Plant Physiol.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online February 12, 2004; 10.1104/pp.103.030148

Plant Physiology 134:995-1005 (2004)
© 2004 American Society of Plant Biologists

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
134/3/995    most recent
pp.103.030148v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Related articles in Plant Physiol.
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (31)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Henderson, J. T.
Right arrow Articles by Ogas, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Henderson, J. T.
Right arrow Articles by Ogas, J.
Agricola
Right arrow Articles by Henderson, J. T.
Right arrow Articles by Ogas, J.
DEVELOPMENT AND HORMONE ACTION

PICKLE Acts throughout the Plant to Repress Expression of Embryonic Traits and May Play a Role in Gibberellin-Dependent Responses1

Jim T. Henderson, Hui-Chun Li, Stanley Dean Rider, Andreas P. Mordhorst2, Jeanne Romero-Severson3, Jin-Chen Cheng, Jennifer Robey, Z. Renee Sung, Sacco C. de Vries and Joe Ogas*

Department of Biochemistry, Purdue University, West Lafayette, Indiana 47907 (J.T.H., H.-C.L., S.D.R., J.R., J.O.); Laboratory of Biochemistry, Department of Agrotechnology and Food Sciences, Wageningen University, 6703 HA Wageningen, The Netherlands (A.P.M., S.C.d.V.); Department of Forestry and Natural Resources, Purdue University, West Lafayette, Indiana 47907 (J.R.-S.); and Department of Plant and Microbial Biology, University of California, Berkeley, California 94720 (J.-C.C., Z.R.S.)


    ABSTRACT
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
A seed marks the transition between two developmental states; a plant is an embryo during seed formation, whereas it is a seedling after emergence from the seed. Two factors have been identified in Arabidopsis that play a role in establishment of repression of the embryonic state: PKL (PICKLE), which codes for a putative CHD3 chromatin remodeling factor, and gibberellin (GA), a plant growth regulator. Previous observations have also suggested that PKL mediates some aspects of GA responsiveness in the adult plant. To investigate possible mechanisms by which PKL and GA might act to repress the embryonic state, we further characterized the ability of PKL and GA to repress embryonic traits and reexamined the role of PKL in mediating GA-dependent responses. We found that PKL acts throughout the seedling to repress expression of embryonic traits. Although the ability of pkl seedlings to express embryonic traits is strongly induced by inhibiting GA biosynthesis, it is only marginally responsive to abscisic acid and SPY (SPINDLY), factors that have previously been demonstrated to inhibit GA-dependent responses during germination. We also observed that pkl plants exhibit the phenotypic hallmarks of a mutation in a positive regulator of a GA response pathway including reduced GA responsiveness and increased synthesis of bioactive GAs. These observations indicate that PKL may mediate a subset of GA-dependent responses during shoot development.


Plants exhibit distinct differentiation characteristics during seed maturation and during subsequent seedling development. During seed maturation, the plant embryo stops growing, accumulates storage reserves, and acquires desiccation tolerance (Bewley and Black, 1994Go; Goldberg et al., 1994Go; Holdsworth et al., 1999Go; Baud et al., 2002Go). At the onset of seedling development, the plant undergoes cell expansion and division, mobilizes storage reserves, and begins photosynthesis. With the advent of genomic-based approaches, we are just beginning to appreciate the large number of genes that are differentially expressed at each of these developmental stages (Girke et al., 2000Go; Gallardo et al., 2001Go, 2002Go; Ruuska et al., 2002Go).

Characterization of LEC1 (LEAFY COTYLEDON1), a gene that promotes embryonic identity in Arabidopsis, illustrates the importance of proper transcriptional regulation of stage-specific genes in specification of developmental identity. lec1 plants exhibit defective embryo development and prematurely initiate the postembryonic differentiation program (Meinke, 1992Go; Meinke et al., 1994Go; West et al., 1994Go). LEC1 codes for a putative transcriptional regulator, and the transcription of LEC1 is seed specific (Lotan et al., 1998Go). Ectopic expression of LEC1 during seedling development results in generation of supernumerary embryos on the seedling (Lotan et al., 1998Go). Thus, repression of LEC1 and analogous genes is necessary to successfully make the transition from embryonic to postembryonic development.

PKL is necessary for repression of embryonic traits in Arabidopsis seedlings. The primary roots of pkl seedlings are capable of expressing embryonic traits after germination (Ogas et al., 1997Go). pkl primary roots that express embryonic traits are referred to as "pickle roots" based on the appearance of the distal tip of the root, which is swollen and greenish. Cloning of PKL revealed that it encoded a CHD3 chromatin remodeling factor (Eshed et al., 1999Go; Ogas et al., 1999Go). In animal systems, CHD3 proteins have been shown to associate in multisubunit complexes (Mi-2 or NURD) that also contain a histone deacetylase, implying that CHD3 proteins function as negative regulators of transcription (Tong et al., 1998Go; Wade et al., 1998Go; Xue et al., 1998Go; Zhang et al., 1998Go). Consistent with such a role for CHD3 proteins in plants, pkl plants are defective in repression of LEC1; the LEC1 transcript is expressed in germinating pkl seedlings (Ogas et al., 1999Go; Rider et al., 2003Go).

Expression of embryonic identity in pkl seedlings is dependent on the plant growth regulator GA, which plays many roles in plant growth and development (Davies, 1995Go; Kende and Zeevaart, 1997Go). In particular, the ability of GA to promote germination, shoot elongation, and flowering has been characterized in many species. In pkl seedlings, GA acts to repress embryonic identity; decreasing the level of GA in germinating seeds increases the penetrance of the pickle root phenotype (Ogas et al., 1997Go). Such a role had not been observed previously for GA, suggesting that a new GA response pathway had been identified. Furthermore, the adult shoot phenotype of pkl plants is reminiscent of a plant defective in GA response: pkl plants are dark green, time to flowering is increased, and pkl plants are dwarfed (Ogas et al., 1997Go). These phenotypes suggest that PKL itself may play a role in mediating GA-dependent responses.

We sought to further investigate the relationships between PKL, GA, and repression of embryonic identity. We have found that PKL is expressed throughout the germinating seedling and that PKL plays a role in repression of embryonic traits in the cotyledons, hypocotyl, and shoot apical meristem (SAM) in addition to the primary root. Although abscisic acid (ABA) and GA act during germination to repress and promote germination, respectively, we show that expression of embryonic identity in germinating pkl seeds is much less responsive to application of ABA. In addition, we find that although a mutation of SPY completely suppresses the germination defect of a plant defective in GA biosynthesis, it only slightly suppresses the derepression of embryonic traits that occurs when GA biosynthesis is perturbed in pkl seedlings. These observations indicate that the GA response pathway that mediates repression of embryonic traits in pkl seedlings appears distinct from previously characterized GA response pathways. Furthermore, we show that pkl plants exhibit the phenotypic hallmarks of a plant that is defective in the ability to respond to GA, including reduced responsivity to GA and elevated levels of bioactive GAs.


    RESULTS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

PKL Expression in Germinating Seeds

Previous work had indicated that PKL acted before the completion of germination (which is marked by the emergence of the radicle from the seed coat) to establish repression of embryonic identity (Ogas et al., 1997Go, 1999Go). This conjecture was based in part on the observation that the LEC1 transcript was elevated in imbibed pkl seeds before germination. We analyzed PKL transcript levels in germinating seeds to determine if the PKL transcript was present before germination. Quantitative reverse transcriptase (RT)-PCR analysis was performed on total RNA isolated from desiccated seeds and from seeds that had been imbibed for up to 96 h (Fig. 1A). Germination of the seed was complete by 56 h. PKL transcript was detected in all of the samples, clearly indicating that the PKL transcript is present during imbibition before completion of germination. Furthermore, there was a significant elevation of the amount of the PKL transcript at the 36-h time point. Such a pattern of expression is consistent with the hypothesis that PKL acts during imbibition to repress transcription of LEC1.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 1. PKL is expressed throughout a germinating seed. A, Quantitative RT-PCR analysis was used to examine the PKL transcript level in desiccated seed and in seed that had been imbibed for up to 96 h. 18s rRNA was used as a standardization control, and expression levels are normalized to desiccated seed. Error bars represent the SD of the mean. B, GUS expression is detected throughout a transgenic seedling carrying the GYM::GUS reporter construct at 36 h after imbibition.

