|
|
||||||||
|
First published online May 7, 2004; 10.1104/pp.104.040477 Plant Physiology 135:357-363 (2004) © 2004 American Society of Plant Biologists Molecular Aspects of Plant Adaptation to Life in the Chernobyl Zone1,[w]Department of Biological Sciences, University of Lethbridge, Lethbridge, Alberta, Canada T1K 3M4 (I.K., O.K.); Vavilov Institute of General Genetics, Russian Academy of Sciences, 117809 Moscow, Russia (V.A.); and Division of Biochemical Toxicology, National Center for Toxicological Research, Jefferson, Arkansas 72079 (I.P.)
With each passing year since the Chernobyl accident of 1986, more questions arise about the potential for organisms to adapt to radiation exposure. Often this is thought to be attributed to somatic and germline mutation rates in various organisms. We analyzed the adaptability of native Arabidopsis plants collected from areas with different levels of contamination around the Chernobyl nuclear power plant from 1986 to 1992. Notably, progeny of Chernobyl plants resisted higher concentrations of the mutagens Rose Bengal and methyl methane sulfonate. We analyzed the possible molecular mechanisms of their resistance to mutagens and found a more than 10-fold lower frequency of extrachromosomal homologous recombination, significant differences in the expression of radical scavenging (CAT1 and FSD3) and DNA-repair (RAD1 and RAD51-like) genes upon exposure to mutagens (Rose Bengal and x-rays), and a higher level of global genome methylation. This data suggests that adaptation to ionizing radiation is a complex process involving epigenetic regulation of gene expression and genome stabilization that improves plants' resistance to environmental mutagens.
Constant exposure to mutagens, such as UV and ionizing radiation, chemicals, heat, drought, and cold, forces plants to either adapt or die. Nuclear testing, leakage of radioactive wastes, and nuclear accidents such as the Chernobyl disaster have compelled scientists to confront the effects of chronic ionizing radiation exposure on all organisms (Dubrova et al., 1996
Ionizing radiation is known to have general effects on plant growth and development, ranging from stimulatory effects at very low doses, increasingly harmful effects for vegetative growth at intermediate levels, and pronounced decreases in reproductive fitness and yields at high radiation levels. The severity of the effects varies across different plants and is dependent upon the species, age, plant morphology, physiology, and genome organization (Holst and Nagel, 1997
Previous adaptation studies were conducted using primarily a single generation of laboratory plants. Studies of multiple generations exposed to radiation were rarely undertaken due to the difficulties of creating a suitable model to study the effects of chronic exposure. Almost 18 years have passed since the enormous release of radioactivity from the Chernobyl accident (International Atomic Energy Agency, 1996 We evaluated the resistance of chronically exposed plants to DNA-damaging agentsMMS, free radical-producing agent Rose Bengal (RB), as well as to ionizing radiation. In parallel, we studied the genome stability of the exposed plants using transient recombination assay and assayed the expression of genes involved in DNA repair and genome maintenance. Finally, we investigated epigenetic changes, such as methylation pattern induced by prolonged chronic exposure in several generations. Such detailed analysis of several generations of plants exposed to radiation provides some insight into possible molecular mechanisms of plant adaptation to chronic radiation exposure.
Collection of Plants from Chernobyl Exclusion Zone
Seeds from several groups of naturally growing Arabidopsis plants were collected from the areas with different contamination levels around the Chernobyl nuclear power plant each year from 1986 to 1992. Table I shows the radiation exposure to
Chernobyl Arabidopsis Plants Are Changed in Their Sensitivity to Mutagens
To analyze whether any possible adaptation processes have taken place in these plants, we evaluated their resistance to methyl methane sulfonate (MMS), often referred to as radiomimetic agent (Singer, 1986 Interestingly, we found that the progeny of plants grown in areas with high contamination were more resistant to mutagens, surviving concentrations that killed the progeny of control plants grown in the area with very low contamination (10 µM RB; Fig. 1A). Moreover, the progeny of plants that were collected from the same experimental plot (either Tolsty Les or Chernobyl) in years 1991 and 1992 were more resistant to mutagens than the progeny of plants collected in 1989 and 1990 (Fig. 1). Statistically significant differences were observed between plants collected in Tolsty Les from 1989 to 1992 grown on MMS (120140 µM) and RB (6.010.0 µM) and between plants collected in Chernobyl from 1989 to 1991 grown on 140 µM MMS and 10 µM RB (P < 0.001 in all cases, ANOVA; Supplemental Tables I and II). With respect to the MMS treatment data, it is important to remember that alkylation is a primary source of DNA modification; therefore, the damaging effects that MMS produces are not the same as those produced by radiation.
