|
|
||||||||
|
First published online March 26, 2004; 10.1104/pp.103.037135 Plant Physiology 134:1672-1682 (2004) © 2004 American Society of Plant Biologists
Mechanism of Gene Expression of Arabidopsis Glutathione S-Transferase, AtGST1, and AtGST11 in Response to Aluminum Stress1Research Institute for Bioresources, Okayama University, 2201, Chuou, Kurashiki, Okayama 7100046, Japan
The gene expression of two Al-induced Arabidopsis glutathione S-transferase genes, AtGST1 and AtGST11, was analyzed to investigate the mechanism underlying the response to Al stress. An approximately 1-kb DNA fragment of the 5'-upstream region of each gene was fused to a -glucuronidase (GUS) reporter gene (pAtGST1::GUS and pAtGST11::GUS) and introduced into Arabidopsis ecotype Landsberg erecta. The constructed transgenic lines showed a time-dependent gene expression to a different degree in the root and/or leaf by Al stress. The pAtGST1::GUS gene was induced after a short Al treatment (maximum expression after a 2-h exposure), while the pAtGST11::GUS gene was induced by a longer Al treatment (approximately 8 h for maximum expression). Since the gene expression was observed in the leaf when only the root was exposed to Al stress, a signaling system between the root and shoot was suggested in Al stress. A GUS staining experiment using an adult transgenic line carrying the pAtGST11::GUS gene supported this suggestion. Furthermore, Al treatment simultaneously with various Ca depleted conditions in root region enhanced the gene expression of the pAtGST11::GUS in the shoot region. This result suggested that the degree of Al toxicity in the root reflects the gene response of pAtGST11::GUS in the shoot via the deduced signaling system. Both transgenic lines also showed an increase of GUS activity after cold stress, heat stress, metal toxicity, and oxidative damages, suggesting a common induction mechanism in response to the tested stresses including Al stress.
Al ions, especially Al3+, have a toxic effect on both plant and animal cells under low pH conditions. Inhibition of root growth is the major symptom of Al toxicity in plants and is accompanied by an accumulation of Al ions in the cell wall of roots (for review, see Kochian, 1995
Many Al-induced genes have been identified in Triticum aestivum, tobacco (Nicotiana tabacum), Arabidopsis, and other species. Some of these genes are induced by various stresses other than Al toxicity. For example, Al-induced wali genes were also induced by toxic levels of other metals, low Ca, and wounding (Snowden et al., 1995
It has been expected that some of the stress-induced genes can relate to the resistant mechanism(s) for the stress. For example, our Arabidopsis transgenic line carrying the parB gene showed phenotypes of resistance to Al, Na, and diamide stresses (Ezaki et al., 2000 In this study, we used the 5'-upstream region of the two AtGST genes, AtGST1 and AtGST11, as a model system for characterization of the mechanism of gene expression in response to Al stress.
Both AtGST1 and AtGST11 Genes Are Induced by Al Stress
Richards et al. (1998)
To clarify whether both of these two genes are Al responsive, the expression level of each gene in the whole plant was determined (Fig. 1
). Since these two genes have quite identical DNA sequences and northern analysis did not appear to be adequate to detect each expression level separately, a semiquantitative reverse transcription (RT)-PCR using gene specific primers was therefore carried out in this experiment. An approximately 2.1- and 3.7-fold higher expression of the AtGST1 and AtGST11 genes was detected by 4-h immersion in one-sixth Murashige and Skoog (MS) medium (Murashige and Skoog, 1962
Construction and Characterization of Transgenic Plants Carrying GUS Reporter Genes
To characterize the functions of the 5'-upstream region of these genes in Al stress, we fused approximately 1-kb upstream region of each gene (pAtGST1 and pAtGST11) to a One line selected from each group (14-1 and 15-1) was grown without Al for 8 to 10 d and then their roots were exposed to various concentrations of Al for 24 h. GUS enzyme activity in the whole plant was determined to estimate the gene expression pattern of each reporter gene for 24 h (Fig. 2A ). The GUS activity in the p35S::GUS line and in Ler (nontransformant, negative control) was kept high and low during the treatment, respectively. Since Arabidopsis has no domestic GUS gene, we concluded that the observed basal fluorescence in Ler derived from self-fluorescent materials in the plant. The basal GUS activity (0 µM Al, 0 h) in 14-1 or 15-1 was slightly higher than that in Ler, but much lower than that in the p35S::GUS line (17-2). In the pAtGST1::GUS line, induction was immediately observed by various Al treatments (50, 100, and 200 µM) and maximum activity was detected after a 2-h exposure. The pAtGST11::GUS line showed a slower response and a maximum induction of GUS after the 8-h Al treatment. The GUS activity in each Al-treated line gradually decreased after a 4-h or 12-h treatment. There was no clear relation between induction of GUS activity and Al concentration in the pAtGST1::GUS line, while the induction of enzyme activity by 200 µM Al was always lower than that by 50 or 100 µM Al in the pAtGST11::GUS transgenic line. To confirm the variation in the Al-dependent gene expression pattern, we exposed all constructed transgenic lines to 100 µM Al for 0, 2, or 8 h. As shown in Figure 2B, 7-2 carrying the pAtGST1::GUS gene showed a higher GUS activity after exposure to Al for 2 h than for 8 h, and the gene expression pattern was very similar to that in 14-1. The pAtGST11::GUS lines, 3-3 and 5-2, showed higher GUS activities after an 8-h exposure than after a 2-h exposure and their patterns were consistent with that of 15-1. These results indicated that both AtGST1 and AtGST11 are Al stress induced genes, but their expression patterns were different. As representatives of these lines, 14-1 and 15-1 were mainly used for further analyses.