 

Previous phenotypic characterization of pkl seedlings had revealed that PKL was necessary to repress embryonic identity in the primary root (Ogas et al., 1997Go). To examine the pattern of PKL expression in germinating seeds, we made use of a GUS reporter construct fused to the PKL upstream region, GYM::GUS. The expression pattern of this construct correlates with PKL transcript accumulation as determined by in situ hybridization (Eshed et al., 1999Go). GUS was detected throughout the entirety of the germinating seedling at 12, 24, and 36 h after imbibition (Fig. 1B; data not shown).


PKL Is Necessary for Repression of Embryonic Identity throughout the Seedling

Because the pattern of GUS expression suggested that PKL is expressed throughout the seedling, we examined whether PKL might be necessary for repression of embryonic identity in other parts of the seedling in addition to the primary root. Portions of the hypocotyl and/or cotyledon of 2-week-old pkl seedlings are sometimes similar in appearance to pickle root tissue. Like pickle roots, these "pickle-like" portions of the hypocotyl and cotyledons are intensely stained by Fat Red 7B, a dye that specifically interacts with neutral lipids (Brundrett et al., 1991Go; Fig. 2, A and B). This result suggests that these organs, like pickle roots, are capable of accumulating large amounts of triacylglycerol and, thus, are capable of expressing embryonic differentiation traits in pkl seedlings after germination.



View larger version (50K):
[in this window]
[in a new window]
 
Figure 2. PKL is necessary for repression of embryonic identity throughout the seedling. Ten-day-old pkl seedlings were stained with Fat Red 7B to visualize accumulation of triacylglycerols in the cotyledons (A) and hypocotyl (B) of 14-d-old pkl seedlings. C, Fourteen-day-old wild-type seedling stained with Fat Red 7B. D, Tissue explants generated from the indicated portions of pkl, and wild-type seedlings were transferred to hormone-free synthetic media and scored for the ability to generate embryogenic callus. E, Number of cells in the L1 layer of wild-type, pkl, pt, and pkl pt SAMs was determined as was the ability of the respective SAMs to give rise to embryogenic cell lines. An asterisk denotes clusters of cells that morphologically resemble embryogenic clusters of cells but that are not capable of generating embryogenic cell lines.

 

To further examine the ability of various portions of the seedling to express embryogenic potential, we assayed for the ability of isolated organs to generate embryogenic callus in the absence of exogenous hormones. Pickle roots will produce embryogenic callus if excised from the plant and placed on hormone-free synthetic media (Ogas et al., 1997Go). We found that in addition to pickle roots, excised cotyledons and hypocotyls from pkl plants were also capable of forming embryogenic callus (Fig. 2D). In contrast, secondary roots and portions of primary root that did not visibly express embryonic traits did not form embryogenic callus. Excised portions of wild-type plants never gave rise to embryogenic callus.

We also explored the potential of the SAM of pkl seedlings to express embryonic traits by examining the ability of the pkl SAM to give rise to embryogenic cell lines. We used a protocol that was used previously to characterize the embryogenic potential of the enlarged SAMs found in the pt (primordia-timing) and in two clavata mutants (Mordhorst et al., 1998Go, 2002Go). When seeds from these mutants are germinated in liquid media containing the synthetic auxin 2,4-dichlorophenoxyacetic acid, it is possible to identify embryogenic cell clusters on the mutant SAMs. We carried out our analysis using seeds from wild-type Columbia (Col), wild-type Landsberg erecta (Ler), pt, pkl, and pt pkl plants. pt is a mutant allele of AMP1 (ALTERED MERISTEM PROGRAM1), which codes for a protein with sequence similarity to a Glu carboxypeptidase that is thought to be involved in processing a signaling molecule in plants (Helliwell et al., 2001Go), and served as a positive control that the culture conditions were satisfactory for observing generation of embryogenic cell lines.

Under these culture conditions, neither the Col nor the Ler SAMs gave rise to embryogenic clusters (Fig. 2E). In contrast, the pt and pkl SAMs were both capable of giving rise to such clusters. Although the pt seedlings had an enlarged SAM, as observed previously (Mordhorst et al., 1998Go), the pkl seedlings did not. Thus, an enlarged SAM is not a prerequisite for maintenance of embryonic identity in the pkl SAM. Double mutants between pkl and pt showed 2-fold more plants with embryogenic clusters, suggesting that pkl and pt act in two separate pathways to repress expression of embryonic potential in the SAM. All seeds were germinated in the absence of uniconazole-P. Thus, the pkl SAM is capable of expressing embryonic identity and does so in the absence of exogenous perturbation of GA biosynthesis.

In summary, all major organs that are produced during embryogenesis—the SAM, cotyledons, hypocotyl, and primary root—are impaired in repression of embryonic identity in pkl seedlings.


ABA Has a Modest Effect on the Penetrance of the Pickle Root Phenotype

ABA and GA act antagonistically with respect to germination (Hilhorst and Karssen, 1992Go; Holdsworth et al., 1999Go; Koornneef et al., 2002Go). GA promotes germination, whereas ABA promotes seed dormancy and inhibits germination. Thus, treatment of a germinating seed with uniconazole-P (an inhibitor of GA biosynthesis) or with ABA has a similar phenotypic outcome: Germination is inhibited. Because ABA- and uniconazole-P-treated wild-type seedlings exhibit similar phenotypes, we examined whether ABA, like uniconazole-P, could increase penetrance of the pickle root phenotype in germinating pkl seedlings.

We found that ABA was much less effective than uniconazole-P in increasing the penetrance of the pickle root phenotype. pkl seedlings were grown in the presence of various concentrations of uniconazole-P and ABA, and penetrance of the pickle root phenotype was determined (Fig. 3A). Although 10-7 M uniconazole-P was able to increase pickle root penetrance to greater than 80%, 10-7 M ABA only increased penetrance of the pickle root phenotype to 11%. At concentrations above these, it is not possible to determine expression of the pickle root phenotype because of the inhibitory effect of uniconazole-P or of ABA on germinating seedlings. Uniconazole-P dramatically decreases germination of both wild-type and pkl seedlings (see below), whereas ABA-treated wild-type or pkl seedlings still germinate, but subsequent development is greatly impaired (data not shown). It has been demonstrated previously that GA can suppress the ability of uniconazole-P to increase the penetrance of the pickle root phenotype and that ga1-3 pkl-1 plants exhibit higher penetrance of the pickle root phenotype in the presence of small amounts of GA (Ogas et al., 1997Go). Thus, these findings indicate that a reduced level of GA has a significantly greater effect on penetrance of the pickle root phenotype than the addition of ABA.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 3. ABA is not as effective as uniconazole-P at increasing penetrance of the pickle root phenotype. A, Plants were grown continuously in the presence of ABA or of uniconazole-P (uni-P) and scored for penetrance of the pickle root phenotype. For each treatment, 144 seeds were incubated on synthetic media containing uniconazole-P or ABA at the indicated concentrations. The pickle root phenotype was scored at 10 d.