Genome Stability of the Exposed Plants: Study of Homologous Recombination Frequency
A possible mechanism of plant adaptation to radiation is genome stabilization (Kovalchuk et al., 2003b
To analyze the HR frequency, we used a transgenic recombination reporter uidA gene coding for
Expression of Stress-Response Genes The increased resistance to mutagens we observed could also be due to changes in expression of the important housekeeping and DNA-repair genes acquired by plants over several generations of radiation exposure. This may lead to stronger plants, more capable of tackling environmental challenges.
We analyzed the expression of oxidative stress-responsive (CAT and FSD3) and DNA-repair (Rad1 and Rad54-like) genes upon treatment of control, CH90, and TL90 plants with RB (100 µM for 2 h), and x-rays (1 Gy). FSD3, a superoxide dismutase, and CAT, a catalase, are the major reactive oxygen species scavenging enzymes (Mittler, 2002
We found CAT and FSD3 genes in CH90 and TL90 plants to be expressed at lower levels in noninduced conditions but to be similarly up-regulated by RB as compared to control plants (Table II). Expression of CAT and FSD3 genes after x-ray exposure was unchanged in CH90 but was induced in TL90 plants and repressed in control plants. A very different result was obtained after x-ray irradiation: a relatively small induction of Rad1 and Rad54-like was observed in control plants, whereas no change was observed in CH90 plants. By contrast, progeny of plants collected from Tolsty Les in 1990 showed the strong induction of all genes tested. This suggests that plants of Tolsty Les that were exposed to stronger radiation for several generations built a much stronger response compared to plants exposed to lower radiation in the Chernobyl plot. Interestingly, although Rad54 was up-regulated, the extrachromosomal HR frequency was not affected (Fig. 2). Since Rad54 exerts its activity through chromatin remodeling, its enhanced expression could not stimulate recombination of exogenously supplied
As suggested from our previous studies, plants may regulate their adaptation to environmental stimuli through an epigenetic control mechanism (Kovalchuk et al., 2003b
Ionizing radiation is known to affect plants in many ways and to varying extents, depending upon the species, plant physiology, and, of course, genome organization (Holst and Nagel, 1997 We present the results of a natural open-field radiation adaptation experiment in the Chernobyl areaa unique natural laboratory to study plant adaptation to radiation. We studied the molecular basis of adaptation using Arabidopsis plants grown in the vicinity of the Chernobyl reactor for several generations. We took an integrated approach and studied physiological, genetic, and epigenetic changes in several generations of these plants.
The exposed Arabidopsis plants presumably have developed different, efficient mechanisms to tolerate chronic radiation exposure. Mutations, although important and powerful tools of adaptation, are definitely not the sole basis for development of plant adaptive responses, as most of them are deleterious. Many excellent papers appearing during the last 5 to 7 years have demonstrated the harmful effects of Chernobyl radiation on the genetic apparatus of plant, animal, and human populations exposed for different periods of time (Syomov et al., 1992 The major finding of the study was the extremely low recombination levels in Chernobyl plants. This could serve as an indicator of adaptation, since low frequency of recombination may prevent excessive genome rearrangements. Another possibility, however, is that plants grown at contaminated areas shift their strand break repair mechanism toward non-HR, a more efficient but more error-prone mechanism. Higher recombination in plants collected from later years from Tolsty Les and Chernobyl plots could suggest that these plants started adapting to the environmental conditions. It is also possible that plants with higher recombination levels do not germinate as efficiently as plants with lower recombination levels.
