| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
|
First published online April 30, 2004; 10.1104/pp.103.037283 Plant Physiology 135:173-182 (2004) © 2004 American Society of Plant Biologists Identification of a New Chloroplast Carbonic Anhydrase in Chlamydomonas reinhardtii1Department of Biological Sciences, Louisiana State University, Baton Rouge, Louisiana 70803
Carbonic anhydrases (CA) are zinc-containing metalloenzymes that catalyze the reversible hydration of CO2. The three evolutionarily unrelated families of CAs are designated  -,  -, and  -CA. Aquatic photosynthetic organisms have evolved different forms of CO2 concentrating mechanisms (CCMs) to aid Rubisco in capturing CO2 from the surrounding environment. One aspect of all CCMs is the critical roles played by various specially localized extracellular and intracellular CAs. Five CAs have previously been identified in Chlamydomonas reinhardtii, a green alga with a well-studied CCM. Here we identify a sixth gene encoding a -type CA. This new -CA, designated Cah6, is distinct from the two mitochondrial -CAs in C. reinhardtii. Nucleotide sequence data show that the Cah6 cDNA contains an open reading frame encoding a polypeptide of 264 amino acids with a leader sequence likely targeting the protein to the chloroplast stroma. We have fused the Cah6 open reading frame to the coding sequence of maltose-binding protein in a pMal expression vector. The purified recombinant fusion protein is active and was used to partially characterize the Cah6 protein. The purified recombinant fusion protein was cleaved with protease Factor Xa to separate Cah6 from the maltose-binding protein and the purified Cah6 protein was used to raise an antibody. Western blots, immunolocalization studies, and northern blots collectively indicated that Cah6 is constitutively expressed in the stroma of chloroplasts. A possible role for Cah6 in the CCM of C. reinhardtii is proposed.
Carbonic anhydrase (CA) is a zinc-containing metalloenzyme that catalyzes the reversible interconversion of CO2 and HCO3–. The enzyme was first discovered in human erythrocytes (Meldrum and Roughton, 1933  ) but has since been found in many organisms, including animals, plants, archaebacteria, and eubacteria (Hewett-Emmett and Tashian, 1996). CA plays an important role in many physiological functions that involve decarboxylation or carboxylation reactions, including both photosynthesis and respiration. It also participates in the transport of inorganic carbon (Ci) to actively photosynthesizing cells or away from actively respiring cells (Henry, 1996). The known CAs can be grouped broadly into three independent families (Hewett-Emmett and Tashian, 1996) called -CA, -CA, and -CA. These three families have no significant sequence identities and are an example of convergent evolution of catalytic function (Hewett-Emmett and Tashian, 1996). Most -CAs are active as monomers of about 30 kD with three His coordinating the zinc atom and are generally highly susceptible to inhibition by sulfonamide compounds (Moroney et al., 1985, 2001). All active -CAs are either monomers, or homo/heteromers with a His and two Cys residues that serve as the zinc coordinating residues (Bracey et al., 1994; Rowlett et al., 1994). The structure of the -CA is remarkably different from that of -CA or -CA (Alber and Ferry, 1994). The -CA functions as a trimer of identical subunits. As in -CAs, three His coordinate the zinc atom but the His residues are provided by two subunits. Like the -CAs, -CAs are highly sensitive to sulfonamide compounds (Moroney et al., 1985, 2001). Although the primary sequences of these CA families are different, the active sites of these three types of CAs contain Zn2+ and all of them employ a two-step catalytic mechanism (Lindskog, 1997).
Five CAs have previously been identified in the green alga Chlamydomonas reinhardtii (Moroney et al., 2001
Two
Screening of the Cosmid and cDNA Library for Genomic and cDNA Clones of Cah6
To find new
The PCR primers F4 and R5 were used on an indexed cosmid library to isolate a cosmid carrying the Cah6 gene (Colombo et al., 2002
The cosmid clones 72-E-6 and 29-D-12, and the 2.4-kb cDNA PCR product mentioned above were sequenced in both directions. The sequencing results were confirmed by the EST and genomic Chlamydomonas databases (http://www.biology.duke.edu/chlamy_genome/). The Cah6 gene is 2,886-bp long with 4 exons and 3 introns (Fig. 1). The exons range in size from 93 bp to 1,652 bp while the introns range from 75 bp to 189 bp long. The genomic and cDNA sequence of Cah6 can be obtained from the GenBank (accession nos. AY463238 and AY463239).