 


A Mutation in SPY Results in a Slight Decrease in Pickle Root Penetrance

The observation that the penetrance of the pickle root phenotype is strongly responsive to GA and relatively insensitive to ABA suggested that the GA response pathway that mediates this trait might be distinct from previously characterized GA response pathways. SPY is a well-characterized negative regulator of GA-dependent responses in Arabidopsis, including germination, and codes for an O-GlcNAc transferase (Jacobsen et al., 1996Go). To investigate the potential role of SPY in the GA response pathway that mediates penetrance of the pickle root phenotype, we examined pickle root penetrance in pkl-1 spy-3 plants.

A mutation at the SPY locus suppresses the need for GA for germination (Jacobsen and Olszewski, 1993Go). One of the phenotypes of pkl-1 seedlings is that they exhibit an increase in sensitivity to inhibitors of GA biosynthesis with regards to inhibition of germination. The spy-3 mutation partially suppresses this phenotype (Fig. 4A). Although pkl-1 SPY seedlings do not germinate in the presence of 10-5 M uniconazole-P, 17% of pkl-1 spy-3 seedlings germinate. Furthermore, pkl-1 spy-3 seedlings are consistently less responsive to uniconazole-P than pkl-1 SPY seedlings with respect to the ability of uniconazole-P to promote penetrance of the pickle root phenotype (Fig. 4B).



View larger version (30K):
[in this window]
[in a new window]
 
Figure 4. spy partially suppresses the effect of uniconazole-P on the phenotype of pkl seedlings. A, spy partially suppresses the germination defect of pkl in the presence of uniconazole-P. Seeds (144) were plated with at least two replicates on synthetic media containing the indicated concentration of uniconazole-P and scored for germination at 12 d after imbibition. B, spy partially suppresses the ability of uniconazole-P to increase penetrance of the pickle root phenotype. Plants were grown continuously on synthetic media containing the indicated concentration of uniconazole-P or in the absence of uniconazole-P and scored for penetrance of the pickle root phenotype. The y axis indicates the increase in penetrance of the pickle root phenotype observed at the indicated concentration of uniconazole-P as compared with penetrance of the pickle root phenotype when seedlings were grown in the absence of uniconazole-P [y = (percentage penetrance observed when grown at x molar uniconazole-P) - (percentage penetrance observed when grown in the absence of uniconazole-P)]. For each treatment, at least 288 seedlings were examined, and the pickle root phenotype was scored at 12 d.

 

It is worth noting, however, that these effects are not nearly as dramatic as the ability of spy-3 to suppress the germination defect of a plant defective in GA biosynthesis. Both wild-type and pkl-1 seeds do not germinate in the presence of 10-5 M uniconazole-P (Fig. 4A). Although 71% of PKL-1 spy seedlings germinate under these conditions, we observed that only 17% of the pkl-1 spy-3 seedlings germinated. Similarly, pkl-1 SPY seedlings grown on 10-8 M uniconazole-P exhibit an increase in percent penetrance of the pickle root phenotype of 74%, whereas pkl-1 spy-3 seedlings grown on 10-8 M uniconazole-P still exhibit an increase in penetrance of 56% (Fig. 4B). These observations indicate that a mutant allele of SPY has a modest effect on the GA response pathways that govern germination and repression of embryonic identity in pkl-1 seedlings.


Characterization of GA-Dependent Responses in the pkl Shoot

Previous analysis of the adult phenotype of pkl plants revealed that they exhibit many phenotypes that are exhibited by plants that are defective in some aspect of GA biosynthesis or response. These observations suggest that PKL itself may plan a role in GA-dependent responses. An alternative hypothesis is that the shoot phenotypes exhibited by pkl plants are nonspecific consequences of a general alteration in transcriptional regulation. In an attempt to address whether the adult phenotypes exhibited by pkl plants are specifically because of a defect in some aspect of GA physiology, we examined the possibility that exogenous application of large amounts of GA might rescue some of the mutant phenotypes exhibited by adult pkl plants.

pkl plants are late-flowering dwarfs (Ogas et al., 1997Go). GA promotes the transition from vegetative to floral development in Arabidopsis, in part through promoting transcription of the floral regulator LEAFY (Blazquez et al., 1998Go; Blazquez and Weigel, 2000Go; Mouradov et al., 2002Go). To determine if exogenous application of GA might rescue the shoot phenotype of pkl plants, pkl and wild-type plants were grown in 18-h days and sprayed with GA or a mock solution (Fig. 5A). In the absence of GA, pkl plants flowered at 38.6 d, and wild-type plants flowered at 28.3 d. Application of GA3 reduced the flowering time of pkl plants to 30.3 d and of wild-type plants to 24.3 d. This effect on flowering time can also be followed by looking at the number of rosette leaves that are produced by the plants (Fig. 5B). In the absence of exogenous GA, pkl plants possessed 22.6 rosette leaves upon flowering, and wild-type plants possessed 13.3 leaves. Application of GA3 reduced the number of rosette leaves to 11.8 leaves for pkl plants and to 8.0 leaves for wild-type plants.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 5. GA-dependent responses are altered in pkl plants. A, Hypocotyl length was determined at the indicated GA concentrations in ga1 and ga1 pkl seedlings. The equations for the linear regressions are as follows: for ga1, y = 2.0 + 0.10 Ln(x), R2 = 0.97, indicated by a solid line; and for ga1 pkl, y = 1.0 + 0.04 Ln(x), R2 = 0.95, indicated by a dotted line. The values plotted are the mean ± SE of >=18 seedlings for which the hypocotyl length was determined. Flowering time is defined as the number of days from imbibition to the opening of the first flower. Flowering time (B), number of rosette leaves (C), and height (D) were determined for pkl and wild-type plants grown in the presence or absence of GA. The values plotted are the mean ± SD of 20 plants measured.

 

As noted above, GA promotes flowering; thus, it is not surprising that pkl plants flower in less time when sprayed with GA. The wild-type plants also flower in less time when sprayed with GA. The response of pkl plants, however, is significantly greater than that of wild-type plants with respect to flowering time and the number of rosette leaves (P < 0.0001). Application of GA3 reduced flowering time by 22% for pkl plants and by only 14% for wild-type plants. Similarly, application of GA3 reduced the number of rosette leaves by 48% for pkl plants and by 40% for wild-type plants.

Exogenous application of GA also partially rescued the reduced height of pkl plants, another phenotypic trait that is GA dependent. pkl and wild-type plants were grown as described above, and the height of the plants was measured (Fig. 5D). In the absence of GA, pkl plants attained a height of 29.9 cM, and wild-type plants attained a height of 55.7 cM. Application of GA3 increased the height of pkl plants to 45.4 cM and that of wild-type plants to 62.1 cM. As before, GA has a significantly greater effect on pkl plants than on wild-type plants (P < 0.0001). Application of GA3 increases the height of pkl plants by 52%, whereas the height of wild-type plants is only increased by 11%.

The ability of exogenous application of GA to partially rescue the shoot phenotype of pkl plants is consistent with a positive role for PKL in some aspect of GA biosynthesis or response. We specifically examined the effect of PKL on GA responsivity by examining the effect of the pkl mutation on hypocotyl elongation, a classic GA-dependent trait. ga1-3 PKL and ga1-3 pkl-1 seedlings were grown in the presence of various concentrations of GA3, and the length of the hypocotyl was determined. Although both lines exhibited a linear response to GA3 between 5 x 10-8 and 10-5 M, the slope of the lines were significantly different (P < 0.0007; Fig. 5A). The ga1-3 pkl-1 hypocotyls were only about one-half as responsive as the ga1-3 PKL hypocotyls to GA3. Saturation of the response occurred between 5x 10-5 and 1x 10-4 M (data not shown). At saturating concentrations of GA3, ga1-3 PKL hypocotyls were 2.0 mm in length, whereas the ga1-3 pkl-1hypocotyls were only 1.1 mm in length. The observed decrease in responsivity of hypocotyl elongation to GA exhibited by ga1-3 pkl-1 plants is unlikely to be a nonspecific effect of being derived from a mixed Col/Ler background. A ga1-3 PKL Ler line and a ga1-3 PKL Ler/Col line do not respond differently to the GA3 treatment gradient (P = 0.68; data not shown).