To ascertain the location of gene expression in each transgenic plant, we examined the GUS activity by GUS staining (Fig. 3A ). The positive control line carrying the p35S::GUS gene (17-2) constitutively showed a high gene expression in root and leaf regions independent of the Al treatment, while the nontransformed plant (Ler) showed no GUS activity. This result supports our hypothesis that the basal fluorescent value detected in Ler in Figure 2A (0 µM Al, 0 h) is not 4-methylumbelliferyl- -d-glucuronide specific. Pale blue spots were observed in the leaf of the pAtGST1::GUS line (14-1) even at 0 h, and this basal level of GUS activity was maintained for 24 h without Al (we showed only the result of the treatment without Al for 2 h in Fig. 3A). Slightly darker blue spots were detected in leaves after 1 to 2 h of Al treatment in this line as the maximum induction. The pAtGST11::GUS line (15-1) showed a negligible GUS activity in the whole plant at 0 h, and a low activity was detected in the root or leaf of untreated plants after 8 h. While an increase of GUS activity in leaves was caused by exposure to 100 µM Al for 4 h, the maximum induction was seen after 8 h of exposure. Pale blue spots were also detected in the root tip region and in lateral roots after an 8-h exposure in this line. These blue spots in the pAtGST11::GUS line became pale blue after the 24-h treatment (data not shown).
Gene Expression in Response to Other Stresses
Plant GST genes are induced by various stresses, such as Al stress, oxidative stress, auxin treatment, and inorganic phosphate starvation (Takahashi and Nagata, 1992
Comparison of the Promoter Region of AtGST1 and AtGST11
A homology search for the nucleotide sequence between the 5'-upstream region of these two genes (1,053 bp from ATG site for AtGST1 and 1,079 bp for AtGST11) was performed using GENETIC MAC version 10 (Software Development, Tokyo), and the longest identical sequence was found between the 483-bp fragment (AtGST1) and the 417-bp fragment (AtGST11) in the 5'-upstream region (Fig. 5 ). Putative TATA boxes of these genes (TATAAA) were located in the 373- to 378-bp region (AtGST1) and 316- to 321-bp region (AtGST11), respectively. Motif sequences were also searched using GENETIC MAC version 10, but we could not find any motif sequences between the TATA box and ATG site in both genes. The AtGST1 promoter, but not the AtGST11 promoter, had the following three sequences: (1) a 32-bp sequence was repeated in the 12- to 43-bp region and in the 33- to 64-bp region (this sequence was seen only in the 29- to 58-bp in the AtGST11 promoter), (2) a 49-bp length of T-rich region in the 146- to 194-bp region, and (3) a 21-bp A-rich region in the 288- to 308-bp region. Moreover, two big gaps, designated
Proposed Signaling from Roots to Leaves by Al Stress Roots of the two pAtGST::GUS lines were exposed to Al stress, but the increase in GUS activity was mainly detected in leaves, suggesting an existence of Al-stress dependent signaling from the roots to leaves (Fig. 3A). To prove whether this hypothesis can be applied to adult plants as well as young seedlings, 25-d-old plants of the pAtGST11::GUS transgenic line (15-1) and two control lines were exposed to 100 µM Al for 0, 2, 4, 8, or 24 h (Fig. 6A ). The negative control line (Ler) and the positive control line (p35S::GUS, 17-2) showed no staining and strong uniform staining throughout the plants during the 24-h period, respectively (their results at 0 h were shown only in Fig. 6A). In the absence of Al, 15-1 line showed a negligible level of staining during the 24-h period. Blue spots were observed in rosette leaves after exposure to Al stress for 2 h and then became widespread after exposure for 4 h. New spots appeared over the whole plant including the top leaves after exposure to Al for 8 h. Blue spots disappeared from the top region and only pale blue spots were observed in rosette leaves after exposure to Al for 24 h (data not shown). Since the shoot was never directly exposed to Al stress, the blue spots on adult leaves after exposure to Al also strongly suggested a gene expression induced via a deduced signaling.