Although the picture of adaptation is far from complete, we think that epigenetic regulation resulting in genome stability plays a major role in adaptation. Hypermethylation in this case could be considered as a stress response and a general defense mechanism of plants that prevents genome rearrangements. Indeed, we observed significantly lower levels of transgene rearrangements in progeny of plants collected from contaminated areas. The fact that DNA methylation and homologous recombination exhibited a tendency to slowly return to control levels (Fig. 2) in plants collected in later years suggests that plants acquired yet another unidentified mechanism of protection. However, it is possible that this is a reflection of a decrease in the level of contamination present (Table I). Similar parallels were found in pine trees native to the Chernobyl zonea tendency to release the hypermethylation was observed with the decrease of absorbed dose by the plants (Kovalchuk et al., 2003b
Plant Material
Arabidopsis seeds were collected in various experimental plots of the exclusion zone around the Chernobyl reactor from 1987 to 1992. The radiological parameters of the experimental plots are given in Table I. The
Total DNA was prepared from whole plants using Nucleon PhytoPure total DNA isolation kit (Amersham Life Science, Arlington Heights, IL) in accordance with the manufacturer's protocol.
Total RNA was extracted using TRIzol reagent (Gibco-BRL, Cleveland) in accordance with the manufacturer's protocol. After quantification, 1 µg of RNA was taken for cDNA preparation (You-Prime-First-Strand, ready-to-go PCR beads; Amersham, Buckinghamshire, UK). The following primers were used for amplification: FSD3 (At5g23310) forward 5'-TTGTGTTGTGACGACAAGC-3', reverse 5'-ATCAATCTGCTCAAGAACACC-3'; CAT (X64271) forward 5'-TATGGAACAACAACTCCTCC-3', reverse 5'-TCTCTGAGTATCGGCATAGG-3'; AtRAD1 (AF089003) forward 5'-AATGGATGCTTGTCTCAAGGAG-3', reverse 5'-TTCCATTTTGGTGCCTCTTCC-3'; AtRAD54-like (At2g02090) forward 5'-GGTGAGGATTTGTTGTTAGAGG-3', reverse5'-GCTGAAATCAGAATCCTCTGC-3'. Real time PCR was performed in a total volume of 25 µL using 1 µL of the first-strand cDNA synthesis mixture as a template, 300 nM forward primer, 300 nM reverse primer, and 12.5 µL of 2x SYBRGreen PCR Master Mix (Applied Biosystems, Foster City, CA). The duplicate reactions were carried out with the 1:3 and 1:15 dilutions of the first-strand cDNA synthesis mixture. A SmartCycler (Cepheid, Sunnyvale, CA) was used to perform the PCR cycles, and fluorescence was quantified against standards. The cDNAs were amplified under the following conditions: (1) 95°C for 5 min for one cycle; (2) 94°C for 30 s, 58°C for 30 s, 72°C for 1 min for 30 cycles; and (3) 72°C for 10 min for one cycle. The melting temperatures were estimated for every gene product. The standards for the expression of each gene were amplified from the cDNA of following dilutions: 1:1, 1:4, 1:20, and 1:100. Equal loading of each amplified sample was determined by the control AtActin-1 PCR product (forward primer 5'TGGACAAGTCATAACCATCGGAGC3'; reverse primer 5'TGTGAACAATCGATGGACCTGAC3').
The assay was performed essentially as described (Rossi et al., 1993
DNA was prepared from control and Chernobyl plants and digested overnight with 10-fold excess of HpaII endonuclease according to manufacturer's protocol (New England Biolabs, Beverly, MA). Additional DNA aliquot was incubated without restriction enzyme addition and served as background control. The single nucleotide extension reaction was performed on a 25 µg of DNA, 1x PCR bufferII, 1.0 mM MgCl2, 0.25 units of Amplitaq DNA polymerase (Perkin-Elmer, Foster City, CA), and [3H]dCTP (57.4 Ci/mmol; NEN, Boston). The reaction mixtures were incubated at 56°C for 1 h and then placed on ice. Duplicate aliquots from each reaction were placed on Whatman DE-81 ion-exchange filters (Clifton, NJ) and washed three times with sodium phosphate buffer (pH 7.0) at the room temperature. The filters were dried and processed by scintillation counting. Background label incorporation was subtracted from enzyme-digested samples, and results were expressed as relative [3H]dCTP incorporation/1 µg of DNA or as percent change from control (Pogribny et al., 1999
Most of the statistical procedures used here were described by Sokal and Rohlf (1995)
We thank Alicja Ziemienowicz and Crystal Snyder for critical comments on the manuscript and Paula Burke for help with methylation analysis. Received February 4, 2004; returned for revision March 8, 2004; accepted March 9, 2004.