The Cah6 cDNA is 2,452-bp long and encodes a putative protein of 264 amino acids. It contains a translation start site at nucleotide 299 and a stop site at nucleotide 1,091. It has an extremely long 3' untranslated region (UTR) of more than 1,300 bp. Predictions based on various protein prediction programs (SORT P, CHLOR P, AND TARGET P) listed under ExPasy tools (http://ca.expasy.org/tools/#translate) indicate that the Cah6 protein is likely to be targeted to the chloroplast, as the protein contains a putative chloroplastic transit peptide of 39 amino acids. A protein database search using the Cah6 protein sequence showed that it is similar to -CAs from Escherichia coli, green algae, and higher plants. A multiple sequence alignment of the Cah6 protein with that of -CAs from other green algae and higher plants shows that it contains the characteristic one His and two Cys residues as zinc coordination residues, characteristic of enzymatically active -CAs (Fig. 2).
Cloning of the Cah6 in an Overexpression Vector Cah6 was cloned into the expression vector pMal to study the properties of Cah6 protein and to raise an antibody against it. Two different MalE-Cah6 recombinant overexpression constructs were generated. One contained the cDNA sequence coding for the full-length open reading frame (ORF) of the Cah6 protein and the other contained the cDNA sequence that would code for the mature Cah6 protein predicted by the web protein prediction programs. The SP2 + R4H primers and the MP + R4H primers were used to amplify the cDNA coding for the full-length and putative mature Cah6 proteins, respectively (Fig. 3A).
Amplified cDNAs were purified from the gel and cloned into the overexpression vector pMal-c2x (Fig. 3B) to generate two different types of recombinant constructs. An in-frame insertion of Cah6 with the sequence of MBP in the recombinant clone was verified by restriction enzyme digestion analyses and DNA sequencing. Two clones were selected out of the 25 recombinant clones of each type. Clone B48 had a cDNA insert coding for the full-length Cah6 protein while clone B3 had one coding for the mature Cah6 protein.
E. coli cells harboring the recombinant B48 and B3 recombinant constructs were induced with 1 mM isopropylthio-
Purification and Activity Assays of the Recombinant Cah6 Crude cell extracts from the B48 and B3 clones were used for CA activity assays. CA activity was detected in cell extracts of the induced B48 clone but not in that of the B3 clone. The B48 clone was selected for further study. This clone had the entire ORF of Cah6. The overexpressed recombinant Cah6 protein was purified by affinity chromatography using amylose resin following a protocol in the New England Biolabs technical catalog. Purified recombinant Cah6 was further concentrated by using a 100-kD cut-off centricon column.
The CA activity in the sample at each step of purification was assayed to check the purity of the Cah6 sample (Table I). The recombinant Cah6 protein was found to have a specific activity of 400 Wilbur-Anderson units (WAU)/mg. This calculation of specific activity was based on the total amount of recombinant fusion protein in the sample. CA activity assays were done using the method of Wilbur and Anderson (1948)
The fusion protein purified from the B48 clone was cleaved by the protease Factor Xa for 4 h at 23°C to separate Cah6 from the MBP. Factor Xa cleaved the fusion protein to yield 42 kD MBP and 31 kD Cah6 protein. It also nonspecifically cleaved the 31-kD Cah6 protein band to yield a 28-kD fragment. Factor Xa sometimes cleaves nonspecifically at other basic residues depending on the conformation of the protein substrate. The mature Cah6 protein starts with an Arg residue. This can explain the generation of the 28-kD fragment (similar in molecular mass to that of the mature Cah6 protein) by the nonspecific cleavage of 31 kD Cah6 protein. Use of common protease inhibitors like leupeptine did not prevent this nonspecific cleavage of Cah6. Purification and cleavage of the fusion protein was confirmed by performing SDS-PAGE (Fig. 5). There was no significant difference between the CA activities of the Factor Xa cleaved MBP-Cah6 fusion protein and undigested fusion protein. The 31-kD Cah6 protein band was excised from the gel to be used as an antigen for production of polyclonal Cah6 primary antibodies.