Most leaves of the p35S::GUS line (17-2) exposed to Al stress were uniformly stained to a similar degree as those not exposed to Al stress, while the staining in the Al-treated leaves of the two pAtGST::GUS lines (14-1 and 15-1) showed a slight variation. The potential differences in GUS staining at the organ level were examined by microscopic observation (Fig. 6B). The complete leaf area including veins was stained substantially and uniformly in the control p35S::GUS line (17-2). By contrast, gene expression of the pAtGST11::GUS in 15-1 line did not occur randomly, but always in some parts of veins and associated areas in leaves. Compared with the leaf slightly stained pale blue (Fig. 6B, pAtGST11::GUS, left), the number as well as the size of spots increased in leaves, which were stained darker (Fig. 6B, pAtGST11::GUS, middle and right). Furthermore, the staining pattern in the root after Al treatment was also different between 17-2 and 15-1 lines. The root tip and the central cylinder were uniformly stained in the 17-2 line, while root tips and/or other parts of roots (rather than central cylinder) were stained in 15-1 line.
Many studies have investigated a relation between Ca nutrition and Al toxicity. Influx of Ca ion and Ca homeostasis are rapidly inhibited at the root apex by Al treatment (Huang et al., 1992
In this study, we have characterized the gene expression mechanism of two Al-induced Arabidopsis GST genes (AtGST1 and AtGST11) under Al stress and other stresses by a combination of two approaches, a fluorescence metrical method and GUS staining. The results indicated that these two genes are induced by Al stress with a different degree. The AtGST1 gene was constitutively expressed at a low level and its maximum induction by 100 µM Al was seen after 2 h, mainly in leaves. This gene was highly induced by heat stress, cold stress, and oxidative damages rather than by Al stress. Expression of the AtGST11 gene was negligible in leaves under the nonstressed condition, and its steady expression was observed in leaves and roots after 8-h Al treatment. Response to the various stresses suggested that each gene has a common responsive promoter for the stresses. Our results are, moreover, consistent with the hypothesis that Al stress, heat stress, cold stress, and some metal toxicity simultaneously cause oxidative stress (Ezaki et al., 1996 A DNA database search revealed more than 30 GST genes in Arabidopsis. The AtGST1 and AtGST11 make a cluster with two other GST genes on chromosome I. The AtGST1 and AtGST11 genes are highly homologous to each other in the coding region and the 5'-upstream region, but they do not have high homology to other GST genes. These data strongly suggested that they encode similar GST isozymes and that these two genes can be classified into a small gene subfamily. Recently, we learned that the AtGST30 gene is also induced by Al stress (H. Koyama, Gifu University, Japan, personal communication), but there is no homology in the promoter sequence between our two AtGST genes and the AtGST30 gene. The pAtGST1 and pAtGST11 region probably carry sequence(s) for the response to Al stress, but the promoter sequences in other AtGST genes may also be responsive to this stress. We are now planning a macroarray analysis using all the reported GST genes in Arabidopsis to clarify whether the AtGST1 and AtGST11 genes are similar to the other AtGST genes in response to Al stress or not. This polygenetic analysis will be a worthwhile work to clarify whether the Al response mechanism of these two genes are distinct from those of other members.