In light of the hypocotyl elongation results, it is intriguing to note that pkl seeds exhibit an increased sensitivity to uniconazole-P relative to wild-type seeds with respect to inhibition of germination (Fig. 4A). Thus pkl seeds also exhibit a phenotype consistent with a defect in GA response during germination.


Characterization of GA Biosynthesis in the pkl Shoot

Although elongation of pkl hypocotyls exhibits reduced responsivity to GA, this observation does not rule out the hypothesis that PKL also plays a role in biosynthesis of GA. The ability of GA to partially rescue some of the mutant shoot phenotypes of pkl plants is consistent with the possibility that PKL, a putative transcriptional regulator, promotes transcription of one or more GA biosynthetic genes and, therefore, is necessary for biosynthesis of wild-type levels of GA. We assayed endogenous GAs in pkl and wild-type plants to test this hypothesis. We found no evidence that pkl plants were defective in any step of the GA biosynthetic pathway. Instead, pkl plants possessed increased levels of bioactive GAs, indicating that the phenotypes exhibited by pkl plants are a result of a defect in the ability to respond to GA.

Table I summarizes the results of our analysis. Levels of GAs were determined by gas chromatography-mass spectrometry. The GAs in the top portion of the table are in the early 13-hydroxylation pathway, whereas the GAs in the bottom portion are in the non-13-hydroxylation pathway. GA4 is the primary bioactive GA in Arabidopsis (Talon et al., 1990). The results revealed that pkl plants are not defective in GA biosynthesis. We instead found that the amounts of C20-GAs were decreased in pkl, whereas the amounts of C19-GAs—including GA4—were increased. This experiment was repeated with similar results (data not shown). This pattern of accumulation of GAs is similar to that observed in gai plants, which are defective in perception of GA (Koorneef et al., 1985Go; Peng et al., 1997Go). Although the magnitude of the perturbation is more severe in gai plants (GA4 has been reported to be elevated more than 20-fold, Talon et al., 1990; or 5-fold, Peng et al., 1999Go; in gai but is elevated only 60% in pkl-1), the overall trend of accumulation of GAs in pkl plants suggests that PKL is somehow involved in perception of GA.


View this table:
[in this window]
[in a new window]
 
Table I. GA content of wild-type Columbia and two pkl lines Nos. indicate nanograms of different GAs per gram dry wt. C20-GAs are listed above the dotted line, whereas C19-GAs are listed below the dotted line. GAs from the 13-hydroxlation pathway GA53 -> GA44 -> GA19 -> GA20 -> GA1 -> GA8 and from the non-13-hydroxylation pathway GA12 -> GA15 -> GA24 -> GA9 -> GA4 -> GA34 were analyzed. GA1 and GA4 are bioactive GAs, whereas the other GAs are precursors or deactivated GAs.

 

Transcript levels of AtGA3ox1 (GA4) and AtGA20ox1 (GA5), which code for enzymes involved in GA biosynthesis, are subject to negative feedback regulation by GA (Chiang et al., 1995Go; Phillips et al., 1995Go; Xu et al., 1995Go,1999Go; Cowling et al., 1998Go). Although gai plants accumulate increased amounts of bioactive GAs, the level of the AtGA20ox1 transcript is increased in gai plants (Xu et al., 1995Go; Peng et al., 1997Go). This observation supports the hypothesis that GAI is involved in feedback regulation of GA biosynthesis and that a defect in feedback regulation in gai plants may contribute to the elevated levels of bioactive GAs observed in gai plants. We examined the transcript levels of AtGA3ox1 and AtGA20ox1 in pkl plants to determine if they were similarly elevated.

We compared the relative transcript levels of AtGA3ox1 and AtGA20ox1 by quantitative RT-PCR in leaves from wild-type and pkl plants that had just began bolting (Fig. 6). We observed that the level of the AtGA3ox1 transcript was reduced 2-fold in pkl plants relative to wild-type plants, whereas the AtGA20ox1 transcript was reduced 3-fold. Thus, although both pkl and gai accumulate increased levels of C19-GAs, these data suggest that PKL is not involved in the feedback regulation of the transcript levels of GA biosynthetic enzymes.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 6. The AtGA20ox1 and AtGA3ox1 transcript levels are reduced in pkl leaves. Quantitative RT-PCR was used to determine the relative transcript level of AtGA20ox1 and AtGA3ox1 in wild-type leaves and pkl leaves. 18s rRNA was used as a standardization control, and expression levels are normalized to pkl leaves. Error bars = SD of the mean.

 


    DISCUSSION
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

PKL Plays a Positive Role in GA-Dependent Responses

Our observations reveal that pkl plants exhibit two phenotypic hallmarks that are strongly associated with a defect in the ability of the plant to respond to GA. Hypocotyl elongation in pkl seedlings exhibits reduced responsivity to GA (Fig. 5D). pkl shoots accumulate C19-GAs, including the bioactive GA4 (Table I), in a manner similar to gai plants, which are defective in perception of GA. In addition, we find that shoot phenotypes of pkl plants are partially rescued by exogenous application of GA (Fig. 5, A–C). Rescue of a mutant phenotype by exogenous application of GA in a plant that is deficient in a factor that promotes a GA-dependent response has precedent. GA promotes flowering, in part by promoting transcription of LFY, a floral meristem identity gene that is necessary for the transition to flowering (Blazquez et al., 1998Go; Blazquez and Weigel, 2000Go; Mouradov et al., 2002Go). Exogenous application of GA can partially rescue the floral reversion phenotype exhibited by an lfy-6/+ plant grown under short-day conditions (Okamuro et al., 1996Go).

Surprisingly, we also observed that transcript levels of AtGA3ox1 and AtGA20ox1 were decreased in pkl plants. A similar decrease in AtGA20ox1 transcript level in pkl leaves has been reported previously (Hay et al., 2002Go). Transcript levels of both AtGA3ox1 and AtGA20ox1 is subject to feedback regulation; the mRNA level of both genes is reduced with the addition of GA (Chiang et al., 1995Go; Phillips et al., 1995Go; Xu et al., 1995Go, 1999Go; Cowling et al., 1998Go). Our interpretation of these observations (increased bioactive GAs and decreased transcript levels of AtGA3ox1 and AtGA20ox1) is that PKL plays a role in GA homeostasis but is not necessary for feedback regulation of transcript levels. Examination of the effect of exogenous GA application on AtGA3ox1 and AtGA20ox1 transcript levels in pkl plants would help to further address this possibility.

The combination of all these observations strongly suggests that pkl plants are defective in some aspect of GA response, presumably as a result of a defect in transcriptional regulation.


The GA Response Pathway That Mediates Repression of Embryonic Identity in pkl Seedlings May Be Distinct from Previously Characterized GA Response Pathways

Penetrance of the pickle root phenotype has been demonstrated previously to be dependent on GA (Ogas et al., 1997Go). If GA levels are not perturbed in pkl seedlings, penetrance of the pickle root phenotype typically ranges from 1% to 5%. Reducing GA levels before germination results in increasing the penetrance of the pickle root phenotype to greater than 80%. We have now tested the ability of ABA, another hormone that regulates germination, to affect pickle root penetrance. We observed that application of ABA had only a modest effect on penetrance of the pickle root phenotype (Fig. 3A). The same held true even if ABA was specifically applied during that time at which penetrance of the pickle root phenotype is most responsive to uniconazole-P (data not shown). These observations indicate that penetrance of the pickle root phenotype is substantially less responsive to application of ABA than to inhibition of GA biosynthesis. Furthermore, given that treatment with either uniconazole-P or ABA inhibits germination, the observation that treatment with uniconazole-P has a much greater effect on pickle root penetrance suggests that the ability of uniconazole-P to affect pickle root penetrance is not simply a consequence of decreasing the rate of germination.