Western-Blotting and Northern-Blotting Analyses of Cah6 Expression
To test the specificity of the Cah6 antibody, Factor Xa (protease) cleaved MBP-Cah6 and purified MBP-Cah6 fusion proteins were separated by 12% SDS-PAGE and probed with the Cah6 antibody (Fig. 6). The antibody did not react with the MBP with induced E. coli cells containing only the pMal-c2x vector (data not shown). Proteins extracted from high CO2 and air acclimated D66 cells were separated by electrophoresis and probed with the Cah6 and mitochondrial
The primers X-9 and R5 were used to amplify an 826-bp PCR product from the cDNA core library (Fig. 8A). This 826-bp PCR product is contained within the 3' UTR of Cah6 and was used as a probe for northern-blot analyses using mRNA extracted from high and low CO2 acclimated C. reinhardtii (strain D66) cells grown in minimal medium. Twenty micrograms of RNA from both cell types were loaded on the RNA gel (Fig. 8B). Northern blotting shows that Cah6 is expressed under both low and high CO2 conditions, but is slightly up-regulated in cells acclimated to air levels of CO2 (Fig. 8C).
Immunolocalization of Cah6 Air acclimated D66 and CC-124 cells grown in minimal medium were used for immunolocalization of Cah6. C. reinhardtii cell sections were probed with the Cah6 antibody or the preimmune serum and observed under a transmission electron microscope (Fig. 9). Immunogold densities in different cell compartments are given in Table II. The immunogold densities in different cell compartments in sections were calculated by dividing the number of immunogold particles in a particular cell organelle with the area of that cell organelle. Immunolocalization results demonstrated that Cah6 is located in the stroma of the chloroplast (Fig. 9A) and is 4-fold more abundant in the area around the pyrenoid (Fig. 9B) compared to the other areas of the stroma. C. reinhardtii cell sections probed with the preimmune serum served as negative controls for the immunolocalization study (Fig. 9C).
Partial Characterization of the Cah6 Activity
The effects of sulfonamide and anion inhibitors on the CA activity of recombinant Cah6 were studied. Table III shows the inhibition of recombinant Cah6 by sulfonamides and anions. Cah6 was comparatively less inhibited by the sulfonamides and more inhibited by the anions azide and cyanide than bovine CAII, which is an
-CAs were first recognized in photosynthetic organisms (Burnell et al., 1990; Fawcett et al., 1990) but later have been identified in eubacteria, cyanobacteria, yeast, micro-algae, and higher plants. They play important physiological roles in these organisms. For example, a carboxysomal -CA in cyanobacteria, coded by icfA gene, converts HCO3– to CO2 (Badger and Price, 1992). This increases the concentration of CO2 at the site of Rubisco, ensuring efficient CO2 fixation. In Saccharomyces cerevisiae, deletion of the -CA-like gene NCE103 causes an oxygen-sensitive growth defect (Götz et al., 1999). It has also been found that the tobacco salicylic acid-binding protein 3 (SABP3) is a chloroplast -CA that exhibits antioxidant activity and plays a role in the hypersensitive defense response (Slaymaker et al., 2002). In E. coli, the cynT gene that codes for a -CA is a part of the cyn operon. CO2 is produced in the reaction of cyanate with HCO3–, and this -CA recycles the CO2 back to HCO3–, so that it does not diffuse out of the cell (Guilloton et al., 1993). Finally, a -CA gene identified in Corynebacterium glutamicum has been shown to be essential for achieving normal growth under atmospheric conditions (Mitsuhashi et al., 2003). These researchers have shown that the effect of this -CA is most likely due to its ability to maintain favorable intracellular HCO3– levels, particularly during exponential growth phases and during L-lysine overproduction, both of which are conditions of higher HCO3– demand (Mitsuhashi et al., 2003).