Our GUS staining experiments provided insight into the nature of an Al stress-dependent signaling system in Arabidopsis. The plant organ directly exposed to Al stress and the plant organ where the gene expression could be observed were different in many cases. Specifically, the experiment using adult plants clearly indicted this point. The young seedlings of transgenic plants also showed similar responses to other stresses, such as H2O2, methyl viologen, and metal toxicity. One simple explanation is a common response for resistance against each stress. Alternatively, a stress-specific signal may be transferred from the organ exposed to the stress to the unexposed organ, which causes a gene induction of AtGST. Similarly, Larsen et al. (1997)
Plant Material and Growth Condition Plants of Arabidopsis ecotype Landsberg erecta (Ler) were grown under fluorescent illumination (approximately 50 µE m2 s1, 16 h of light and 8 h of darkness) at 22°C. A modified MS medium containing MS salts, B5 vitamins, and 10 g/L sucrose, adjusted to pH 5.7 was used for plant transformation. Another modified MS medium, in which MS salts and B5 vitamins were diluted six times (one-sixth MS medium), was used for Al stress (adjusted to pH 4.2) as well as other stresses (adjusted to pH 5.7). The one-sixth MS medium also contained 10 g/L sucrose as a carbon source.
Control plasmid pBI121 (Clontech Laboratories, Palo Alto, CA), carrying a p35S::GUS gene, was used for construction of a positive control transgenic plant and for construction of other GUS reporter plasmids. The 5'-upstream region of the AtGST1 gene (pAtGST1; 939 bp) or AtGST11 gene (pAtGST11; 1,077 bp) was prepared by PCR using genome DNA as a template. PCR was performed for 30 cycles (denature at 94°C for 60 s, anneal at 60°C for 60 s, and extension at 72°C for 90 s). Four DNA oligomers, P4F (TTGGAAGAGGGCATGTG) and P4R (GTTAATACTGTGTTTTTCTTGTTCTTA) for pAtGST1, and P5F (TTACCAGGGAGACGGAGAC) and P5R (TTGTTCTTAAAGCAAGGTGGA) for pAtGST11, were used as primers for PCR. The amplified fragments were sequenced to confirm their DNA sequences. These fragments were blunt-ended and then exchanged with the SmaI fragment of pBI121 carrying the p35S sequence. The generated plasmids were designated pEM14 (pAtGST1::GUS) and pEM15 (pAtGST11::GUS), respectively. Arabidopsis was transformed by the vacuum infiltration method described by Bechtold et al. (1993)
Total RNA was extracted using TRIzol Reagent (Life Technologies/GibcoBRL, Gaithersburg, MD). Semiquantitative RT-PCR was carried out using a kit, SuperScript First-Strand Synthesis System for RT-PCR (Life Technologies/GibcoBRL). To identify each PCR product separately, we used four oligomers (P2F, GGCAAGGACATGGCGAT; P2R, CCACTTTTATTACATCTTCTGATCGATA; P3F, TCCAAGGACATTGCGGG; P3R, CGGCACTTTATTCAATCTTCTGATT) as primers in the RT-PCR. P2F and P2R were used in PCR for the AtGST1 gene, while P3R and P3F were used for the AtGST11 gene. PCR was performed in the DNA Thermal Cycler programmed for 22, 24, 26, or 28 cycles at 94°C for 30 s, 60°C for 30 s, and 72°C for 30 s. To ensure that approximately equal amounts of RNA were used for amplification, we performed control PCR with mRNA encoding the
Plants were treated with Al stress and other stresses under sterile hydroponic conditions using plant growth racks. Sterilized seeds were incubated at 4°C for 4 d and then plated on a nylon-mesh square cup (mesh size, 300 µm; cup size, 40 mm [W] x 40 mm [L] x 10 mm [H]). This square cup was kept floating with a sponge support on 130 mL of one-sixth MS medium (pH 4.2) without Al. Roots of young seedlings grown for 8 to 10 d (with 1530 mm length of roots) were treated with various concentrations of Al. After the treatments, plants were washed several times with distilled water and then stored at 20°C. When adult plants were used, seeds were plated on 150 mL of one-sixth MS medium gelled with 1.5 g gelangum L1 in plant growth racks and cultured for 25 d. The plants were picked up from the gel carefully not to cause any physical damage and the root regions were exposed to fresh one-sixth MS medium with or without Al (0 or 100 µM) for various periods (0, 2, 4, 8, or 24 h). The treated plants were stored at 20°C.
