y. Cheung and H.-M. Wu
Structural and functional compartmentalization in pollen tubes
J. Exp. Bot., January 1, 2007; 58(1): 75 - 82.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
K. von Besser, A. C. Frank, M. A. Johnson, and D. Preuss
Arabidopsis HAP2 (GCS1) is a sperm-specific gene required for pollen tube guidance and fertilization
Development, December 1, 2006; 133(23): 4761 - 4769.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
G. Drakakaki, O. Zabotina, I. Delgado, S. Robert, K. Keegstra, and N. Raikhel
Arabidopsis Reversibly Glycosylated Polypeptides 1 and 2 Are Essential for Pollen Development
Plant Physiology, December 1, 2006; 142(4): 1480 - 1492.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
P. R. Darrah, M. Tlalka, A. Ashford, S. C. Watkinson, and M. D. Fricker
The vacuole system is a significant intracellular pathway for longitudinal solute transport in basidiomycete fungi.
Eukaryot. Cell, July 1, 2006; 5(7): 1111 - 1125.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
T. Higaki, N. Kutsuna, E. Okubo, T. Sano, and S. Hasezawa
Actin Microfilaments Regulate Vacuolar Structures and Dynamics: Dual Observation of Actin Microfilaments and Vacuolar Membrane in Living Tobacco BY-2 Cells
Plant Cell Physiol., July 1, 2006; 47(7): 839 - 852.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
X.-Q. Gao, C.-G. Li, P.-C. Wei, X.-Y. Zhang, J. Chen, and X.-C. Wang
The Dynamic Changes of Tonoplasts in Guard Cells Are Important for Stomatal Movement in Vicia faba
Plant Physiology, November 1, 2005; 139(3): 1207 - 1216.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
R. A. Cole, L. Synek, V. Zarsky, and J. E. Fowler
SEC8, a Subunit of the Putative Arabidopsis Exocyst Complex, Facilitates Pollen Germination and Competitive Pollen Tube Growth
Plant Physiology, August 1, 2005; 138(4): 2005 - 2018.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
P. Niewiadomski, S. Knappe, S. Geimer, K. Fischer, B. Schulz, U. S. Unte, M. G. Rosso, P. Ache, U.-I. Flugge, and A. Schneider
The Arabidopsis Plastidic Glucose 6-Phosphate/Phosphate Translocator GPT1 Is Essential for Pollen Maturation and Embryo Sac Development
PLANT CELL, March 1, 2005; 17(3): 760 - 775.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
C. Carter, S. Pan, J. Zouhar, E. L. Avila, T. Girke, and N. V. Raikhel
The Vegetative Vacuole Proteome of Arabidopsis thaliana Reveals Predicted and Unexpected Proteins
PLANT CELL, December 1, 2004; 16(12): 3285 - 3303.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
M. A. Johnson, K. von Besser, Q. Zhou, E. Smith, G. Aux, D. Patton, J. Z. Levin, and D. Preuss
Arabidopsis hapless Mutations Define Essential Gametophytic Functions
Genetics, October 1, 2004; 168(2): 971 - 982.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
134/3/1227    most recent
pp.103.037382v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (28)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hicks, G. R.
Right arrow Articles by Raikhel, N. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hicks, G. R.
Right arrow Articles by Raikhel, N. V.
Agricola
Right arrow Articles by Hicks, G. R.
Right arrow Articles by Raikhel, N. V.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY® THE PLANT CELL
Copyright © 2004 by the American Society of Plant Biologists