Two nearly identical
Researchers in several laboratories have tried to assay CA activity in C. reinhardtii chloroplasts. Using mass-spectrometric measurements of 18O exchange, Sültemeyer et al. (1995)
Here we report the identification of a nuclear gene encoding a chloroplastic
CA activity was detected in cell extracts of the induced B48 clone but not in that of the B3 clone of E. coli expressing the Cah6 gene. The B48 clone contains the entire ORF of Cah6, whereas the B3 clone had only the cDNA coding for the putative mature Cah6 protein. One explanation for the lack of activity is that Cah6 is cleaved at a point different than that predicted by the different target prediction programs. A second possible explanation for the lack of activity of the protein from B3 clone is that the first amino acid of the mature Cah6 was eliminated to facilitate cloning. During the cloning of the putative mature Cah6, the codon for Arg was substituted as Factor Xa does not cleave any protein that starts with an Arg after the Factor Xa recognition sequence (Ile-[Glu-Asp]-Gly-Arg). Thus the mature Cah6 protein in the B3 clone started with a Ser instead of an Arg residue. It is therefore possible that this change caused the recombinant fusion protein to become insoluble or misfold. It is clear however that Cah6 is an active CA as the full-length protein had a specific activity well within the normal range found for
Western- and northern-blotting analyses show that Cah6 is constitutively expressed and slightly up-regulated under low CO2 conditions. Immunolocalization shows that Cah6 is localized in the stroma of the chloroplast and is not present in the pyrenoid. In Chlamydomonas, 90% of the Rubisco is localized inside the pyrenoid under low CO2 conditions (Borkhsenious et al., 1998
A mutant of C. reinhardtii, cia5, which requires elevated levels of CO2 for growth, fails to induce CCM and does not synthesize any of the low CO2 inducible mitochondrial and periplasmic CAs along with other low CO2 inducible polypeptides (Manuel and Moroney, 1988 ). It is deficient in a putative transcription factor coded by the Cia5 gene (Fukuzawa et al., 2001; Xiang, et al., 2001). Katzman et al. (1994) used a 14C assay to measure the CA activity in the chloroplasts of cia5 and wild-type cells of Chlamydomonas and found that the CA activity of cia5 is almost identical to that in wild-type cells. Cah3 is an -CA that is localized to the lumenal side of thylakoids in the chloroplast (Karlsson et al., 1998). The Cah3 and the Cah6 antibodies specifically detect the Cah3 and Cah6 protein in the cia5 cells (data not shown). So it appears that both Cah3 and Cah6 contributed to the total CA activity measured by Katzman et al. (1994) in the chloroplasts of cia5. This also suggests that Cah6 expression is probably not under the regulation of the Cia5 gene. Immunoblotting and northern-blotting analysis (using Cah3 and Cah6 specific probes) of cia5 and wild-type cells of C. reinhardtii could show the expression pattern of Cah6 gene in this mutant and could confirm if these genes are under the regulation of the Cia5 gene. Generation of mutants of Cah6 could help to confirm the physiological role of Cah6 in photosynthesis and CCM.
There has been a surge of interest in CAs from plants and algae over the past decade. This interest began with the discovery of the
Strains and Media
Chlamydomonas reinhardtii strain D66 (nit2–, cw15, mt+) was obtained from Rogene Schnell, University of Arkansas (Little Rock, AR; Schnell and LeFebvre, 1993
Extraction of total RNA from low CO2 and high CO2 acclimated D66 cells and RNA gel-blot analyses were performed by standard procedures (Sambrook et al., 1989
Plasmid and cosmid DNA was purified using a combination of the standard ethanol precipitation method (Sambrook et al., 1989
Homology searches (against Chlamydomonas EST and the full database) were performed using the BLAST server (http://www.ncbi.nlm.nih.gov/BLAST; Altschul et al., 1997
A cDNA core library (in bacteriophage
To obtain wild-type genomic clones of the Cah6 gene, a PCR-based screen of an indexed cosmid library was used (Pollock et al., 2003
The mitochondrial
Cah6 was cloned into the pMal-c2x overexpression vector (NEB, Beverly, MA) and fused to the MalE gene that encodes MBP. Two different pMal-Cah6 recombinant overexpression vectors were constructed. One contained the cDNA sequence coding for the ORF of Cah6 protein and the other contained the cDNA sequence that would code for the putative mature Cah6 protein. SP2 (5' A TGGGATGCGGTGCCAGCGTG 3') + R4H (5'-ATATAAGCTTTTGCGCCATGAAGTCCCT AA-3') primers and MP (5'- AGCAACCGCAGCAGCCTT-3') + R4H primers were used to amplify the cDNA coding for the full-length and mature Cah6 protein, respectively. SP2 + M1RH and MP + M1RH primers yielded a PCR product of 1.1 kb and 979 bp, respectively. A high fidelity DNA polymerase (Platinum Pfx DNA polymerase from Invitrogen, Carlsbad, California) was used for PCRs. The vector was double digested with the XmnI and HindIII. Amplified cDNAs were purified from the DNA gel using Qiagen spin columns and were digested with HindIII. Ligation of the insert to the overexpression vector pMal-c2x vector was performed following the protocol in the NEB technical manual. Transformations of DH5
Selected clones of Cah6 were grown at 37°C in 2 L Luria-Bertani medium + Glc (0.2%) + Amp (100 µg mL–1) cultures on a rotary shaker. Glc was added to the growth medium to repress the maltose genes on the chromosome of the E. coli host, one of which codes for amylase that can degrade the amylose on the affinity resin that is used for purification. The cells were induced for 2 h with 1 mM isopropylthio- Recombinant proteins were cleaved from the MBP by digestion with Factor Xa. Fifty micrograms of the recombinant protein was digested by 1 µg of Factor Xa enzyme in the Factor Xa digestion buffer (20 mM Tris-HCl, 100 mM NaCl, and 2 mM CaCl2 [pH 8.0]) at 23°C for 4 to 6 h. Purification and Factor Xa digestion of the recombinant protein were verified using SDS-PAGE.