The effects of depletion of Ca ions on the expression of the pAtGST11::GUS gene were examined by treating the roots of young seedlings (810-d-old) in the following four media for 16 h as pretreatment: (1) +Ca medium (pH 4.2); one-sixth MS medium (this medium initially contains 500 µM Ca), (2) +La medium (pH 4.2); one-sixth MS medium containing 50 µM La, (3) +EGTA medium (pH 4.2); one-sixth MS medium containing 3 mM EGTA, or (4) Ca medium (pH 4.2); one-sixth MS medium prepared without Ca ions. EGTA and La were used as a Ca chelator and a Ca flux blocker, respectively (Ryan and Kochian, 1993 For other metal toxicity and oxidative stresses, roots of young seedlings described above (810 d old) were exposed to one-sixth MS medium (pH 5.7) containing 100 µM CdCl2, 100 µM CuSO4, 100 mM NaCl, 200 µM ZnCl2, 1 mM diamide, 1 mM H2O2, or 40 µM methyl viologen for 0, 4, 8, or 24 h. For cold and heat stresses, young seedlings grown at 22°C were transferred to fresh one-sixth MS medium and then whole plants were exposed to 4°C or 37°C for 0, 4, 8, or 24 h.
According to the methods described by Jefferson et al. (1987) Sequence data from this article have been deposited with the EMBL/GenBank data libraries under accession numbers D17672, Y11727, and Y14251.
We thank Ms. Kanako Akashi for her technical assistance and Prof. Zdenko Rengel for his comments on our manuscript. We also thank Dr. Takayuki Sasaki for providing the PCR primers of the -tublin gene. Received December 2, 2003; returned for revision December 18, 2003; accepted December 18, 2003.
1 This work was supported by the Program for Promotion of Basic Research Activities for Innovative Biosciences (to H.M.), the Ministry of Education, Culture, Sports, Science and Technology [Grant-in-Aid for Scientific Research (C)(2) no. 13660066 to B.E., and Grant-in-Aid for Scientific Research (A)(2) no. 11306006 and no. 14206008 to H.M.], and two JSPS Joint Projects under the Japan-U.S. Cooperative Science program (to B.E. and to H.M.).
2 Present address: Graduate School of Medicine, Kyoto University, Konoe-cho, Yoshida, Sakyou-ku, Kyoto 6068501, Japan. Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.103.037135. * Corresponding author; e-mail bezaki{at}rib.okayama-u.ac.jp; fax 0864341249.
Bechtold N, Ellis J, Pelletier G (1993) In planta Agrobacterium-mediated gene transfer by infiltration of adult Arabidopsis thaliana plants. CR Acad Sci Ser III Sci Vie 316: 11941199 Cakmak I, Horst WJ (1991) Effect of aluminium on lipid peroxidation, superoxide dismutase, catalase and peroxidase activities in root tips of soybean (Glycine max). Physiol Plant 83: 463468[CrossRef] Cruz-Ortega R, Cushman JC, Ownby JD (1997) cDNA clones encoding 1, 3-beta-glucanase and a fibrin-like cytoskeletal protein are induced by Al toxicity in wheat roots. Plant Physiol 114: 14531460[Abstract] Delhaize E, Ryan PR, Randall PJ (1993) Aluminum tolerance in wheat (Triticum aestivum L.) II. Aluminum-stimulated excretion of malic acid from root apices. Plant Physiol 103: 695702[Abstract]
de la Fuente JM, Ramirez-Rodriguez V, Cabrera-Ponce JL, Herrera-Estrella L (1997) Aluminum tolerance in transgenic plants by alteration of citrate synthesis. Science 276: 15661568 Ezaki B, Yamamoto Y, Matsumoto H (1995) Cloning and sequencing of the cDNAs induced by aluminium treatment and Pi starvation in tobacco cultured cells. Physiol Plant 93: 1118[CrossRef] Ezaki B, Tsugita S, Matsumoto H (1996) Expression of a moderately anionic peroxidase is induced by aluminum treatment in tobacco cells: Possible involvement of peroxidase isozymes in aluminum ion stress. Physiol Plant 96: 2128 Ezaki B, Gardner RC, Ezaki Y, Kondo H, Matsumoto H (1998) Protective roles of two aluminum (Al) induced genes, HSP150 and SED1 of Saccharomyces cerevisiae, in Al and oxidative stresses. FEMS Microbiol Lett 159: 99105[CrossRef][Web of Science][Medline]
Ezaki B, Gardner RC, Ezaki Y, Matsumoto H (2000) Expression of aluminum-induced genes in transgenic Arabidopsis plants can ameliorate aluminum stress and/or oxidative stress. Plant Physiol 122: 657665