The ability of GA to promote germination is antagonized by ABA (Hilhorst and Karssen, 1992Go; Holdsworth et al., 1999Go; Koornneef et al., 2002Go). The observation that penetrance of the pickle root phenotype is much less responsive to application of ABA than to inhibition of GA biosynthesis suggests that the GA response pathway that mediates repression of embryonic identity in pkl seedlings is distinct from previously characterized GA response pathways that function during germination. Our analysis of pickle root penetrance in pkl spy plants is consistent with this hypothesis. The spy mutation suppresses the need for GA for germination; spy ga1 seed can germinate in the absence of GA (Jacobsen and Olszewski, 1993Go). We observed that mutating SPY only weakly suppresses the ability of uniconazole-P to increase pickle root penetrance in pkl seedlings (Fig. 4B). This result thus also suggests that the GA response pathway that mediates repression of embryonic identity in pkl seedlings is distinct from the GA response pathway that mediates germination.

It is not yet known how this PKL-independent pathway mediates repression of embryonic identity. One possibility is that this alternative pathway utilizes one of the other three CHD genes present in Arabidopsis. Analysis of transcript levels of the three CHD genes, however, reveals that the transcript level of all three genes is neither PKL dependent nor effected by the presence of 10-8 M uniconazole-P during germination (D. Rider, unpublished data).


PKL Is Necessary for Repression of Embryonic Identity throughout the Germinating Seedling

Previous characterization of the differentiation state of the pkl seedling focused on the pickle root phenotype, which was shown to result from derepression of embryonic identity in the primary root. We have now shown that all major organs derived during embryogenesis are capable of expressing embryonic traits in pkl seedlings (Fig. 2). Thus, PKL apparently functions throughout the organism to repress the potential to express the embryonic state. Consistent with this hypothesis, we observe that a PKL transcriptional reporter is expressed throughout a germinating seedling (Fig. 1B).

An intriguing observation regarding the embryogenic potential of the pkl SAM is that it is possible to generate embryogenic cell lines in the absence of uniconazole-P. These data are consistent with observations that the LEC class of embryonic regulators are derepressed in germinating pkl seedlings in the absence of uniconazole-P (Rider et al., 2003Go). Our interpretation of these results is that derepression of LEC and related genes in pkl seeds during germination creates the potential for generation of embryonic traits but does not ensure the subsequent expression of this potential. In the presence of other factors, however, it is possible to greatly increase the number of seedlings in which embryonic traits continue to be derepressed after germination. Thus addition of 1 x 10-8 M uniconazole-P during germination facilitates expression of the pickle root phenotype in roots, whereas addition of 4.5 x 10-6 M 2,4-dichlorophenoxyacetic acid allows generation of embryogenic cell lines in the SAM.

It still remains to be determined when PKL acts to repress gene expression. The transcript level of LEC1 is PKL-dependent and is elevated in pkl seedlings between 24 and 36 h after imbibition (Ogas et al., 1997Go; Rider et al., 2003Go). This observation suggests that PKL acts before this time to repress transcription of genes. We have now observed that transcript levels of PKL peak during imbibition before completion of germination (Fig. 1A). The timing of the increase in PKL transcript level is consistent with the hypothesis that PKL acts during this time to mediate repression of embryonic identity, presumably through the repression of transcription of genes such as LEC1. Further testing of this hypothesis will require identification of that time at which PKL binds to its presumptive targets by using chromatin immunoprecipitation or a related biochemical approach.


PKL, GA, and Repression of Embryonic Identity

We have shown that PKL is necessary for wild-type GA-dependent responses in the shoot. We also have shown that PKL acts throughout the germinating seedling to repress expression of embryonic traits. Expression of these traits in pkl seedlings is likely to be a consequence of the failure to repress expression of the LEC genes during germination (Rider et al., 2003Go). We propose that the dual roles of PKL in repression of embryonic identity and in promoting GA-dependent shoot responses are two aspects of the same activity; GA-dependent repression of the transcriptional activity of target genes via a CHD3 chromatin remodeling factor. Thus, we propose that that PKL mediates GA-dependent repression of some seed-specific genes during germination, including the repression of genes such as LEC1 that promote embryonic identity. We also propose that there is a PKL-independent pathway by which GA acts to repress expression of embryonic traits because GA can act in the absence of PKL to repress expression of the pickle root phenotype (Ogas et al., 1997Go).

A corollary of this hypothesis is that GA acts via PKL to repress transcription of certain genes in the adult plant as well. It is well known that GA promotes various developmental transitions in the plant. Such transitions are likely to involve transcriptional repression of various genes in addition to activation of others. Based on the characterization of the expression of genes that are inappropriately expressed during germination of pkl seeds (Rider et al., 2003Go), our prediction is that stage-specific restriction of developmental regulators is lost during other stages of pkl shoot development as well. Thus, the phenotype of pkl adult plants is a result of the failure to restrict genes to their normal developmental window. An implicit assumption of this hypothesis is that there are other GA response pathways that function in pkl plants but in an inappropriate developmental context as a result of the failure to repress various regulators. It remains to be determined what contribution, if any, is made to the pkl shoot phenotype by the seed-specific genes that exhibit elevated expression during germination of pkl seeds. Transcripts for LEC1 and LEC2 are not elevated in pkl leaves, but the FUS3 transcript is elevated almost 6-fold (Rider et al., 2003Go). Overexpression of FUS under the control of the cauliflower mosaic virus 35S promoter, however, was not reported to generate a GA-deficient phenotype (Luerssen et al., 1998Go).

Because pkl plants exhibit a phenotype that is strikingly similar to a defect in the ability to respond to GA, we have assumed in our model that PKL activity is in some way responsive to GA. It is important to note, however, that no data have been presented that shows a direct link between PKL activity and GA. As a consequence, an alternative hypothesis is that PKL functions in a GA-independent manner during germination and during subsequent shoot development. Thus, repression of LEC1 may be a PKL-dependent but GA-independent event. Similarly, PKL may be necessary to provide a proper developmental context for GA response pathways in the shoot, for example by repressing expression of one or more factors that would otherwise inhibit GA-dependent responses. It is important to note that this hypothesis does not presuppose that the normal role of these PKL-repressed factors is to act as an inhibitor of GA response when they are expressed in their proper developmental context. For example, perhaps the reduced elongation of pkl hypocotyls is because of inappropriate expression of cell wall factors that are intrinsically less able to promote cell wall expansion. Further experiments will be necessary to distinguish between these two hypotheses regarding the relationship between GA and PKL by determining if PKL expression and/or activity are GA dependent.

There is little evidence to indicate whether GA- and PKL-dependent response pathways analogous to those that act during germination are functioning in shoot development after germination. PKL has been demonstrated to play a role in repression of meristematic activity in the shoot (Eshed et al., 1999Go; Ori et al., 2000Go). It is unknown whether or not this activity is GA-dependent. It is intriguing to note, however, that genes that promote meristematic activity also down-regulate expression of genes involved in GA biosynthesis and that up-regulation of GA signaling results in decreased meristematic activity of mutationally compromised meristems (Hay et al., 2002Go). Thus, PKL and GA both act as negative regulators with respect to expression of meristematic activity in the shoot, an observation that is consistent with the hypothesis that PKL activity may be GA dependent in this context as well.