1 This work was supported by the Natural Sciences and Engineering Research Council of Canada (Establishment Grant to O.K.) and the Alberta Heritage Foundation for Science and Engineering Research (Alberta Ingenuity Grants).
[w] The online version of this article contains Web-only data. Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.104.040477. * Corresponding author; e-mail olga.kovalchuk{at}uleth.ca; fax 1 403 329 2242.
Abramov VI, Fedorenko OM, Shevchenko VA (1992) Genetic consequences of radioactive contamination for populations of Arabidopsis. Sci Total Environ 112: 1928[Medline] Arkhipov NP, Kuchma ND, Askbrant S, Pasternak PS, Musica VV (1994) Acute and long-term effects of irradiation on pine (Pinus sylvestris) stands post-Chernobyl. Sci Tot Environ 157: 383386[CrossRef] Critchlow S, Jackson S (1998) DNA end-joining: from yeast to man. Trends Biochem Sci 23: 394402[CrossRef][ISI][Medline] Dmitrieva SA (1996) The adaptation of natural plant populations to chronic irradiation due to the accident at the Chernobyl Atomic Electric Power Station. Tsitol Genet 30: 38 Dubrova YE, Nesterov VN, Krouchinsky NG, Ostapenko VA, Neumann R, Neil DL, Jeffreys AJ (1996) Human minisatellite mutation rate after the Chernobyl accident. Nature 380: 683686[CrossRef][Medline] Ellegren H, Lindgren G, Primmer CR, Møller AP (1997) Fitness loss and germline mutations in barn swallows breeding in Chernobyl. Nature 389: 593596[CrossRef][Medline] Gallego F, Fleck O, Li A, Wyrzykowska J, Tinland B (2000) AtRAD1, a plant homologue of human and yeast nucleotide excision repair endonucleases, is involved in dark repair of UV damages and recombination. Plant J 21: 507518[CrossRef][ISI][Medline]
Gorbunova V, Levy AA (1997) Non-homologous DNA end-joining in plant cells is associated with deletions and filler DNA insertions. Nucleic Acids Res 25: 46504657 Gros L, Saparbaev MK, Laval J (2002) Enzymology of the repair of free radicals-induced DNA damage. Oncogene 21: 89058925[CrossRef][ISI][Medline]
Herlocher ML, Maassab HF, Webster RG (1993) Molecular and biological changes in the cold-adapted "master strain" A/AA/6/60 (H2N2) influenza virus. Proc Natl Acad Sci USA 90: 60326036 Holland JJ, de la Torre JC, Steinhauer DA (1992) RNA virus populations as quasispecies. Curr Top Microbiol Immunol 176: 120[ISI][Medline] Holst RW, Nagel DJ (1997) Radiation effects on plants. In W Wang, JW Gorsuch, JS Hughes, eds, Plants for Environmental Studies. Lewis Publishers, Boca Raton, FL, pp 3781 International Atomic Energy Agency (1996) Proceedings of the International Conference: One Decade after Chernobyl: Summing up the Consequences of the Accident. Austria Center, April 812, 1996, Vienna Izrael YA, De Cort M, Jones AR, Nazarov IM, Fridman SD, Kvasnikova EV, Stukin ED, Kelly GN, Matveenko II, Poumeiko YM, et al. (1997) The atlas of Caesium-137 contamination of Europe after the Chernobyl accident. In A Karaoglu, G Desmet, GN Kelly, HG Menzel, eds, The Radiological Consequences of the Chernobyl Accident. ECSC-EC-EAEC, Brussels, pp 110 Kim SY, Kwon OJ, Park JW (2001) Inactivation of catalase and superoxide dismutase by singlet oxygen derived from photoactivated dye. Biochimie 83: 437444[Medline] Kirik A, Salomon S, Puchta H (2000) Species-specific double-strand