Factor Xa digested purified recombinant proteins were separated on a 12% gel by SDS-PAGE at 15 mA for 18 to 20 h. The 31-kD Cah6 protein band was excised carefully from the polyacrylamide gel. The gel pieces were shipped to Strategic BioSolutions (Ramona, CA) for production of antibody. Antibodies were raised against Cah6 proteins by a standard 70-d protocol using two pathogen-free rabbits. Approximately 1.6 mg of the Cah6 protein was used to raise the antibody.
CA activity was assayed electrometrically using a modification of the Wilbur-Anderson method (1948). The samples were assayed at 4°C by adding 50 to 200 µL of the test sample to 3.5 mL of 20 mM 4-(2-hydroxyethyl)-1-piperazine propane sulfonic acid (EPPS, pH 8.0). The reaction was initiated by addition of 1.5 mL of ice-cold CO2 saturated water. The time required for the pH drop from 7.7 to 6.3 was measured. The activity of the test sample was calculated using the equation: WAU = t0/t–1 where t is the time required for the pH change when the test sample is present and t0 is the time required for the pH change when the buffer is substituted for the test sample. Bovine CAII (Sigma, St. Louis) was used as a positive control. Both Factor Xa digested and undigested purified Cah6 fusion proteins were used for activity assays. The effects of the sulfonamide inhibitors ethoxyzolamide and acetazolamide and the anions azide and cyanide on CA activities of recombinant Cah6 were studied. I50 was determined by plotting the percentage of inhibition versus the concentration of the inhibitor. Sodium salts of azide and potassium salts of cyanide were used. All the inhibitors were purchased from Sigma.
For protein analyses and western blots, cells were harvested, washed twice with fresh medium, and resuspended in 10 mM Tris-HCl, 10 mM EDTA, and 150 mM NaCl, pH 7.5. Proteins were separated on 12% and 15% polyacrylamide gels (0.8% bis-acrylamide) as described previously (Laemmli, 1970 Immunoblotting was performed as described in the protocol from Bio-Rad. Cah6 primary antibody was used to probe proteins from high and low CO2 acclimated D66 as well as the Factor Xa digested and undigested purified MBP-Cah6 fusion proteins. The Cah6 antibody was diluted with the antibody buffer (Tris-buffered saline + 0.005% Tween 20 + 1% bovine serum albumin, pH 7.4) in the ratio of 1:1,000, before being used as a probe. The secondary antibody used for western blotting was conjugated to the enzyme horseradish peroxidase (Bio-Rad) and was diluted at a ratio of 1:3,000 with the antibody buffer. Western blots were developed following the protocol from Bio-Rad using a mixture of the horse radish peroxidase color development reagent (Bio-Rad) in ice-cold 100% methanol (20 mL), Tris-buffered saline (80 mL, pH 7.4, and 30% H2O2, 60 µL).