The proposed role for PKL as a hormone-dependent chromatin remodeling factor that mediates developmental transitions is not without parallel in animal systems. A CHD3 gene has been shown to play a strikingly similar role to PKL in Caenorhabditis elegans development (Unhavaithaya et al., 2002Go). Germline and somatic cells are segregated early during embryogenesis and express dramatically different differentiation programs. In worms that lack the CHD3 protein LET-418/Mi-2, somatic cells inappropriately continue to express germline traits. There is no evidence in this circumstance that the repressive activity is hormone dependent. In human (Homo sapiens) breast epithelial cells, however, the action of a CHD3 complex has been demonstrated to be hormone dependent for at least one locus (Fujita et al., 2003Go). The transcriptional repressor Snail acts as a master regulator of epithelial to mesenchymal transitions. The CHD3-containing Mi-2/NuRD complex mediates repression of Snail in an estrogen-dependent manner. Thus, the basic role of CHD3 proteins appears well conserved in both plants and animals. We anticipate that continued characterization of PKL-mediated events in Arabidopsis is likely to shed further light on how CHD3 proteins mediate transitions between developmental stage-specific transcription programs in eukaryotes.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Plant Material and Growth Conditions

pkl-1 (Ogas et al., 1997Go), pkl-3, and spy-3 (Jacobsen and Olszewski, 1993Go) are in the Col background. ga1-3 (Koorneef et al., 1983Go), gai (Koorneef et al., 1985Go), and pt (Vizir et al., 1995Go) are in the Ler background. Plants and plant explants were grown on synthetic media as previously described (Ogas et al., 1997Go). The pickle root phenotype was scored based on inspection under the dissection microscope. For hypocotyl dose response curves, seeds were plated and then incubated for 5 d at 4°C in the dark. Plates were then placed in a vertical position in a Percival CU36L5 incubator (Percival Scientific Inc., Perry, IA). Pictures of the plants were taken at 7 d after radicle emergence, and the hypocotyl length was determined using NIH Image software (National Institutes of Health, Bethesda, MD). Plants that were examined for GA-dependent shoot phenotypes were grown in a walk-in chamber with 16 h of illumination (110–150 µE m-2 s-1) at 22°C. Plants were sprayed with an aqueous solution containing 100 µM GA3 and 0.05% (v/v) Tween 20 or with a mock solution containing 0.05% (v/v) Tween 20 twice a week. Flowering was scored as the number of days until the first flower opened.


GUS and Fat Red Staining

GUS staining was done as described by Hemerly et al. (1993Go). Staining with Fat red 7B was carried out as described previously (Ogas et al., 1997Go).


Determination of Embryogenic Potential of pkl and Wild-Type Tissue

Explants were isolated from plants that were grown on one-half-strength Murashige and Skoog medium under 8 h of light for 2 weeks. Explants of hypocotyl, cotyledon, and root parts, swollen or normal, were then excised and placed on Murashige and Skoog agar medium at 24°C. To assay for embryogenic ability, explants were transferred into liquid Murashige and Skoog medium and shaken at 110 rpm at 24°C. In 1 to 3 weeks, embryos will appear from cultures containing embryogenic explants. Embryogenic cell lines were established from the SAM of seedlings as described previously (Mordhorst et al., 1998Go). The number of cells in the L1 layer of the SAM as a measurement of the SAM size was analyzed in whole-mount preparations of mature embryos as described previously (Mordhorst et al., 1998Go).


Statistical Analysis of GA-Dependent Traits

The effect of genotype and GA on the response variables flowering time and height was analyzed using ANOVA for a completely random design in which each of the four treatment classes (WT + GA3, WT + mock solution, pkl + GA3, and pkl + mock solution) contained five pots of four plants each. Pots were randomly arranged in the growth chamber. The model included the effect of genotype, GA treatment, and the interaction between genotype and GA treatment. A significant interaction in this simple design means that the response surface of WT plants to GA3 differs from the response surface of pkl plants to GA3 for variable tested. The effect of genotypes GA1 pkl-1 and ga1-3 pkl-1 on hypocotyl response to exogenous GA was analyzed with a general linear model procedure, a generalized form of the ANOVA that can handle unbalanced data. In both analyses, tests of the response surface indicated that a simple linear model best explained the observed responses. Thus, a significant interaction between genotype and GA treatment means that the slope of the line for one genotype is significantly different from the slope of the line for the other genotype. The analyses were performed using SAS Proprietary Software Release 8.2 (SAS Institute Inc., Cary, NC).


Quantification of GAs

Plants were initially grown in 9-h photoperiods until large rosettes had developed. For 4 d before harvesting the rosettes, the 15-h dark period was replaced with light from incandescent bulbs at approximately 10 µmol m-2 s-1. The entire rosettes (minus senescing yellow old leaves) were harvested and used for GA analysis. GAs were extracted, purified, and quantified as previously described (Talon et al., 1990aGo).


RNA Isolation and Quantitative RT-PCR Analysis

RNA isolation and quantitative RT-PCR analysis was carried out as described previously using the ABI Prism 7000 Sequence Detection System (Applied Biosystems, Foster City, CA; Rider et al., 2003Go). The 18s ribosomal RNA forward and reverse primers were 5'TCCTAGTAAGCGCGAGTCATCA3' and 5'GAACACTTCACCGGATCAT3', respectively. Primers used for the PKL transcript were 5'CTCATTCCGCATTTGGTAATTG 3' and 5'GCCCATGTGGCAAACTCTCT 3'. The GA4 forward primer sequence was 5'CACCGCGCTCGGGTTA3', and the reverse primer sequence was 5'CAGATTGCGGACCCCAAA3'. The GA5 forward primer sequence was 5'CCCTTTCTTTCCGGTTTTGC3', and the reverse primer sequence was 5'CAACGCATCGCAGAAGTAATCT3'. Optimal final concentrations for primers used for 18s, PKL, and GA4 were 900 nM for the forward primer and 900 nM for the reverse primer. Primer concentrations for GA5 were 900 and 300 nM for the forward and reverse primers, respectively.


    ACKNOWLEDGMENTS
 
We thank Chris Somerville for the use of facilities at the Carnegie Institute of Washington, Department of Plant Biology (Stanford, CA). We thank Jan Zeevaart (East Lansing, MI) for analysis of GA content of plants. We thank Yuval Eshed (UC Davis, Davis, CA) and John Bowman (UC Davis, Davis, CA) for sharing the GYM::GUS reporter construct. We thank the Arabidopsis Biological Resource Center (Ohio State) for distribution of Arabidopsis seed lines. We also thank the reviewers for providing such thoughtful suggestions for the paper.

Received July 14, 2003; returned for revision August 19, 2003; accepted November 21, 2003.


    FOOTNOTES
 
Article, publication date, and citation information can be found at http://www.plantphysiol.org/cgi/doi/10.1104/pp.103.030148.

1 This work was supported by the National Institutes of Health (grant no. R01GM059770–01A1 to J.O.), by the Indiana 21st Century Research and Development Fund (to J.R.S.), and by BASF (to J.O.). This is journal paper no. 17189 of the Purdue University Agricultural Experiment Station. Back

2 Present address: Nunhems Zaden B.V., P.O. Box 4005, 6080 AA Haelen, The Netherlands. Back

3 Present address: 327 Galvin Life Sciences, University of Notre Dame, Notre Dame, IN 46556. Back

* Corresponding author; e-mail ogas{at}purdue.edu; fax 765–494–7897.