break repair and genome evolution in plants. EMBO J 19: 55625566[CrossRef][ISI][Medline] Kovalchuk I, Kovalchuk O, Arkhipov A, Hohn B (1998) Transgenic plants are sensitive bioindicators of nuclear pollution caused by the Chernobyl accident. Nat Biotechnol 16: 10541059[Medline] Kovalchuk I, Kovalchuk O, Hohn B (2000a) Genome-wide variation of the somatic mutation frequency in transgenic plants. EMBO J 19: 44314438[CrossRef][ISI][Medline] Kovalchuk O, Burke P, Arkhipov A, Kuchma N, James SJ, Kovalchuk I, Pogribny I (2003b) Genome hypermethylation in Pinus silvestris of Chernobyl a mechanism for radiation adaptation? Mutat Res 529: 1320[ISI][Medline] Kovalchuk O, Dubrova Y, Arkhipov A, Hohn B, Kovalchuk I (2000b) Wheat mutation rate after Chernobyl. Nature 407: 583584[CrossRef][Medline] Kovalchuk O, Kovalchuk I, Arkhipov A, Hohn B, Dubrova Y (2003a) Extremely complex pattern of microsatellite mutation in the germline of wheat exposed to the post-Chernobyl radioactive contamination. Mutat Res 525: 93101[Medline] Mittler R (2002) Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci 7: 405410[CrossRef][ISI][Medline] Puchta H, Swoboda P, Hohn B (1995) Induction of homologous DNA recombination in whole plants. Plant J 7: 203210[CrossRef] Pogribny I, Yi P, James SJ (1999) A sensitive new method for rapid detection of abnormal methylation patterns in global DNA and within CpG islands. Biochem Biophys Res Commun 262: 624628[CrossRef][ISI][Medline] Rossi L, Escudero J, Hohn B, Tinland B (1993) Efficient and sensitive assay for T-DNA-dependent transient gene expression. Plant Mol Biol Rep 11: 220229 Satoh C, Kodaira M (1996) Effects of radiation on children. Nature 383: 226[Medline] Shevchenko VV, Grinikh LI (1990) Cytogenetic effects in native populations of Crepis tectorum exposed to chronic irradiation in the vicinity of the Chernobyl Nuclear Power Station. Induction of chromosome aberrations during the first 2 years following the accident. Radiobiologiia 30: 728734[Medline] Shkvarnikov PK (1990) A cytological study of plants growing under exposure to different radiation levels. Tsitol Genet 24: 3337[Medline]
Singer B (1986) O-Alkyl pyrimidines in mutagenesis and carcinogenesis: occurrence and significance. Cancer Res 46: 48794885
Smith J, Baldeyron C, De Oliveira I, Sala-Trepat M, Papadopoulo D (2001) The influence of DNA double-strand break structure on end-joining in human cells. Nucleic Acids Res 29: 47834792 Sokal R, Rohlf FJ (1995) Biometry. Freeman, New York Swoboda P, Gal S, Hohn B, Puchta H (1994) Intrachromosomal homologous recombination in whole plants. EMBO J 13: 484489[ISI][Medline] Syomov AB, Ptitsyna SN, Sergeeva SA (1992) Analysis of DNA strand break induction and repair in plants from the vicinity of Chernobyl. Sci Total Environ 112: 18[CrossRef] Walbot V (1985) On the life strategies of plants and animals. Trends Genet 1: 165170 Ziablitskaia EI, Geras'kin SA, Udalova AA, Spirin EV (1996) An analysis of the genetic sequelae of the contamination of winter rye crops by the radioactive fallout from the Chernobyl Atomic Electric power station. Radiats Biol Radioecol 36: 498505[Medline] Related articles in Plant Physiol.:
This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY | THE PLANT CELL | |
|---|---|---|---|