Air acclimated D66 or CC-124 cells were fixed in a mixture of 1% OsO4, 2% formaldehyde, and 0.5% glutaraldehyde in a 1:1 ratio for 15 min. The sample was then fixed for an additional 15 min in 1% OsO4, 2% formaldehyde, 0.5% glutaraldehyde, and 0.1 mM sodium cacodylate buffer. Materials were rinsed with distilled water and stained with 0.5% uranyl acetate for 30 min. After this, excess stain was rinsed and the samples were dehydrated in ethyl alcohol series. Samples were then infiltrated and embedded in LR White resin (EMS, Fort Washington, PA). Embedded tissues were sectioned with a DuPont Sorvall microtome (Wilmington, DE). The sections were 70-µm thick.
The immunocytochemical procedure was similar to the method of Borkhsenious et al. (1998)
The CO2 concentration in the growth chambers was measured using an infrared gas analyzer (Analytical Development, Hoddesdon, UK), which reads at an accuracy of ±2%. The CO2 concentration was checked at least once every day, while the alga was growing in the high and low CO2 growth chambers. Protein concentration was determined by the method of Lowry et al. (1951) Sequence data from this article have been deposited with the EMBL/GenBank data libraries under accession numbers AY463238 and AY463239.
The authors thank Steve Pollock for helping with the northern blot and Catherine Mason and Patricia Moroney for their critical reading of the manuscript. We also thank Göran Samuelsson, Umeå University, Sweden, for providing us with the mitochondrial -CA primary antibody. Received December 4, 2003; returned for revision January 23, 2004; accepted January 23, 2004.
1 Supported by National Science Foundation (grants IBN–9904425 and IBN–0212093 to J.V.M.) and the Howard Hughes Memorial Institute undergraduate research program.  Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.103.037283. * Corresponding author; e-mail btmoro{at}lsu.edu; fax 1–225–578–2597.
Alber BE, Ferry JG (1994) A carbonic anhydrase from the archaeon Methanosarcina thermophila. Proc Natl Acad Sci USA 91: 6909–6913
Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25: 3389–3402 Amoroso G, Weber C, Sültemeyer DF, Fock HP (1996) Intracellular carbonic anhydrase activities in Dunaliella tertiolecta (Butcher) and Chlamydomonas reinhardtii (Dangeard) in relation to inorganic carbon concentration during growth: further evidence for the existence of two distinct carbonic anhydrases associated with the chloroplast. Planta 199: 177–184
Arnon DI (1949) Copper enzymes in isolated chloroplasts. Polyphenoloxidase in Beta vulgaris. Plant Physiol 24: 1–15 Badger MR, Price GD (1992) The CO2 concentrating mechanism in cyanobacteria and microalgae. Physiol Plant 84: 606–615[CrossRef]
Borkhsenious ON, Mason CB, Moroney JV (1998) The intracellular localization of ribulose-1, 5-bisphosphate carboxylase/oxygenase in Chlamydomonas reinhardtii. Plant Physiol 116: 1585–1591 Bracey MH, Christiansen J, Tovar P, Cramer SP, Bartlett SG (1994) Spinach carbonic anhydrase: investigation of the zinc-binding ligands by site-directed mutagenesis, elemental analysis and EXAFS. Biochemistry 33: 13126–13131[CrossRef][Medline]
Burnell JN, Gibbs MJ, Mason JG (1990) Spinach chloroplastic carbonic anhydrase-nucleotide sequence analysis of cDNA. Plant Physiol 92: 37–40 Colombo SL, Pollock SV, Eger KA, Godfrey AC, Adams JE, Mason CB, Moroney JV (2002) Use of the bleomycin resistance gene to generate tagged insertional mutants of Chlamydomonas reinhardtii that require elevated CO2 for optimal growth. Funct Plant Biol 29: 231–241[CrossRef]
Eriksson M, Karlsson J, Ramazanov Z, Gardeström P, Samuelsson G (1996) Discovery of an algal mitochondrial carbonic anhydrase: molecular cloning and characterization of a low-CO2-induced polypeptide in Chlamydomonas reinhardtii. Proc Natl Acad Sci USA 93: 12031–12034