Huang JW, Shaff JE, Grunes DL, Kochian LV (1992) Aluminum effects on calcium fluxes at the root apex of aluminum-tolerant and aluminum-sensitive wheat cultivars. Plant Physiol 98: 230237
Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS fusions: Kinraide TB, Ryan PR, Kochian LV (1994) Al3+ -Ca2+ interactions in aluminum rhizotoxicity II. Evaluating the Ca2+displacement hypothesis. Planta 192: 104109 Kochian LV (1995) Cellular mechanisms of aluminum toxicity and resistance in plants. Annu Rev Plant Physiol Plant Mol Biol 46: 237260[CrossRef][Web of Science] Kwon SI, An CS (2001) Molecular cloning, characterization and expression analysis of a catalase cDNA from hot pepper (Capsicum annuum L.). Plant Sci 160: 961969[Medline] Larsen PB, Kochian LV, Howell SH (1997) Al inhibits both shoot development and root growth in als3, an Al-sensitive Arabidopsis mutant. Plant Physiol 114: 12071214[Abstract] Ma JF (2000) Role of organic acids in detoxification of aluminum in higher plants. Plant Cell Physiol 41: 383390 Ma JF, Ryan PR, Delhaize E (2001) Aluminum tolerance in plants and the complexing role of organic acids. Trends Plant Sci 6: 273278[CrossRef][Web of Science][Medline]
Ma Q, Rengel Z, Kuo J (2002) Aluminium toxicity in rye (Secale cereale): root growth and dynamics of cytoplasmic Ca2+ in intact root tips. Ann Bot (Lond) 89: 241244 Marshall J, Corzo A, Leigh RA, Sanders D (1994) Membrane potential-dependent calcium transport in right-side-out plasma membrane vesicles from Zea mays L. roots. Plant J 5: 683694[CrossRef] Matsumoto H (2000) Cell biology of aluminum toxicity and tolerance in higher plants. Int Rev Cytol 200: 146[CrossRef][Web of Science][Medline]
Matsumoto H, Morimura S, Takahashi E (1977) Binding of aluminium to DNA in pea root nuclei. Plant Cell Physiol 18: 987993
Milla MAR, Butler E, Huete AR, Wilson CF, Anderson O, Gustafson JP (2002) Expression sequence tag-based gene expression analysis under aluminum stress in rye. Plant Physiol 130: 17061716 Murashige T, Skoog F (1962) A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol Plant 15: 473497[CrossRef] Rengel Z (1992) Disturbance of cell Ca2+ homeostasis as a primary trigger of Al toxicity syndrome. Plant Cell Environ 15: 931938[CrossRef]
Rengel Z, Elliot DC (1992) Mechanism of aluminum inhibition of net 45Ca2+ uptake by Amaranthus protoplasts. Plant Physiol 98: 632638
Richards KD, Schott EJ, Sharma YK, Davis KR, Gardner RC (1998) Aluminum induces oxidative stress genes in Arabidopsis thaliana. Plant Physiol 116: 409418 Ryan PR, Kochian LV (1993) Interaction between aluminum toxicity and calcium uptake at the root apex in near-isogenic lines of wheat (Triticum aestivum L.) differing in aluminum tolerance. Plant Physiol 102: 975982[Abstract]
Sasaki T, Ezaki B, Matsumoto H (2002) A gene encoding multidrug resistance (MDR)-like protein is induced by aluminum and inhibition of calcium flux in wheat. Plant Cell Physiol 43: 177185 Snowden KC, Richards KD, Gardner RC (1995) Aluminum-induced genes: induction by toxic metals, low calcium, and wounding and pattern of expression in root tips. Plant Physiol 107: 341348[Abstract] Sugimoto M, Sakamoto W (1997) Putative phospholipid hydroperoxide glutathione peroxidase gene from Arabidopsis thaliana induced by oxidative stress. Genes Genet Syst 72: 311316[CrossRef][Web of Science][Medline]
Takahashi Y, Nagata T (1992) parB: An auxin-regulated gene encoding glutathione S-transferase. Proc Natl Acad Sci USA 89: 5659 Watt DA (2003) Aluminum-responsive genes in sugarcane: identification and analysis of expression under oxidative stress. J Exp Bot 385: 11631174
Yamamoto Y, Kobayashi Y, Matsumoto H (2001) Lipid peroxidation is an early symptom triggered by aluminum, but not the primary cause of elongation inhibition in pea poots. Plant Physiol 125: 199208
Zhang WH, Rengel Z, Kuo J, Yan G (1999) Aluminum effects on pollen germination and tube growth of Chamelaucium uncinatum. A comparison with other Ca2+ antagonists. Ann Bot (Lond) 84: 559564 This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|