    LITERATURE CITED
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Baud S, Boutin JP, Miquel M, Lepiniec L, Rochat C (2002) An integrated overview of seed development in Arabidopsis thaliana ecotype WS. Plant Physiol Biochem 40: 151-160[CrossRef][Web of Science]

Bewley JD, Black M (1994) Seeds: Physiology of Development and Germination, Ed 2. Plenum Press, New York

Blazquez MA, Green R, Nilsson O, Sussman MR, Weigel D (1998) Gibberellins promote flowering of Arabidopsis by activating the LEAFY promoter. Plant Cell 10: 791-800[Abstract/Free Full Text]

Blazquez MA, Weigel D (2000) Integration of floral inductive signals in Arabidopsis. Nature 404: 889-892[CrossRef][Medline]

Brundrett MC, Kendrick B, Peterson CA (1991) Efficient lipid staining in plant material with Sudan red 7B or fluoral yellow 088 in polyethylene glycol-glycerol. Biotechnol Histochem 66: 111-116

Chiang HH, Hwang I, Goodman HM (1995) Isolation of the Arabidopsis GA4 locus. Plant Cell 7: 195-201[Abstract]

Cowling RJ, Kamiya Y, Seto H, Harberd NP (1998) Gibberellin dose-response regulation of GA4 gene transcript levels in Arabidopsis. Plant Physiol 117: 1195-1203[Abstract/Free Full Text]

Davies PJ, editor (1995) Plant Hormones: Physiology, Biochemistry and Molecular Biology. Kluwer Academic Publishers, Dordrecht, The Netherlands

Eshed Y, Baum SF, Bowman JL (1999) Distinct mechanisms promote polarity establishment in carpels of Arabidopsis. Cell 99: 199-209[CrossRef][Web of Science][Medline]

Fujita N, Jaye DL, Kajita M, Geigerman C, Moreno CS, Wade PA (2003) MTA3, a Mi-2/NuRD complex subunit, regulates an invasive growth pathway in breast cancer. Cell 113: 207-219[CrossRef][Web of Science][Medline]

Gallardo K, Job C, Groot SP, Puype M, Demol H, Vandekerckhove J, Job D (2001) Proteomic analysis of Arabidopsis seed germination and priming. Plant Physiol 126: 835-848[Abstract/Free Full Text]

Gallardo K, Job C, Groot SP, Puype M, Demol H, Vandekerckhove J, Job D (2002) Proteomics of Arabidopsis seed germination: a comparative study of wild-type and gibberellin-deficient seeds. Plant Physiol 129: 823-837[Abstract/Free Full Text]

Girke T, Todd J, Ruuska S, White J, Benning C, Ohlrogge J (2000) Microarray analysis of developing Arabidopsis seeds. Plant Physiol 124: 1570-1581[Abstract/Free Full Text]

Goldberg RB, de Paiva G, Yadegari R (1994) Plant embryogenesis: zygote to seed. Science 266: 605-614[Abstract/Free Full Text]

Hay A, Kaur H, Phillips A, Hedden P, Hake S, Tsiantis M (2002) The gibberellin pathway mediates KNOTTED1-type homeobox function in plants with different body plans. Curr Biol 12: 1557-1565[CrossRef][Web of Science][Medline]

Helliwell CA, Chin-Atkins AN, Wilson IW, Chapple R, Dennis ES, Chaudhury A (2001) The Arabidopsis AMP1 gene encodes a putative glutamate carboxypeptidase. Plant Cell 13: 2115-2125[Abstract/Free Full Text]

Hemerly AS, Ferreira P, de Almeida Engler J, Van Montagu M, Engler G, Inze D (1993) cdc2a expression in Arabidopsis is linked with competence for cell division. Plant Cell 5: 1711-1723[Abstract]

Hilhorst HWM, Karssen CM (1992) Seed dormancy and germination: the role of abscisic acid and gibberellins and the importance of hormone mutants. Plant Growth Reg 11: 225-238[CrossRef][Web of Science]

Holdsworth M, Kurup S, McKibbin R (1999) Molecular and genetic mechanisms regulating the transition from embryo development to germination. Trends Plant Sci 4: 275-280[CrossRef][Web of Science]

Jacobsen SE, Binkowski KA, Olszewski NE (1996) SPINDLY, a tetratricopeptide repeat protein involved in gibberellin signal transduction in Arabidopsis. Proc Natl Acad Sci U S A 93: 9292-9296[Abstract/Free Full Text]

Jacobsen SE, Olszewski NE (1993) Mutations at the SPINDLY locus of Arabidopsis alter gibberellin signal transduction. Plant Cell 5: 887-896[Abstract/Free Full Text]

Kende H, Zeevaart JAD (1997) The five "classical" plant hormones. Plant Cell 9: 1197-1210[CrossRef][Web of Science][Medline]

Koorneef M, Elgersma A, Hanhart CJ, van Loenen-Martinet EP, van Rijn L, Zeevaart JAD (1985) A gibberellin insensitive mutant of Arabidopsis thaliana. Physiol Plant 65: 33-39[CrossRef]

Koornneef M, Bentsink L, Hilhorst H (2002) Seed dormancy and germination. Curr Opin Plant Biol 5: 33-36[CrossRef][Web of Science][Medline]

Koorneef M, van Eden J, Hanhart CJ, de Jongh AMM (1983) Genetic fine-structure of the GA-1 locus in the higher plant Arabidopsis thaliana (L.) Heynh. Genet Res Camb 41: 57-68

Lotan T, Ohto M, Yee KM, West MA, Lo R, Kwong RW, Yamagishi K, Fischer RL, Goldberg RB, Harada JJ (1998) Arabidopsis LEAFY COTYLEDON1 is sufficient to induce embryo development in vegetative cells. Cell 93: 1195-1205[CrossRef][Web of Science][Medline]

Luerssen H, Kirik V, Herrmann P, Misera S (1998) FUSCA3 encodes a protein with a conserved VP1/AB13-like B3 domain which is of functional importance for the regulation of seed maturation in Arabidopsis thaliana. Plant J 15: 755-764[CrossRef][Web of Science][Medline]

Meinke DW (1992) A homeotic mutant of Arabidopsis thaliana with leafy cotyledons. Science 258: 1647-1650[Abstract/Free Full Text]

Meinke DW, Franzmann LH, Nickle TC, Yeung EC Leafy cotyledon mutants of Arabidopsis. Plant Cell 6: 1049-1064, 1994[Abstract]

Mordhorst AP, Hartog MV, El Tamer MK, Laux T, de Vries SC (2002) Somatic embryogenesis from Arabidopsis shoot apical meristem mutants. Planta 214: 829-836[CrossRef][Web of Science][Medline]

Mordhorst AP, Voerman KJ, Hartog MV, Meijer EA, van Went J, Koornneef M, de Vries SC (1998) Somatic embryogenesis in Arabidopsis thaliana is facilitated by mutations in genes repressing meristematic cell divisions. Genetics 149: 549-563[Abstract/Free Full Text]

Mouradov A, Cremer F, Coupland G (2002) Control of flowering time: interacting pathways as a basis for diversity. Plant Cell Suppl 14: S111-130[Free Full Text]

Ogas J, Cheng J-C, Sung ZR, Somerville C (1997) Cellular differentiation regulated by gibberellin in the Arabidopsis thaliana pickle mutant. Science 277: 91-94[Abstract/Free Full Text]

Ogas J, Kaufmann S, Henderson J, Somerville C (1999) PICKLE is a CHD3 chromatin-remodeling factor that regulates the transition from embryonic to vegetative development in Arabidopsis. Proc Natl Acad Sci USA 96: 13839-13844[Abstract/Free Full Text]

Okamuro JK, den Boer BG, Lotys-Prass C, Szeto W, Jofuku KD (1996) Flowers into shoots: photo and hormonal control of a meristem identity switch in Arabidopsis. Proc Natl Acad Sci USA 93: 13831-13836[Abstract/Free Full Text]

Ori N, Eshed Y, Chuck G, Bowman JL, Hake S (2000) Mechanisms that control knox gene expression in the Arabidopsis shoot. Development 127: 5523-5532[Abstract]