Eriksson M, Villand P, Gardeström P, Samuelsson G (1998) Induction and regulation of expression of a low-CO2-induced mitochondrial carbonic anhydrase in Chlamydomonas reinhardtii. Plant Physiol 116: 637–641
Fawcett TW, Browse JA, Volokita M, Bartlett SG (1990) Spinach carbonic-anhydrase primary structure deduced from the sequence of a cDNA clone. J Biol Chem 265: 5414–5417
Fujiwara S, Fukuzawa H, Tachiki A, Miyachi S (1990) Structure and differential expression of two genes encoding carbonic anhydrase in Chlamydomonas reinhardtii. Proc Natl Acad Sci USA 87: 9779–9783
Fukuzawa H, Fujiwara S, Yamamoto Y, Dionisio-Sese ML, Miyachi S (1990) cDNA cloning, sequence, and expression of carbonic anhydrase in Chlamydomonas reinhardtii- regulation by environmental CO2 concentration. Proc Natl Acad Sci USA 87: 4383–4387
Fukuzawa H, Miura K, Ishizaki K, Kucho K, Saito T, Kohinata T, Ohyama K (2001) Ccm1, a regulatory gene controlling the induction of a carbon-concentrating mechanism in Chlamydomonas reinhardtii by sensing CO2 availability. Proc Natl Acad Sci USA 98: 5347–5352
Giordano M, Norici A, Forssen M, Eriksson M, Raven J (2003) An anaplerotic role for mitochondrial carbonic anhydrase in Chlamydomonas reinhardtii. Plant Physiol 132: 2126–2134 Götz R, Gnann A, Zimmermann FK (1999) Deletion of the carbonic anhydrase-like gene NCE103 of the yeast Saccharomyces cerevisiae causes an oxygen-sensitive growth defect. Yeast 15: 855–864[CrossRef][Web of Science][Medline]
Guilloton MB, Lamblin AF, Kozliak EI, Gerami-Nejad M, Tu C, Silverman D, Anderson PM, Fuchs JA (1993) A physiological role for cyanate-induced carbonic anhydrase in Escherichia coli. J Bacteriol 175: 1443–1451
Hanson DT, Franklin LA, Samuelsson G, Badger MR (2003) The Chlamydomonas reinhardtii cia3 mutant lacking a thylakoid lumen-localized carbonic anhydrase is limited by CO2 utilization by Rubisco and not PSII function in vivo. Plant Physiol 132: 2267–2275 Henry RP (1996) Multiple roles of carbonic anhydrase in cellular transport and metabolism. Annu Rev Physiol 58: 523–538[CrossRef][Web of Science][Medline]
Hewett-Emmett D, Tashian RE (1996) Functional diversity, conservation, and convergence in the evolution of the Holden M (1976) Chlorophylls. In TW Goodwin, ed, Chemistry and Biochemistry of Plant Pigments. Academic Press, London, pp 2–37 Johansson IM, Forsman C (1993) Kinetic-studies of pea carbonic-anhydrase. Eur J Biochem 218: 439–446[Web of Science][Medline] Karlsson J, Clarke AK, Chen ZY, Hugghins SY, Park YI, Husic HD, Moroney JV, Samuelsson G (1998) A novel alpha-type carbonic anhydrase associated with the thylakoid membrane in Chlamydomonas reinhardtii is required for growth at ambient CO2. EMBO J 17: 1208–1216[CrossRef][Web of Science][Medline] Katzman GL, Carlson SJ, Marcus Y, Moroney JV, Togasaki RK (1994) Carbonic anhydrase activity in isolated chloroplasts of wild-type and high-CO2-dependent mutants of Chlamydomonas reinhardtii as studied by a new assay. Plant Physiol 105: 1197–1202[Abstract] Kulp D, Haussler D, Reese MG, Eeckman FH (1996) A generalized hidden Markov model for the recognition of human genes in DNA. Proc Int Conf Intell Systems Mol Biol 4: 134–142 Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680–685[CrossRef][Medline] Lindskog S (1997) Structure and mechanism of carbonic anhydrase. Pharmacol Ther 74: 1–20[CrossRef][Web of Science][Medline]
Lowry OH, Rosebrough NJ, Fart AL, Randall RJ (1951) Protein measurement with Folin phenol reagent. J Biol Chem 193: 265–275