Peng J, Carol P, Richards DE, King KE, Cowling RJ, Murphy GP, Harberd NP (1997) The Arabidopsis GAI gene defines a signaling pathway that negatively regulates gibberellin responses. Genes Dev 11: 3194-3205[Abstract/Free Full Text]

Peng J, Richards DE, Moritz T, Cano-Delgado A, Harberd NP (1999) Extragenic suppressors of the Arabidopsis gai mutation alter the dose-response relationship of diverse gibberellin responses. Plant Physiol 119: 1199-1208[Abstract/Free Full Text]

Phillips AL, Ward DA, Uknes S, Appleford NE, Lange T, Huttly AK, Gaskin P, Graebe JE, Hedden P (1995) Isolation and expression of three gibberellin 20-oxidase cDNA clones from Arabidopsis. Plant Physiol 108: 1049-1057[Abstract]

Rider SD, Henderson JT, Jerome RE, Edenberg HJ, Romero-Severson J, Ogas J (2003) Coordinate repression of regulators of embryonic identity by PICKLE during germination in Arabidopsis. Plant J 35: 33-43[CrossRef][Web of Science][Medline]

Ruuska SA, Girke T, Benning C, Ohlrogge JB (2002) Contrapuntal networks of gene expression during Arabidopsis seed filling. Plant Cell 14: 1191-1206[Abstract/Free Full Text]

Talon M, Koornneef M, Zeevaart JA (1990a) Endogenous gibberellins in Arabidopsis thaliana and possible steps blocked in the biosynthetic pathways of the semidwarf ga4 and ga5 mutants. Proc Natl Acad Sci USA 87: 7983-7987[Abstract/Free Full Text]

Talon M, Koornneef M, Zeevaart JAD (1990b) Accumulation of C19-gibberellins in the gibberellin-insensitive dwarf mutant gai of Arabidopsis thaliana (L.) Hehyn. Planta 182: 501-505[CrossRef]

Tong JK, Hassig CA, Schnitzler GR, Kingston RE, Schreiber SL (1998) Chromatin deacetylation by an ATP-dependent nucleosome remodelling complex. Nature 395: 917-921[CrossRef][Medline]

Unhavaithaya Y, Shin TH, Miliaras N, Lee J, Oyama T, Mello CC (2002) MEP-1 and a homolog of the NURD complex component Mi-2 act together to maintain germline-soma distinctions in C. elegans. Cell 111: 991-1002[CrossRef][Web of Science][Medline]

Vizir I, Thorlby G, Briarty G, Mulligan B (1995) Positional cloning of the primordia timing gene in Arabidopsis. In 6th International Conference on Arabidopsis Research.

Wade PA, Jones PL, Vermaak D, Wolffe AP (1998) A multiple subunit Mi-2 histone deacetylase from Xenopus laevis cofractionates with an associated Snf2 superfamily ATPase. Curr Biol 8: 843-846[CrossRef][Web of Science][Medline]

West MAL, Yee KM, Danao J, Zimmerman JL, Fischer RL, Goldberg RB, Harada JJ (1994) LEAFY COTYLEDON1 is an essential regulator of late embryogenesis and cotyledon identity in Arabidopsis. Plant Cell 6: 1731-1745[Abstract/Free Full Text]

Xu YL, Li L, Gage DA, Zeevaart JA (1999) Feedback regulation of GA5 expression and metabolic engineering of gibberellin levels in Arabidopsis. Plant Cell 11: 927-936[Abstract/Free Full Text]

Xu YL, Li L, Wu K, Peeters AJ, Gage DA, Zeevaart JA (1995) The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: molecular cloning and functional expression. Proc Natl Acad Sci USA 92: 6640-6644[Abstract/Free Full Text]

Xue Y, Wong J, Moreno GT, Young MK, Cote J, Wang W (1998) NURD, a novel complex with both ATP-dependent chromatin-remodeling and histone deacetylase activities. Mol Cell 2: 851-861[CrossRef][Web of Science][Medline]

Zhang Y, LeRoy G, Seelig HP, Lane WS, Reinberg D (1998) The dermatomyositis-specific autoantigen Mi2 is a component of a complex containing histone deacetylase and nucleosome remodeling activities. Cell 95: 279-289[CrossRef][Web of Science][Medline]


Related articles in Plant Physiol.:

Peter V. Minorsky
Plant Physiol. 2004 134: 881-882. [Full Text]  



This article has been cited by other articles:


Home page
Mol PlantHome page
H. Zhang and J. Ogas
An Epigenetic Perspective on Developmental Regulation of Seed Genes
Mol Plant, July 1, 2009; 2(4): 610 - 627.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
K. E. Nolan, S. Kurdyukov, and R. J. Rose
Expression of the SOMATIC EMBRYOGENESIS RECEPTOR-LIKE KINASE1 (SERK1) gene is associated with developmental change in the life cycle of the model legume Medicago truncatula
J. Exp. Bot., April 1, 2009; 60(6): 1759 - 1771.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
M.-J. Gao, D. J. Lydiate, X. Li, H. Lui, B. Gjetvaj, D. D. Hegedus, and K. Rozwadowski
Repression of Seed Maturation Genes by a Trihelix Transcriptional Repressor in Arabidopsis Seedlings
PLANT CELL, January 1, 2009; 21(1): 54 - 71.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
J. Verdier and R. D. Thompson
Transcriptional Regulation of Storage Protein Synthesis During Dicotyledon Seed Filling
Plant Cell Physiol., September 1, 2008; 49(9): 1263 - 1271.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
X. Zou, D. Neuman, and Q. J. Shen
Interactions of Two Transcriptional Repressors and Two Transcriptional Activators in Modulating Gibberellin Signaling in Aleurone Cells
Plant Physiology, September 1, 2008; 148(1): 176 - 186.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Zhang, S. D. Rider Jr., J. T. Henderson, M. Fountain, K. Chuang, V. Kandachar, A. Simons, H. J. Edenberg, J. Romero-Severson, W. M. Muir, et al.
The CHD3 Remodeler PICKLE Promotes Trimethylation of Histone H3 Lysine 27
J. Biol. Chem., August 15, 2008; 283(33): 22637 - 22648.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
X. Tang, A. Hou, M. Babu, V. Nguyen, L. Hurtado, Q. Lu, J. C. Reyes, A. Wang, W. A. Keller, J. J. Harada, et al.
The Arabidopsis BRAHMA Chromatin-Remodeling ATPase Is Involved in Repression of Seed Maturation Genes in Leaves
Plant Physiology, July 1, 2008; 147(3): 1143 - 1157.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
M. Tanaka, A. Kikuchi, and H. Kamada
The Arabidopsis Histone Deacetylases HDA6 and HDA19 Contribute to the Repression of Embryonic Properties after Germination
Plant Physiology, January 1, 2008; 146(1): 149 - 161.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
S. A. Casson and K. Lindsey
The turnip Mutant of Arabidopsis Reveals That LEAFY COTYLEDON1 Expression Mediates the Effects of Auxin and Sugars to Promote Embryonic Cell Identity
Plant Physiology, October 1, 2006; 142(2): 526 - 541.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
N. Imin, T. Kerim, J. J. Weinman, and B. G. Rolfe
Low Temperature Treatment at the Young Microspore Stage Induces Protein Changes in Rice Anthers
Mol. Cell. Proteomics, February 1, 2006; 5(2): 274 - 292.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
134/3/995    most recent
pp.103.030148v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Related articles in Plant Physiol.
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (31)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Henderson, J. T.
Right arrow Articles by Ogas, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Henderson, J. T.
Right arrow Articles by Ogas, J.
Agricola
Right arrow Articles by Henderson, J. T.
Right arrow Articles by Ogas, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY® THE PLANT CELL
Copyright © 2004 by the American Society of Plant Biologists