Manuel LJ, Moroney JV (1988) Inorganic carbon accumulation by Chlamydomonas reinhardtii: new proteins are made during adaptation to low CO2. Plant Physiol 88: 491–496 Meldrum NU, Roughton FJW (1933) Carbonic anhydrase. Its preparation and properties. J Physiol 80: 113–142 Mitsuhashi S, Ohnishi J, Hayashi M, Ikeda M (2003) A gene homologous to beta-type carbonic anhydrase is essential for the growth of Corynebacterium glutamicum under atmospheric conditions. Appl Microbiol Biotechnol (in press) Moroney JV, Bartlett SG, Samuelsson G (2001) Carbonic anhydrases in plants and algae. Plant Cell Environ 24: 141–153
Moroney JV, Husic HD, Tolbert NE (1985) Effect of carbonic anhydrase inhibitors on inorganic carbon accumulation by Chlamydomonas reinhardtii. Plant Physiol 79: 177–183
Pollock SV, Colombo SL, Prout DL Jr, Godfrey AC, Moroney JV (2003) Rubisco activase is required for optimal photosynthesis in the green alga Chlamydomonas reinhardtii in a low CO2 atmosphere. Plant Physiol 133: 1854–1861 Purton S, Rochaix JP (1994) Complementation of a Chlamydomonas reinhardtii mutant using a genomic cosmid library. Plant Mol Biol 24: 533–537[CrossRef][Web of Science][Medline] Raven JA (2001) A role for mitochondrial carbonic anhydrase in limiting CO2 leakage from low CO2-grown cells of Chlamydomonas reinhardtii. Plant Cell Environ 24: 261–265[CrossRef] Rowlett RS, Chance MR, Wirt MD, Sidelinger DE, Royal JR, Woodroffe M, Wang YFA, Saha RP, Lam MG (1994) Kinetic and structural characterization of spinach carbonic-anhydrase. Biochemistry 33: 13967–13976[CrossRef][Medline] Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual, Ed 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Schnell RA, Lefebvre PA (1993) Isolation of the Chlamydomonas reinhardtii regulatory gene NIT2 by transposon tagging. Genetics 134: 737–747[Abstract] Silflow CD (1998) Organization of the nuclear genome. In JD Rochaix, M Goldschmidt-Clermont, S Merchant, eds, The Molecular Biology of Chloroplasts and Mitochondria in Chlamydomonas. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp 25–40
Slaymaker DH, Navarre DA, Clark D, del Pozo O, Martin GB, Klessig D (2002) The tobacco salicylic acid binding protein 3 (SABP3) is the chloroplast carbonic anhydrase which exhibits antioxidant activity and plays a role in the hypersensitive defense response. Proc Natl Acad Sci USA 99: 11640–11645
Sueoka N (1960) Mitotic replication of deoxyribonucleic acids in Chlamydomonas reinhardtii. Proc Natl Acad Sci USA 46: 83–91 Sültemeyer DF, Price GD, Yu JW, Badger MR (1995) Characterization of carbon dioxide and bicarbonate transport during steady state photosynthesis in the marine cyanobacterium Synechococcus strain PCC 7002. Planta 197: 597–607[Web of Science] Villarejo A, Rolland N, Martinez F, Sültemeyer D (2001) A new chloroplast envelope carbonic anhydrase activity is induced during acclimation to low inorganic carbon concentrations in Chlamydomonas reinhardtii. Planta 213: 286–295[CrossRef][Medline]
Wilbur KM, Anderson NG (1948) Electrometric and colorimetric determination of carbonic anhydrase. J Biol Chem 176: 147–154
Xiang YB, Zhang J, Weeks DP (2001) The Cia5 gene controls formation of the carbon concentrating mechanism in Chlamydomonas reinhardtii. Proc Natl Acad Sci USA 98: 5341–5346 This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|
TOP
ABSTRACT
RESULTS
) was obtained from the Chlamydomonas Genetics Center at Duke University (Durham, NC). This core library was made from cDNAs prepared from CC-1690 cells grown to mid-log phase in TAP (acetate-containing) medium in the light, TAP medium in the dark, high salt (HS; minimal) medium in ambient levels of CO2, and HS medium bubbled with 5% CO2. cDNAs were cloned into the lambda Zap II (Stratagene, La Jolla, CA) in the EcoRI (5') and XhoI (3') sites. This cDNA library was amplified following the protocol given in the Stratagene manual. Cah6 primers F4 (5'-GCACGAGGCAACATTAAACA-3') and R5 when used on the cDNA core library yielded a PCR product of 2446 bp. This product codes for the full-length Cah6 protein. 
